ID: 1170863492

View in Genome Browser
Species Human (GRCh38)
Location 20:20130774-20130796
Sequence GTTCAGCAGCACCACACTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170863492_1170863495 5 Left 1170863492 20:20130774-20130796 CCTACAGTGTGGTGCTGCTGAAC No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data
1170863492_1170863493 -7 Left 1170863492 20:20130774-20130796 CCTACAGTGTGGTGCTGCTGAAC No data
Right 1170863493 20:20130790-20130812 GCTGAACTGCCATGCTAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170863492 Original CRISPR GTTCAGCAGCACCACACTGT AGG (reversed) Intronic