ID: 1170864297

View in Genome Browser
Species Human (GRCh38)
Location 20:20139331-20139353
Sequence TCTAAGCTTTATTAGCTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 1, 2: 10, 3: 59, 4: 379}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170864293_1170864297 13 Left 1170864293 20:20139295-20139317 CCTTGGCGGAGCCTGTGCTGGGA 0: 1
1: 0
2: 0
3: 16
4: 252
Right 1170864297 20:20139331-20139353 TCTAAGCTTTATTAGCTTCATGG 0: 1
1: 1
2: 10
3: 59
4: 379
1170864294_1170864297 2 Left 1170864294 20:20139306-20139328 CCTGTGCTGGGAAGATGCCTGAA 0: 1
1: 0
2: 2
3: 30
4: 259
Right 1170864297 20:20139331-20139353 TCTAAGCTTTATTAGCTTCATGG 0: 1
1: 1
2: 10
3: 59
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170864297 Original CRISPR TCTAAGCTTTATTAGCTTCA TGG Intronic
900254176 1:1688597-1688619 TCTAAGCTTTATTTTTTTCTGGG - Intronic
900262892 1:1741539-1741561 TCTAAGCTTTATTTTTTTCTGGG - Intronic
905699633 1:40001560-40001582 TTTAAGCTTCCTTAGCTTCATGG + Intergenic
906903335 1:49861845-49861867 TCTAAGCTGTATCTGCTTTAGGG - Intronic
908265771 1:62377819-62377841 TGTAAGCTTTGTTGGCTTCATGG - Intergenic
908979957 1:69943736-69943758 CTTAAGCTTCATTAACTTCAAGG + Intronic
909082392 1:71128590-71128612 TTCAAGCTGTATTAGCTTCAAGG - Intergenic
909420775 1:75462340-75462362 TCTAAGCTGTATTTGTTTTAGGG - Intronic
909842229 1:80342407-80342429 TAAAATCTTTATTTGCTTCAAGG + Intergenic
909883902 1:80915676-80915698 TCTACACTTTATTTGCCTCATGG + Intergenic
909966469 1:81917857-81917879 TTTAAGATTCATTACCTTCATGG - Intronic
910553437 1:88502494-88502516 GCTAAGCTCTATTAGCTTCATGG + Intergenic
910716403 1:90236060-90236082 TCTAAGACTTACTGGCTTCAGGG - Intergenic
911536555 1:99106740-99106762 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
912598677 1:110904595-110904617 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
912664501 1:111566981-111567003 CTTAAGCTTCATTAGCGTCATGG + Intronic
913297135 1:117333046-117333068 TCTATCCTTTCTTACCTTCAAGG + Intergenic
914404549 1:147358032-147358054 TCTAAGCTGTCTGAGCTCCATGG + Intergenic
915008819 1:152665691-152665713 TCTTCGCTTTTATAGCTTCAGGG + Intergenic
915010135 1:152677871-152677893 TCTTTGCTTTCATAGCTTCAGGG + Intergenic
915182573 1:154075473-154075495 TCTCTGCTTAGTTAGCTTCATGG - Intronic
916513815 1:165497108-165497130 TCTAGGCCTTAGTAGCCTCAGGG - Intergenic
916909352 1:169328847-169328869 TCTAAGCTATATCTGCTTTAAGG - Intronic
917003175 1:170384058-170384080 TCTAAGAGTTATTAACTTTAAGG - Intergenic
918353682 1:183684509-183684531 TCTTAGCTTTCTGGGCTTCATGG + Intronic
918565478 1:185925559-185925581 CTTTAGCTTTATTGGCTTCATGG + Intronic
918941423 1:191003487-191003509 TCTAAGCTTTACTAGCATTTTGG - Intergenic
920154937 1:203940931-203940953 CTGAAGCTTCATTAGCTTCATGG + Intergenic
921042731 1:211449065-211449087 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
922246621 1:223805292-223805314 TCTAAGCTTTTTAGTCTTCAAGG - Intronic
922872248 1:228912188-228912210 GCTTAGCTTTGTTAACTTCATGG + Intergenic
923415349 1:233751826-233751848 TCAGAGCTTTATTCTCTTCATGG + Intergenic
923831241 1:237559900-237559922 TCTCAGTTTCATTAGCTTCATGG + Intronic
924409258 1:243785996-243786018 CCTATGCTTTATGAGCTTCAAGG + Intronic
924833741 1:247627764-247627786 TCTAAGCTGTGTTGGCTTTAGGG + Intergenic
1064670571 10:17709605-17709627 CCTATCCTTTATTTGCTTCAAGG - Intronic
1064925803 10:20567536-20567558 CCTGAGTTTTCTTAGCTTCAGGG - Intergenic
1065766961 10:29039190-29039212 TCTTAGTTTTATCAGCTTCTTGG + Intergenic
1065929022 10:30462853-30462875 CTGAAGCTTCATTAGCTTCATGG - Intergenic
1066084629 10:31964043-31964065 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1067528704 10:47055044-47055066 TGGAAGCATCATTAGCTTCAAGG + Intergenic
1068020283 10:51573570-51573592 TTTAAGGTTTATTAGCTTCATGG - Intronic
1069147940 10:64918440-64918462 TCTAAGCTATATCTGCTTTAAGG - Intergenic
1069933431 10:71899259-71899281 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1070399802 10:76043647-76043669 CATGAGCTTTATTAGCTCCATGG + Intronic
1071018202 10:81022192-81022214 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1071427321 10:85571947-85571969 TTTAAGCTGTCTGAGCTTCAGGG - Intergenic
