ID: 1170868031

View in Genome Browser
Species Human (GRCh38)
Location 20:20177657-20177679
Sequence AGAAATTCTTGCCCTCACGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170868027_1170868031 13 Left 1170868027 20:20177621-20177643 CCAGGTGCTGGGGAAACAGAAAT No data
Right 1170868031 20:20177657-20177679 AGAAATTCTTGCCCTCACGGGGG No data
1170868026_1170868031 14 Left 1170868026 20:20177620-20177642 CCCAGGTGCTGGGGAAACAGAAA No data
Right 1170868031 20:20177657-20177679 AGAAATTCTTGCCCTCACGGGGG No data
1170868023_1170868031 24 Left 1170868023 20:20177610-20177632 CCAGCTTTATCCCAGGTGCTGGG No data
Right 1170868031 20:20177657-20177679 AGAAATTCTTGCCCTCACGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170868031 Original CRISPR AGAAATTCTTGCCCTCACGG GGG Intronic