ID: 1170867039

View in Genome Browser
Species Human (GRCh38)
Location 20:20167183-20167205
Sequence CCTCATTAGAAACAGTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170867039_1170867041 28 Left 1170867039 20:20167183-20167205 CCTGGATACTGTTTCTAATGAGG 0: 1
1: 0
2: 2
3: 15
4: 119
Right 1170867041 20:20167234-20167256 TCTTACAACTATGTGATGTTAGG 0: 1
1: 0
2: 3
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170867039 Original CRISPR CCTCATTAGAAACAGTATCC AGG (reversed) Intronic
902706101 1:18205972-18205994 CAGCAGAAGAAACAGTATCCAGG - Intronic
902777902 1:18686284-18686306 CCTGACTAGAGACAGGATCCAGG + Intronic
911415972 1:97574878-97574900 CCTCAGTGGAAACATTACCCAGG - Intronic
911535152 1:99090626-99090648 CATCATTAGAAACAGTAACAAGG + Intergenic
912688325 1:111784745-111784767 CTTGAGGAGAAACAGTATCCAGG + Intronic
915092142 1:153434090-153434112 CATCATTAGAAAGAGAAGCCTGG + Intergenic
915192054 1:154159475-154159497 CAGCATTATAAACAGTATACTGG + Intronic
917291890 1:173478678-173478700 CCTTTTTATATACAGTATCCAGG + Intronic
923498177 1:234542800-234542822 CATCATTATAAACACTATCCTGG + Intergenic
1069969844 10:72157105-72157127 CTTAATTAGAAAAAGTATCTGGG - Intronic
1070269136 10:74934950-74934972 CTAAATTAGAAACAGTAACCAGG - Intronic
1071168100 10:82830684-82830706 CCTCATTAGAAGCTGTATTCTGG + Intronic
1071429724 10:85597273-85597295 GCTCATCAGAAACAGAACCCAGG - Intergenic
1071689799 10:87805018-87805040 TCAAATCAGAAACAGTATCCTGG - Intronic
1071846497 10:89526332-89526354 CCTCTCTAGAAACACTCTCCTGG + Intronic
1071977203 10:90967128-90967150 TCTCGGTAGAAACAGGATCCAGG - Intergenic
1072437521 10:95427707-95427729 TCCCATTAGAAACATTCTCCTGG + Intronic
1072741563 10:97913000-97913022 CCTTAATAGAAACAGGATTCTGG + Intronic
1076828059 10:132980340-132980362 CCTCATTAGAGACAGAACTCTGG - Intergenic
1077959796 11:7063484-7063506 GCTCATTACAAACACAATCCTGG + Intronic
1081056781 11:38419173-38419195 CCTCATTAGAAAGAACATTCTGG + Intergenic
1081550314 11:44105696-44105718 CCTCCCCCGAAACAGTATCCGGG + Intronic
1083378463 11:62244915-62244937 CCCCATTAGTAACAGGATGCTGG - Intergenic
1083384280 11:62296151-62296173 CCCCATTAGTAACAGAATGCTGG + Intergenic
1091595026 12:1872494-1872516 TCTCAGTAGAAACCGTCTCCAGG - Intronic
1091626504 12:2124921-2124943 CCTCAGCATAAACAGTCTCCTGG - Intronic
1091883927 12:4002466-4002488 CTTCCTTAGAAACAGAATCCTGG - Intergenic
1093027054 12:14254696-14254718 CCTCCTTTAAAAGAGTATCCTGG - Intergenic
1098045448 12:66396052-66396074 CCTCATCATCAACAATATCCTGG + Intronic
1101584887 12:106077035-106077057 GCTCATTATAAACAGTGTTCTGG - Intronic
1106761545 13:32873357-32873379 CCTCATTTGAACCAGTTTTCAGG + Intergenic
1107080179 13:36366464-36366486 CCTCCATAGAAACAGTTTTCTGG + Intronic
1108677053 13:52746159-52746181 CCTCATTAGAGAAAGTCTGCTGG - Intergenic
1108761944 13:53578181-53578203 CCTTTTTAGAAACTGTATCCTGG + Intergenic
1112837384 13:103532667-103532689 CCCCCTTAGAAACAGCCTCCTGG - Intergenic
1114305006 14:21414808-21414830 CCCCATTAAAAACAGCAACCTGG + Intronic
1114474834 14:22986963-22986985 CCTCAGCATAAACAGTATCTCGG - Exonic
1114569006 14:23652824-23652846 CCTCACTAGACACAGAATGCTGG - Intergenic
1114983849 14:28200239-28200261 TCTCATTTGAAACAGCTTCCAGG + Intergenic
1116394342 14:44430018-44430040 CCTCTTTAGAAAGAGGATTCTGG + Intergenic
1116517229 14:45817450-45817472 GCTCATTAGGAACAATATCACGG + Intergenic