1072396756 10:95050721-95050743 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1072844173 10:98810563-98810585 TATGAGCTTCATTAACTTCACGG + Intronic
1073678962 10:105680767-105680789 TCTAAGCTATATCTGCTTTAGGG - Intergenic
1073697124 10:105882282-105882304 TAAAAGCTTAATTAGGTTCAGGG - Intergenic
1074332284 10:112527009-112527031 TCCAAGCTTTATTGGTATCAAGG - Intronic
1078091564 11:8267717-8267739 CCTAAACTTCATTAGCTTCAAGG + Intronic
1078691013 11:13580333-13580355 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1078717557 11:13854473-13854495 TCTAAGCTTTGTTTGCTTCTTGG + Intergenic
1079038077 11:17037731-17037753 TCCAAGCTGTATTTGCTTTAGGG - Intergenic
1079294900 11:19224386-19224408 TCTAAGATATATTAACTTCTAGG - Exonic
1079729184 11:23919863-23919885 TCTAAGCTGTATCTGCTTCAGGG + Intergenic
1080084083 11:28258069-28258091 TCTAAGCTATATCTGCTTAATGG + Intronic
1080479994 11:32637814-32637836 TTTAAGATTTATTAGCATAAAGG - Intronic
1081005718 11:37735287-37735309 TAGAAGATTTATTAGATTCATGG + Intergenic
1081680726 11:45000549-45000571 TCTCAGCCTTCTTAGCATCATGG + Intergenic
1081840739 11:46199749-46199771 CTGAAGCTTCATTAGCTTCAGGG - Intergenic
1081975853 11:47234297-47234319 TATAAGCTTTGTCTGCTTCAGGG + Intronic
1082678998 11:56145164-56145186 CTTAACCTTTATTAGCTGCATGG - Intergenic
1085183778 11:74558444-74558466 TTTAAGCTTCATTAGTTTCAAGG + Intronic
1085411460 11:76293175-76293197 TGTAGACTTTATTAGCTTCTGGG - Intergenic
1085945745 11:81270241-81270263 TCTCAGACCTATTAGCTTCAAGG + Intergenic
1086201799 11:84212460-84212482 TCTAAGTTTCATTTGCTTAAAGG + Intronic
1086574287 11:88320980-88321002 ACTAAGCCTTATTATATTCAGGG + Intronic
1088361885 11:109000401-109000423 TTTAAGCTGTATTTGCTTTAGGG + Intergenic
1088434698 11:109798744-109798766 TCTAATATTTATTAGCTTTGTGG + Intergenic
1089937212 11:122376424-122376446 TCTAAGCTGTATGTGCTTTAGGG - Intergenic
1092268340 12:7001193-7001215 CTGAAGCTTTTTTAGCTTCATGG - Intronic
1092326648 12:7538684-7538706 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
1094741784 12:33297470-33297492 TCCAAGCATTATTGGCTTTAAGG + Intergenic
1095212663 12:39511215-39511237 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1095260095 12:40087768-40087790 TCTCAGCTTTATCCACTTCATGG - Intronic
1096223381 12:49847180-49847202 CCTGAGGTTTATTAGCTTCATGG + Intergenic
1097768146 12:63548966-63548988 CATTAGCTTCATTAGCTTCATGG - Intergenic
1097784505 12:63744031-63744053 CGTTAGCTTCATTAGCTTCATGG - Intergenic
1098188329 12:67922126-67922148 TTTAAGCTTTACCAGCTTCCAGG - Intergenic
1099026814 12:77474903-77474925 TTTAAGCTTCAGTAGCTTCATGG - Intergenic
1101076339 12:101133381-101133403 TCTAAGATATAGTTGCTTCATGG + Intergenic
1101824954 12:108212955-108212977 TCTAAGCCTTATTAGCCTTGAGG + Intronic
1101824957 12:108212970-108212992 TCTCAGCCTTAGTAGCCTCAAGG - Intronic
1102795608 12:115686787-115686809 CTTAAGCTTCATTAGCTTTAAGG + Intergenic
1102859894 12:116326653-116326675 TCTAGCATTTATTAGCCTCAGGG - Intergenic
1103144806 12:118586016-118586038 TCTGATCTATATTAACTTCATGG - Intergenic
1104103011 12:125633610-125633632 TCTAAGCTGTATCTGCTTTAGGG + Intronic
1107228310 13:38077182-38077204 TCCAAGCTGTATTTGCTTCAGGG - Intergenic
1107552071 13:41486774-41486796 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1107783667 13:43932640-43932662 GTTAAGTTTCATTAGCTTCATGG + Intergenic
1108849628 13:54711820-54711842 TATAACCTTTATAACCTTCAAGG + Intergenic
1111067717 13:83118915-83118937 CTTAAAGTTTATTAGCTTCATGG + Intergenic
1111945352 13:94659341-94659363 CTTAAGATTTGTTAGCTTCAGGG + Intergenic
1112025219 13:95405464-95405486 TCTCAGCTATATCAGCCTCATGG - Intergenic
1112213125 13:97401247-97401269 CTTAAGCTTCATTAGTTTCATGG + Intergenic
1112572851 13:100609205-100609227 TCTGAGCTCTCTTAGCTTCAAGG - Intronic
1114138289 14:19879803-19879825 CCTAAGCTTTACAAGCTTTATGG - Intergenic
1115291296 14:31775845-31775867 CTTAAGCTTTATTAGCTTCATGG - Intronic
1115308939 14:31960136-31960158 TTTAAACTTCCTTAGCTTCACGG + Intergenic
1115486452 14:33915458-33915480 TTTAAGCTTGAATAGCTACAAGG + Intergenic
1116043789 14:39718004-39718026 GGTAAGCATTATTAGCTTAAAGG + Intergenic
