ID: 1170863490 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:20130758-20130780 |
Sequence | CTGTAGGAGATTTGTTCCAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1170863490_1170863493 | 9 | Left | 1170863490 | 20:20130758-20130780 | CCTGTGGAACAAATCTCCTACAG | No data | ||
Right | 1170863493 | 20:20130790-20130812 | GCTGAACTGCCATGCTAATTTGG | No data | ||||
1170863490_1170863495 | 21 | Left | 1170863490 | 20:20130758-20130780 | CCTGTGGAACAAATCTCCTACAG | No data | ||
Right | 1170863495 | 20:20130802-20130824 | TGCTAATTTGGAGTCTCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1170863490 | Original CRISPR | CTGTAGGAGATTTGTTCCAC AGG (reversed) | Intronic | ||