1116539938 14:46089579-46089601 CCTCATCAGAAGCAGAATCTGGG - Intergenic
1117046857 14:51821674-51821696 CTTCATCAGAAACATTATTCTGG - Intergenic
1121056071 14:90854504-90854526 CATCATTAGAAAAAGTTTTCTGG + Exonic
1125741609 15:41969183-41969205 CCTCATTAGAATAAGTTTTCTGG + Intronic
1126699309 15:51353662-51353684 CCACATTGGCAACAATATCCTGG - Intronic
1138087870 16:54150391-54150413 CATCATTAGAGACATTCTCCAGG + Intergenic
1140377999 16:74460642-74460664 GCTCATCACAAACAGTTTCCTGG + Intronic
1141124325 16:81389509-81389531 CCTCATCAGAAACGGTATCGCGG + Exonic
1148870475 17:50656373-50656395 CCTCATTAAAACCAGAATGCTGG - Intronic
1150260445 17:63785763-63785785 GCCCAATAGAAACACTATCCAGG - Intronic
1153422626 18:4925252-4925274 CCACATTAGTAACATGATCCTGG - Intergenic
1154049450 18:10940071-10940093 CCTCATCAGAAACAAACTCCAGG + Intronic
1158864013 18:61619828-61619850 CCTCTTTAGAAAGAGGATTCTGG + Intergenic
1159639652 18:70848605-70848627 CCTCATTGGAGACAGATTCCTGG + Intergenic
1166423614 19:42656862-42656884 CCTCTTTAGAGACTGGATCCTGG + Intronic
1166711780 19:44942283-44942305 CCTCCTCAGAAACAGGCTCCAGG + Exonic
1166781137 19:45344130-45344152 CCTCATTAGAAACACAATGTAGG - Intronic
1167212440 19:48141714-48141736 CCTCATTAGAAACAGAAGCTGGG + Intronic
925518266 2:4709250-4709272 CCTTATGAGAAACAGTATGGAGG + Intergenic
925572349 2:5325622-5325644 GCTCAGTGGAAACAGTCTCCAGG - Intergenic
927144808 2:20156161-20156183 CCTCATTTAAAAAAGTATCATGG - Intergenic
928746431 2:34421241-34421263 CCTCAAAAGAAACAGTATATAGG - Intergenic
931298833 2:60957221-60957243 CCCCCTAAGAAACAGTATCAAGG + Intronic
934518525 2:95004797-95004819 CCTGATTACAAATAGTTTCCAGG + Intergenic
942334127 2:174862629-174862651 GTTCATTAAAAACAGTATCATGG - Intronic
942942867 2:181639943-181639965 TTTCATTAGAAACAGTGTTCTGG - Intronic
945206083 2:207334046-207334068 TCTCATTAGAACCAGAACCCTGG - Intergenic
1170867039 20:20167183-20167205 CCTCATTAGAAACAGTATCCAGG - Intronic
1177220898 21:18191392-18191414 CCTCATATGAAACAGTTGCCAGG + Intronic
1178074036 21:28999276-28999298 CCTCATTCCAAACATCATCCTGG + Intergenic
1179197741 21:39181911-39181933 CTTCAATATAAACAGTATCATGG + Intronic
1180001737 21:44998249-44998271 CCTCATCTGAAACAGGAACCTGG + Intergenic
1181891458 22:26067180-26067202 GCTTATTAGAAACAGGATCGGGG + Intergenic
953617270 3:44502650-44502672 CCTCATACGCCACAGTATCCTGG + Exonic
953625633 3:44568303-44568325 CCTCATATGCCACAGTATCCTGG - Exonic
954242034 3:49301303-49301325 CCTGATAAGAAACAGAAGCCCGG + Intronic
954776267 3:53021346-53021368 CCTCATTAGAAAATGTCTCTAGG + Intronic
957961123 3:87254506-87254528 CCTCAATACAAAGATTATCCTGG + Exonic
959165493 3:102772301-102772323 TCTCATTAAAAACAGGATGCCGG - Intergenic
961586239 3:127928552-127928574 CTTCAATAGAAACAGCATTCTGG - Intronic
962163925 3:133029039-133029061 CCAAATTAGAAAGAGTATTCAGG - Intergenic
963787670 3:149551493-149551515 CTTCATCAGAAACACTTTCCAGG + Intronic
966078908 3:175975929-175975951 CATCTTTAGAAACAGGACCCTGG + Intergenic
970149998 4:13079615-13079637 TCTCATTAGAGAGAGTATCCAGG - Intergenic
971203265 4:24533237-24533259 CAACATTAGAAACAGTAACAAGG + Intronic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
975708850 4:77138718-77138740 ACTCATCAGTAACAGTAGCCAGG + Intergenic
979783660 4:124688080-124688102 CCAAATTAGAAACAGTGTACAGG + Intronic