1116058006 14:39886822-39886844 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1116407193 14:44580158-44580180 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1117159247 14:52972847-52972869 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1117264786 14:54075987-54076009 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1117298569 14:54401096-54401118 TCTAGGCATTATTATCTTTAAGG + Intronic
1117482978 14:56167859-56167881 TCTAAGCTATATCGGCTTTAGGG + Intronic
1117523807 14:56577555-56577577 CCTAAGCTTCATTAGCTTCATGG - Intronic
1117566148 14:56995554-56995576 CTTCACCTTTATTAGCTTCAGGG - Intergenic
1120296695 14:82650431-82650453 TTTAAGCTTCATTAGCTTCATGG - Intergenic
1120674883 14:87409251-87409273 CTTAAGCCTTAGTAGCTTCAAGG - Intergenic
1120808287 14:88776073-88776095 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1123183172 14:106488886-106488908 TCAACACTTTATTATCTTCAAGG - Intergenic
1124081248 15:26500491-26500513 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1124949974 15:34308811-34308833 CTTAAGCTCTATTATCTTCATGG - Intronic
1125383545 15:39112983-39113005 TCTAAGCTATTTTTGATTCAGGG - Intergenic
1126169318 15:45681413-45681435 TATAAGCTTAATTAACCTCAGGG - Intronic
1126420241 15:48464835-48464857 TCTAATCTTTGTTAACTCCATGG + Intronic
1127012574 15:54645653-54645675 TCTAAGCTGTATATGCTTTAGGG - Intergenic
1127757022 15:62102765-62102787 TGTAGGCTTCATTATCTTCATGG - Intergenic
1128115180 15:65100779-65100801 TCTACCCTTTATTACCTCCAGGG + Intronic
1130429448 15:83831857-83831879 CTTAAGCTTCATTAACTTCATGG + Intronic
1130767546 15:86886966-86886988 TCAAAGCTCTATTAACTTAAGGG + Intronic
1131005954 15:88978646-88978668 CTTAAGCTTCATTAGCTTCATGG - Intergenic
1131129160 15:89884468-89884490 TCTAGGCTTTATTGGCCTTAAGG - Intronic
1133107279 16:3520593-3520615 TTTAAGCTTTTATAGCTTCTTGG + Intronic
1133638101 16:7689599-7689621 TCTAGGCATTCTTATCTTCAGGG + Intronic
1135834840 16:25815719-25815741 CTTCAGCTTCATTAGCTTCATGG + Intronic
1135879685 16:26241630-26241652 TCTAAGCTGTAACTGCTTCATGG - Intergenic
1138159032 16:54736006-54736028 TGGAAGGTTTCTTAGCTTCAGGG - Intergenic
1139103694 16:63801141-63801163 TATAAGCTATATCAGCTTGAGGG + Intergenic
1139169740 16:64615815-64615837 TCTAAGCTGTTTGAGCTTCTTGG - Intergenic
1140636125 16:76916018-76916040 TCTTAGCTTTATTTTCTACATGG - Intergenic
1141397232 16:83716059-83716081 TCTAAGTTTTCCTAGCTTTATGG - Intronic
1143993849 17:10990000-10990022 CTTAAGCTTCATTAGCTTTAAGG + Intergenic
1146131710 17:30282693-30282715 TCAAAGCTATCTGAGCTTCACGG + Intronic
1146503556 17:33385007-33385029 TCTCTCCTTTATTAGCTGCATGG + Intronic
1149276083 17:55039174-55039196 TCTAAGCTTTATTACTCTTATGG - Intronic
1149906409 17:60529954-60529976 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1150366060 17:64586368-64586390 TCTACACTTTATTACGTTCATGG + Intronic
1151822463 17:76504097-76504119 TCTAAGCTTTTTTATTTTTATGG + Intergenic
1151964450 17:77424141-77424163 TCGAAGCTTTATGCGCTTCATGG + Intronic
1153107677 18:1546608-1546630 TTTAAGATTGAATAGCTTCAGGG - Intergenic
1153477100 18:5509041-5509063 TGTTGGCTTTATTACCTTCAAGG - Intronic
1153647999 18:7212290-7212312 TTTAAGCTGTGTTAGCTTCACGG + Intergenic
1153980433 18:10304257-10304279 ACTATGCTTTATTTGCTTCAGGG - Intergenic
1154240703 18:12651017-12651039 TTTAAGCTGCATTAGATTCATGG + Intronic
1156560807 18:38123287-38123309 TCTAAGCTTTACAATCTTTAGGG + Intergenic
1157794978 18:50565002-50565024 TTTAAGTTTCATTAGCTTCTTGG + Intronic
1158411084 18:57206564-57206586 TCTCAGCATTCTGAGCTTCAGGG - Intergenic
1158833002 18:61301215-61301237 ACTGAGATTTATTAGCCTCAAGG + Intergenic
1159512990 18:69420653-69420675 TCTTAGCTTCCTTAACTTCATGG - Intronic
1159623178 18:70662718-70662740 TCTAACCCTTATTGGCTGCAAGG + Intergenic
1159647345 18:70934642-70934664 TATAAACTTTAGGAGCTTCATGG - Intergenic
1159896357 18:74000836-74000858 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
1164047549 19:21555549-21555571 TCTTAGCTTGCTGAGCTTCATGG + Intronic
1164779575 19:30881667-30881689 TGTAAGCTTTAACAGATTCAGGG - Intergenic
926551694 2:14309377-14309399 TTTAAGGTTCATTAGGTTCAAGG - Intergenic
926602167 2:14856252-14856274 TCTAAGCTGTATTTGCTTTAGGG - Intergenic
928293692 2:30062087-30062109 TCTAAGCTGTATTTGCATGAGGG - Intergenic
