ID: 1170863495

View in Genome Browser
Species Human (GRCh38)
Location 20:20130802-20130824
Sequence TGCTAATTTGGAGTCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170863489_1170863495 29 Left 1170863489 20:20130750-20130772 CCAGGGGACCTGTGGAACAAATC No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data
1170863492_1170863495 5 Left 1170863492 20:20130774-20130796 CCTACAGTGTGGTGCTGCTGAAC No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data
1170863488_1170863495 30 Left 1170863488 20:20130749-20130771 CCCAGGGGACCTGTGGAACAAAT No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data
1170863490_1170863495 21 Left 1170863490 20:20130758-20130780 CCTGTGGAACAAATCTCCTACAG No data
Right 1170863495 20:20130802-20130824 TGCTAATTTGGAGTCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170863495 Original CRISPR TGCTAATTTGGAGTCTCCTT TGG Intronic