985044199 4:185923767-185923789 CTTCCTTAGATACAGTATCAGGG + Intronic
986097969 5:4578854-4578876 CTTCGTTAGAAACACTTTCCTGG + Intergenic
986701862 5:10418076-10418098 ATTCATTAAAAAGAGTATCCTGG + Intronic
986998595 5:13635747-13635769 CCTTATGAAAAACAGTATGCAGG + Intergenic
987235854 5:15940893-15940915 CTTCATTAGAAAAAGTTTTCAGG + Intergenic
989334747 5:40302516-40302538 ACTTATTGGAAACAGTAGCCAGG + Intergenic
991067212 5:62436546-62436568 GGTGATTAGAAACAGAATCCCGG + Intronic
993221223 5:85099951-85099973 CCTCATTAGGAACAGAAATCAGG + Intergenic
996633595 5:125665321-125665343 CCACATTGGAAACAGACTCCCGG + Intergenic
997635616 5:135402572-135402594 CTCCATTAGAAACAGTACTCAGG + Intergenic
998960761 5:147484092-147484114 CCTCATTAGAACCAGGTTCCCGG + Intronic
1001871366 5:175158862-175158884 CCTCATTAGAACCAATTTCATGG - Intergenic
1003079229 6:3007627-3007649 CCTCATTGGAAAGAGTCTCCAGG - Intronic
1006815623 6:36848030-36848052 GCTGATTAGAATCAGTCTCCTGG + Intergenic
1007085088 6:39138194-39138216 CTTCATTAGAAACAGTGCTCTGG + Intergenic
1008247764 6:49200049-49200071 TCTCATATGAAACAGTTTCCAGG + Intergenic
1008935913 6:56992156-56992178 CCTCTTGAGAAACAGAAACCAGG - Intronic
1009368457 6:62874276-62874298 TCCCATTAGAAACAGTATCCCGG - Intergenic
1011582334 6:88882997-88883019 CTTCTTTAGAAAAAGTTTCCAGG - Intronic
1012094501 6:94942013-94942035 CATTATGAGAAACAGTATGCAGG + Intergenic
1013757207 6:113475889-113475911 CCTCAGTAGATCCAGGATCCAGG - Intergenic
1014157970 6:118134180-118134202 CATCTTTAGACACAGTATCAAGG - Intronic
1015656571 6:135525256-135525278 CCTCACCAGACACAGTCTCCTGG + Intergenic
1016085157 6:139904406-139904428 CATCATTAGAAACAATAGCAAGG + Intergenic
1016198720 6:141380127-141380149 CCTTGTTAGAAACAGTATGGTGG - Intergenic
1020566417 7:9801872-9801894 CATCATTGAAAACAGTATGCAGG + Intergenic
1022826215 7:34017017-34017039 CCTCTTTAGAAACTGGAACCAGG + Intronic
1029686095 7:102149272-102149294 CACCAGGAGAAACAGTATCCCGG - Intronic
1029798213 7:102917797-102917819 CCTCATTTGGCACAGTATCCTGG - Intronic
1033018095 7:137692581-137692603 CCTAATTAGGAAGAGTAACCGGG - Intronic
1034190673 7:149210979-149211001 CCCCTTTAGAAACAATATCCTGG + Intronic
1034398215 7:150843369-150843391 CCTCCTTGGGAACAGTTTCCAGG - Intronic
1037135311 8:15453033-15453055 CATAACTAGAAACAGTATCTAGG + Intronic
1042050821 8:64704310-64704332 CCTCTTTAGAAAGAGTATCCTGG - Intronic
1043443575 8:80298193-80298215 CCTCATTAGCAGCAGTGTACTGG + Intergenic
1043782536 8:84354196-84354218 CCTGATTAAAAACAGTTTGCTGG + Intronic
1043885328 8:85592907-85592929 CCCCATGAGAAACAGTATGGTGG - Intergenic
1186417226 X:9394276-9394298 CCTCACTACCAACATTATCCCGG + Intergenic
1187584251 X:20642360-20642382 CCTGATTTGAACAAGTATCCAGG - Intergenic
1190580154 X:51885141-51885163 CCACTTTAGAAACAGTATAGAGG - Intronic
1193406853 X:81111062-81111084 CCTCTTTAGAAACATATTCCAGG - Intergenic
1194220049 X:91178413-91178435 CATCATTAGAATCAAAATCCAGG - Intergenic
1198867154 X:141135934-141135956 CCTCATTAGACAAATGATCCAGG - Intergenic
1200556560 Y:4642174-4642196 CATCATTAGAATCAAAATCCAGG - Intergenic
1200844839 Y:7821399-7821421 CCTCTTTACAAAAAGGATCCAGG + Intergenic
1202252162 Y:22884585-22884607 CCCCATTGGAAGCAGTATCCAGG + Intergenic
1202405150 Y:24518334-24518356 CCCCATTGGAAGCAGTATCCAGG + Intergenic
1202465629 Y:25151748-25151770 CCCCATTGGAAGCAGTATCCAGG - Intergenic