928387699 2:30884147-30884169 CCTAAGCTTTATTACCATCCAGG - Intergenic
928598746 2:32883210-32883232 TCTTAGCTTTATTTCCTTAAGGG - Intergenic
928635251 2:33239206-33239228 TGTTAGCTGTAGTAGCTTCATGG + Intronic
929231721 2:39567264-39567286 ACTAAGATTCATTAGCTTCTCGG + Intergenic
929926428 2:46216268-46216290 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
930159367 2:48138405-48138427 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
930876180 2:56219839-56219861 TCTAAGTTTTATCTGCTCCAGGG - Intronic
930972231 2:57409443-57409465 TCTAAGCTGTATCTGCTTTAAGG - Intergenic
931161820 2:59701549-59701571 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
931343734 2:61427006-61427028 TCTAAGCTGTATCTGCTTTAGGG - Intronic
931534894 2:63263961-63263983 CTTAAGCTTCATTAGCTTCATGG - Intronic
931637401 2:64352742-64352764 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
933227448 2:79767534-79767556 TCTAAGCTGTATCTGCTTTAGGG + Intronic
933269744 2:80220811-80220833 TCTAAGCTTTAGGACCTTAAGGG + Intronic
933753021 2:85615416-85615438 TTAGAGCTTTATTAGCTTCATGG + Intronic
933849879 2:86357501-86357523 TATAACCTTTCTAAGCTTCAGGG + Intergenic
934882819 2:97998107-97998129 CTTAAGCTTCATTAGCTGCATGG - Intergenic
936294188 2:111253534-111253556 TCTCTGCTTTGTTAGCTTAATGG + Intergenic
938175142 2:129119051-129119073 TCTAAATTTTAATAGCTTTAAGG + Intergenic
939483301 2:142777371-142777393 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
939658105 2:144852794-144852816 TTTAAACTTCATTAGCTTCATGG - Intergenic
939930628 2:148229694-148229716 TCTAAGCTGTATCTGCTTTAGGG + Intronic
940730657 2:157386491-157386513 TCTAAGCTATATTTACTTTAGGG - Intergenic
941081287 2:161063665-161063687 TCTCAGCATTACTAGCTTTAAGG + Intergenic
943566887 2:189526488-189526510 TTAAAGCTTCATTAGCTTCGTGG - Intergenic
943709138 2:191070782-191070804 TCTATGACTTATTAGCTGCATGG + Intronic
943745697 2:191460877-191460899 TCTGAACTTTATTAGCTGCATGG + Intergenic
943923427 2:193739292-193739314 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
944089362 2:195888456-195888478 TATAAGCATTATTACCTTGATGG - Intronic
945210366 2:207376037-207376059 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
947115956 2:226770852-226770874 TCTGAGCTTTATTATCTTTAGGG + Intronic
1168741933 20:199577-199599 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1168873654 20:1153755-1153777 TCTAAGTCTCATTAGCTTGAAGG + Intronic
1169628441 20:7598427-7598449 TCTAAGGTCTATTTGCTTTAGGG - Intergenic
1170864297 20:20139331-20139353 TCTAAGCTTTATTAGCTTCATGG + Intronic
1172963524 20:38816348-38816370 TCCAACCTCTATGAGCTTCAAGG - Intronic
1174543817 20:51309945-51309967 TTCAAGCTTTTTTAGCTCCATGG + Intergenic
1174699560 20:52594300-52594322 CATAAGCTTCATTAGCTTCGTGG + Intergenic
1176917693 21:14645468-14645490 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1182833272 22:33321056-33321078 CCTAACCTTTCTGAGCTTCAGGG + Intronic
1183399710 22:37595303-37595325 TTTAAGGTCTATTAGCGTCATGG - Intergenic
1184542557 22:45137924-45137946 TCTTAAATTTAATAGCTTCATGG - Intergenic
950356281 3:12412665-12412687 ATGAAGCTTCATTAGCTTCATGG - Intronic
951102443 3:18704201-18704223 TCTATGCTGTATTTGCTTTAGGG - Intergenic
951204508 3:19910904-19910926 TCTAAGCTGTATCTGCTTTAGGG - Intronic
951318854 3:21220609-21220631 TCTAAACTATGTTAGCTTCTAGG - Intergenic
951929709 3:27951820-27951842 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
952171855 3:30815912-30815934 TCCATCCTTTATGAGCTTCATGG + Intronic
952383954 3:32825621-32825643 TTTAACCTTTATTAGTTTTATGG - Intronic
955466748 3:59245056-59245078 TCAGAGCTTCATTAGCTTCAGGG + Intergenic
955579046 3:60399196-60399218 TATCTGCTTTATTAACTTCAAGG + Intronic
957177887 3:76835662-76835684 TCTAAACTATATTAAATTCAGGG + Intronic
957558742 3:81794510-81794532 CGTAAGCTTTATGAGCTACATGG - Intergenic
957900211 3:86480234-86480256 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
958078479 3:88713638-88713660 TCTAAGCTTTATCTGCTTTAGGG - Intergenic
959279342 3:104317588-104317610 TGTAAGCTTTATCTGCTTTATGG - Intergenic
960322822 3:116257696-116257718 TTTAAGCTCTATGACCTTCACGG + Intronic
960393648 3:117109707-117109729 TCTAATATTTATTAGCTTCTTGG - Intronic
