ID: 1170863492 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:20130774-20130796 |
| Sequence | GTTCAGCAGCACCACACTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170863492_1170863495 | 5 | Left | 1170863492 | 20:20130774-20130796 | CCTACAGTGTGGTGCTGCTGAAC | No data | ||
| Right | 1170863495 | 20:20130802-20130824 | TGCTAATTTGGAGTCTCCTTTGG | No data | ||||
| 1170863492_1170863493 | -7 | Left | 1170863492 | 20:20130774-20130796 | CCTACAGTGTGGTGCTGCTGAAC | No data | ||
| Right | 1170863493 | 20:20130790-20130812 | GCTGAACTGCCATGCTAATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170863492 | Original CRISPR | GTTCAGCAGCACCACACTGT AGG (reversed) | Intronic | ||