960698933 3:120421953-120421975 TCAAAGCTTAATTAGCTTCATGG + Intronic
961248423 3:125477870-125477892 TTTCAGCTTTGTTAGCTTTATGG - Intronic
962445712 3:135462350-135462372 TGTGAGCATTATTAGCTTCAAGG - Intergenic
962862497 3:139418058-139418080 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
963374311 3:144444196-144444218 TTTAAGCATCATTAGCTTCAGGG + Intergenic
963489377 3:145980188-145980210 TTTAAGCTTCATCAGCTTCGTGG - Intergenic
963504529 3:146166975-146166997 TTTAAGCTTCAATAGTTTCAGGG - Intergenic
963692391 3:148520191-148520213 TATAAGCTGTATTAACTTTAGGG - Intergenic
964209164 3:154209447-154209469 TCTAAGCTGTATCTGCTTTAGGG + Intronic
964239609 3:154575530-154575552 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
964467547 3:157012827-157012849 TCTCATTTTTATTAGCCTCAGGG + Intronic
964976044 3:162622089-162622111 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
965183894 3:165438338-165438360 TCTAGGTTTTATGATCTTCAGGG + Intergenic
966142102 3:176768469-176768491 TCTAAGAGTTATTAGCTTTAAGG + Intergenic
966491219 3:180530304-180530326 TCTAAGCTGTATTTACTTTAGGG - Intergenic
970716837 4:18936367-18936389 TATAAGTTTTATGAACTTCAAGG - Intergenic
971109623 4:23570486-23570508 TTTAACCTTAATTAGCTTCTTGG + Intergenic
972908430 4:43782081-43782103 GTTAAGCTTTATTAGCTTTTAGG - Intergenic
972956788 4:44402568-44402590 CTCAAGTTTTATTAGCTTCAGGG - Intronic
974508858 4:62810835-62810857 TCTAATTTTTATTGGCATCAGGG + Intergenic
975665380 4:76729765-76729787 ATTAAATTTTATTAGCTTCAGGG + Intronic
975931693 4:79532023-79532045 TCTACCCTTTAATAACTTCAGGG + Intergenic
978054885 4:104251305-104251327 TCTAAGCTGTATCTGCTTAAGGG - Intergenic
978253040 4:106656296-106656318 TTTAAGATTTGTTAGCTTCATGG + Intergenic
978699776 4:111628373-111628395 TCTTAGCTTGCTCAGCTTCATGG + Intergenic
979170701 4:117598372-117598394 GCTCAGCTTTAATAGGTTCAGGG + Intergenic
979762913 4:124429021-124429043 TTTTACCTTCATTAGCTTCAGGG + Intergenic
979917921 4:126461138-126461160 TCATAGCATTATTATCTTCAAGG + Intergenic
980191764 4:129533613-129533635 CTTAAGCTTCATGAGCTTCATGG + Intergenic
980330612 4:131406076-131406098 CTTAAACTTTATTAGCTTCATGG + Intergenic
980443096 4:132872145-132872167 TGTAAGCTGTATTTGCTTTAGGG - Intergenic
981289135 4:143053606-143053628 TTTAATTTTTATTAGGTTCAGGG + Intergenic
981443467 4:144809100-144809122 TCTTAGCTTTCTGAGCTCCATGG - Intergenic
981895781 4:149796869-149796891 TCTAAGCTGTATTTGCTTTAGGG - Intergenic
981931377 4:150192550-150192572 CTTAAGCCTCATTAGCTTCATGG + Intronic
981989815 4:150904163-150904185 TTGAAGCTTTATCAGCTTCGTGG - Intronic
982795856 4:159642636-159642658 TCCAAGCTTTTCTGGCTTCATGG + Intergenic
982806587 4:159773014-159773036 CCACAGCTTTATTAGTTTCATGG - Intergenic
983199270 4:164843398-164843420 ACTAAGCTTCATCAGCTTCCTGG + Intergenic
983421631 4:167526283-167526305 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984664872 4:182415602-182415624 AGTAAGCTTTATTAGCTTAGAGG + Intronic
984673601 4:182521095-182521117 TCTAAGTTTTAGATGCTTCAAGG - Intronic
985215612 4:187650363-187650385 TCTAAGCTGTGGTAGCTTCCTGG + Intergenic
986657443 5:10029795-10029817 TCTAAGCTATATCTGCTTTAGGG + Intergenic
987531320 5:19124549-19124571 TATAAGCTCTGTTACCTTCACGG + Intergenic
987911796 5:24155828-24155850 TCTCAGCTTTATCTACTTCAGGG - Intronic
988022754 5:25644456-25644478 TTTAGGCTTTATTAGCTTCATGG + Intergenic
988801893 5:34703727-34703749 TTTAAGCTTTAGTTGCTTTATGG + Intronic
989582883 5:43049862-43049884 GCTAAGCTTCCTTAGCTGCATGG - Intergenic
989681376 5:44032977-44032999 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
989722951 5:44552017-44552039 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
990593029 5:57284499-57284521 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
990923678 5:60995367-60995389 TCTAAGCTGTATCTGCTTTAAGG + Intronic
991180463 5:63745963-63745985 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
992177322 5:74162982-74163004 TCTAATCTTTATTATTTCCAAGG + Intergenic
992301764 5:75389325-75389347 TCTAAATTTTATTTTCTTCATGG + Intronic
992587294 5:78253183-78253205 TCTAAGCTATATTGGCTTTAGGG - Intronic
993192266 5:84697117-84697139 TCTAAGCTGTATCTGCTTTAAGG - Intergenic
993441212 5:87959129-87959151 CTTAAGCTTCATTAGCTTTACGG + Intergenic
993623453 5:90193956-90193978 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
993691558 5:91007238-91007260 CTTAAACTTCATTAGCTTCATGG + Intronic
994223638 5:97226313-97226335 TTTAAGCTTTATTACTTTTATGG - Intergenic
994235480 5:97357793-97357815 TCTAACCTGCATTTGCTTCAGGG + Intergenic
994477503 5:100289901-100289923 TCTAAGCTATATCTGCTTTAGGG + Intergenic
994864122 5:105243090-105243112 TTAAAGATTCATTAGCTTCATGG - Intergenic
995371988 5:111428189-111428211 TCTAAGCTGTATCTACTTCAGGG - Intronic
995611853 5:113919211-113919233 CATAAGCTTCCTTAGCTTCATGG + Intergenic
996116274 5:119623824-119623846 TCTAAGCTGTATCTGCTTTAGGG + Intronic
996359281 5:122627746-122627768 GCTAAGCTTCATTAGCTTCGTGG - Intergenic
996927672 5:128846932-128846954 TCTAAGCTTTATCTACTTTAGGG - Intronic
996962553 5:129269129-129269151 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
999013485 5:148069723-148069745 CTTAAGCTTTATTAGCTTTAAGG + Intronic
999406456 5:151311540-151311562 TCTAAGTTGTATCTGCTTCAGGG + Intergenic
999748233 5:154608273-154608295 CCTAAGCTTCACTAGCTCCATGG - Intergenic
1000478505 5:161743358-161743380 TCTAAGCTGTATCAGCTTTAGGG + Intergenic
1001272853 5:170328594-170328616 CATAACCTTCATTAGCTTCATGG + Intergenic
1006963865 6:37961815-37961837 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1007532177 6:42553010-42553032 CTTAAGCTTTACTAGTTTCATGG + Intergenic
1008017994 6:46542468-46542490 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1008250194 6:49230692-49230714 TCTAAGAGTTATTGGCTTTAAGG - Intergenic
1008277276 6:49556308-49556330 TCTATGAATTATTATCTTCATGG - Intronic
1008758416 6:54824915-54824937 TCTTAGCTTGATGGGCTTCATGG + Intergenic
1009466530 6:63977529-63977551 CTTAAGCTTCATTAGCTTCGAGG + Intronic
1009771103 6:68144282-68144304 TCTAATCTCTATTGGCTTTAGGG + Intergenic
1009783309 6:68297714-68297736 TCTAAGCTCTATCTGCTTTATGG - Intergenic
1009807685 6:68623574-68623596 ACTAAGCTTGTTCAGCTTCAAGG - Intergenic
1010529032 6:76943052-76943074 TCTAAGCTGTATGTGCTTTAGGG - Intergenic
1010639580 6:78307991-78308013 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1010976936 6:82325776-82325798 CCTATGCTTCATTCGCTTCATGG + Intergenic
1011431958 6:87296939-87296961 CTTAAACTTCATTAGCTTCAGGG - Intronic
1011496045 6:87937407-87937429 TTTAAGCTTTATTAGCTTCATGG - Intergenic
1012112469 6:95254480-95254502 TCTAAACTTTATTTTCTTGATGG + Intergenic
1012911315 6:105121092-105121114 TCAAAGTTTTATTGACTTCAAGG - Intronic
1013724429 6:113076436-113076458 TTTCAGTATTATTAGCTTCAAGG + Intergenic
1013753078 6:113429577-113429599 TCAAAGCATTACTAGATTCATGG - Intergenic
1014449189 6:121564096-121564118 TGAATGCTTTATTATCTTCAAGG - Intergenic
1015221836 6:130813095-130813117 TTTAAACTTCATTGGCTTCATGG + Intergenic
1015810450 6:137157197-137157219 TTTAATCTTCATTAGATTCATGG + Intronic
1016869208 6:148799746-148799768 TACAAGCTTTATCAGCTTCTAGG - Intronic
1018535965 6:164819073-164819095 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1020068784 7:5211740-5211762 TCTCAGCTTCATTAACTTCAGGG - Intronic
1020903942 7:14041451-14041473 TCTATGCATTAATAGATTCAAGG - Intergenic
1021230047 7:18075147-18075169 CCTAAGCTTCATTAGCGTCATGG + Intergenic
1021562086 7:21978630-21978652 TTTAAGCTTAATTAGCTTCAAGG + Intergenic
1022061246 7:26797496-26797518 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1022080350 7:27013531-27013553 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1022490551 7:30814248-30814270 CTTAAGCTTCATTAGCTTCATGG + Intronic
1023349698 7:39308434-39308456 CGTAAGCTTCATCAGCTTCATGG + Intronic
1024268606 7:47625548-47625570 GCTAAGTCTTATTAGCTTGAGGG + Intergenic
1024415147 7:49097241-49097263 TCTAAGCTGTATTTTCTTTAGGG - Intergenic
1027357572 7:77373256-77373278 CCTAATCTTTATTAGCGTAAAGG - Intronic
1028001517 7:85502934-85502956 TCTAAGCTTTATCTGCTTTAGGG - Intergenic
1028950445 7:96629821-96629843 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1029797160 7:102908593-102908615 TCTAAGCTGTATCTGCTTTAGGG + Intronic
1029872528 7:103710106-103710128 CCGAAGCTTCATCAGCTTCATGG - Intronic
1030377205 7:108767295-108767317 ACTAACCTTTATTCACTTCAAGG - Intergenic
1030423732 7:109344552-109344574 ACTCAGCGTTCTTAGCTTCAAGG + Intergenic
1030540338 7:110822713-110822735 TCTAACCTTTCTAAGTTTCAGGG - Intronic
1031003617 7:116446740-116446762 TCTTAGCTTCCTTAGCTTCAGGG - Intronic
1031280528 7:119795103-119795125 TCTAAGCTCTATCTGCTTTAAGG + Intergenic
1031472554 7:122183551-122183573 TCTAAGCTGTATCAACTTTACGG - Intergenic
1033302443 7:140198540-140198562 CCTAAGCTTCATTAGCTTGGTGG + Intergenic
1033614496 7:143000006-143000028 GCTAAGCTTTATGTGGTTCATGG + Intergenic
1033735902 7:144221503-144221525 CTTAAGCTTTGCTAGCTTCATGG - Intergenic
1033747149 7:144329449-144329471 CTTAAGCTTTGCTAGCTTCATGG + Intergenic
1033887377 7:145964715-145964737 TCTAAACTATATCTGCTTCAGGG - Intergenic
1034019025 7:147620135-147620157 TCTAAGCTGTAACAGCTTTAGGG - Intronic
1035084391 7:156246109-156246131 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1036190065 8:6662064-6662086 TTAAAGATTTATTAGATTCAGGG + Intergenic
1036983298 8:13495760-13495782 GCTAAGATTTATGGGCTTCAAGG + Intronic
1037993583 8:23337762-23337784 TTTAAGCTTCATTAGCTTTAAGG + Intronic
1039647342 8:39302579-39302601 TCTAAGCTGTACCTGCTTCAGGG + Intergenic
1040095830 8:43441287-43441309 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1041670397 8:60486068-60486090 CTTAATTTTTATTAGCTTCATGG - Intergenic
1041672528 8:60506332-60506354 ATTAAGCTTCATTAGGTTCATGG + Intergenic
1042064797 8:64862634-64862656 TCTTAGCTTTTCTAGTTTCATGG - Intergenic
1043325316 8:79043280-79043302 ACTAAGCATTTTTACCTTCATGG + Intergenic
1043743057 8:83838465-83838487 TCTTAGCATTAACAGCTTCAGGG - Intergenic
1044192927 8:89341716-89341738 TCTAAGCTGTATCTGCTTTACGG + Intergenic
1046169537 8:110486524-110486546 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1050028669 9:1362514-1362536 TGTAAGCTTTGTTAGCTTCCGGG + Intergenic
1050088154 9:1988598-1988620 TCTCAGCCTTGTTAGCATCATGG + Intergenic
1051096108 9:13467055-13467077 CCTAAGGTTTATTAGTTTCATGG + Intergenic
1051736102 9:20200678-20200700 CTTCAGCTTTATTAGCTTCATGG + Intergenic
1052214502 9:25950386-25950408 TCTAAGCTGTATTTGCTTTAAGG + Intergenic
1052476963 9:28972102-28972124 TCTAAGCTGTTTTTGCTTTAGGG - Intergenic
1052733027 9:32311470-32311492 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1054892257 9:70263599-70263621 TCTAATCTTTATTAGTTGCTAGG - Intronic
1054907569 9:70424133-70424155 TCAAGGCTTTAATATCTTCAGGG + Intergenic
1055073727 9:72193314-72193336 TCTAAGCTATATCTGCTTTAGGG + Intronic
1055154176 9:73040329-73040351 TTTAATCTTTCTAAGCTTCATGG - Intronic
1055815908 9:80206299-80206321 ATTAAGCCTCATTAGCTTCAAGG + Intergenic
1055915681 9:81397734-81397756 TCTGAACTTTGTTATCTTCAGGG - Intergenic
1056389519 9:86127621-86127643 CCTTAGGTTTGTTAGCTTCAGGG - Intergenic
1056424547 9:86464158-86464180 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
1057612137 9:96554230-96554252 TCTTATTTTTATTGGCTTCAAGG - Intronic
1057622693 9:96650390-96650412 TCTAAGCTCTATTAATTACAAGG + Intronic
1058780299 9:108326138-108326160 TCTAAGCTATTTCTGCTTCAGGG - Intergenic
1059878119 9:118658877-118658899 TCTAAGCTTTATTAGATTTAAGG - Intergenic
1060673696 9:125493313-125493335 TCTAAAATTTATATGCTTCAAGG + Intronic
1061915447 9:133750703-133750725 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1186363661 X:8869524-8869546 TCCAAGCTTCATTATCTTCAGGG - Intergenic
1186602373 X:11051495-11051517 CTTAAGCTTCATCAGCTTCAGGG + Intergenic
1187099404 X:16177359-16177381 TTTAAGCTTTAGTGGCTTCATGG + Intergenic
1187174979 X:16888162-16888184 CTTAAGCTTCATTATCTTCATGG + Intergenic
1187610455 X:20938230-20938252 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1187618576 X:21026237-21026259 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1187651924 X:21419586-21419608 TCTAAGCTGTATCTGCCTCAGGG + Intronic
1188742856 X:33808232-33808254 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1189227953 X:39429230-39429252 TTTAAGCTTCATTAGCTTCATGG - Intergenic
1189280336 X:39816553-39816575 TTTAAGCTTTATTAGCCTCGAGG - Intergenic
1189657882 X:43266421-43266443 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1189690429 X:43612309-43612331 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1189753272 X:44244896-44244918 ATTACGCTTCATTAGCTTCAAGG + Intronic
1190614738 X:52218253-52218275 TTTAAGCTGTATTTGCTTTAGGG - Intergenic
1190867386 X:54396396-54396418 TCTGTGCTTTATTACCTTCTAGG + Intergenic
1190919430 X:54838471-54838493 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1191694999 X:63979987-63980009 TCTAAGCTTTATCTGCTTTCAGG - Intergenic
1191775341 X:64807759-64807781 TCTAAGCCATATTAGCTCCGTGG + Intergenic
1191795647 X:65018754-65018776 TCTTAGCTTGCTCAGCTTCATGG - Intronic
1192262930 X:69518661-69518683 TAAAAGCTTTATAAGCTACAAGG - Intronic
1192406175 X:70888027-70888049 TCTAAGCTGTATCTGCTTTAGGG - Intronic
1192822276 X:74657821-74657843 TCTAAGCTCTATCTGCTTTAGGG + Intergenic
1193000495 X:76557571-76557593 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1193175297 X:78385091-78385113 TCTAAGCTATATTTGCTTTAGGG - Intergenic
1193619945 X:83739099-83739121 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1193755772 X:85407610-85407632 TCTAAGCTGTATCTGCTTCAGGG + Intergenic
1193821374 X:86170025-86170047 TCTAAGCTGTGTCTGCTTCAAGG + Intronic
1193830827 X:86288074-86288096 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1193842579 X:86425686-86425708 TCTAACCTTTATTATATTTAAGG + Intronic
1193981744 X:88188829-88188851 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1194112767 X:89855008-89855030 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1194274685 X:91865202-91865224 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1194358391 X:92917557-92917579 TCTAAGCTTTATCTGCTTTTGGG + Intergenic
1194360928 X:92949799-92949821 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
1194395614 X:93381365-93381387 TCAAAAATTTATTAGATTCATGG + Intergenic
1194760398 X:97789219-97789241 CATAAGCTACATTAGCTTCATGG - Intergenic
1194770804 X:97902388-97902410 TCTAAACTTTATGATATTCATGG - Intergenic
1194839612 X:98725095-98725117 TCTAAGCTGTATGTGCTTTAGGG + Intergenic
1195014519 X:100765520-100765542 TCTAAGCTTTATCTACTTTAGGG + Intergenic
1195172124 X:102280355-102280377 TCTAAGCTGTGTCTGCTTCAGGG + Intergenic
1195186736 X:102406738-102406760 TCTAAGCTGTGTCTGCTTCAGGG - Intronic
1195438395 X:104872460-104872482 CCTAAGCTTCATTAGCTACATGG + Intronic
1195668527 X:107450645-107450667 TTTGAGCTTTATTAGCATCTTGG - Intergenic
1195821046 X:108945783-108945805 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1196214387 X:113034246-113034268 TCTAAGCTATATCTGCTTTAGGG + Intergenic
1196215975 X:113051656-113051678 TCTAAGCTTTATCTGCATTAGGG - Intergenic
1196233378 X:113252160-113252182 TCTAAGCTGTATTTTCTTTAGGG + Intergenic
1196466349 X:115974896-115974918 TCTAAGAGTTATTGGCTTTAAGG + Intergenic
1196494243 X:116306164-116306186 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1196573418 X:117289586-117289608 TCTAAGCTTTTTCTGCTTCAGGG - Intergenic
1196818047 X:119680666-119680688 TTGAAGCTTTCTTAGCTACAGGG - Intronic
1197096804 X:122605435-122605457 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1197429557 X:126343345-126343367 TGTAAGCTGTATTGGCTTCAAGG - Intergenic
1197435546 X:126424344-126424366 TCTAAGCTGTATTTGCTTTAGGG + Intergenic
1197462981 X:126766102-126766124 TGTAAGTTTCATTAGCTTCATGG - Intergenic
1197987008 X:132277817-132277839 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1198785330 X:140282537-140282559 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1199159807 X:144596125-144596147 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1199177789 X:144811730-144811752 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1199308557 X:146296676-146296698 TCTAAGCTGTATCTGCTTTAGGG + Intergenic
1200465420 Y:3509819-3509841 TCTAAGCTGTATCTGCTTTAGGG - Intergenic
1200591928 Y:5086603-5086625 TCTAAGCTGTATGTGCTTTAGGG + Intronic
1200666569 Y:6033248-6033270 TCTAAGCTTTATCTGCTTTTGGG + Intergenic
1200669128 Y:6065611-6065633 TCTAAGCTGTATCTGCTTTAAGG + Intergenic
1200984176 Y:9288680-9288702 TGTAAGCTTTAAAAGCTGCAGGG - Intergenic
1201689064 Y:16742484-16742506 TCTGAGCTTCCTTAACTTCACGG - Intergenic
1201934012 Y:19386507-19386529 TCTAAGCTATCTGAGCTCCATGG - Intergenic