ID: 1170869553

View in Genome Browser
Species Human (GRCh38)
Location 20:20192570-20192592
Sequence CAAGCTACTCCCACTCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170869553 Original CRISPR CAAGCTACTCCCACTCTAAG AGG (reversed) Intronic
904390288 1:30180607-30180629 CAAACTACTTTTACTCTAAGGGG + Intergenic
905402827 1:37715946-37715968 CAAGCAACTGCCACTCAAAGAGG + Intronic
912082413 1:105952633-105952655 CAAGCTACTCTCTGTCTGAGTGG + Intergenic
912513475 1:110203732-110203754 CAAGTTACTCCAAGTCTGAGCGG + Intergenic
915153598 1:153855795-153855817 CCAGCTACTCCCAGTCCCAGAGG - Intronic
916868702 1:168888443-168888465 CCAGGTACTCCCACTCTTAGGGG + Intergenic
918130537 1:181624029-181624051 CAAGCTGCTCCCACTCATGGTGG + Intronic
918285587 1:183051550-183051572 CAAGCTACTCCAAAGCTCAGTGG - Intronic
918364055 1:183787911-183787933 CAGGCTACTTCCACTCATAGTGG - Intronic
919957764 1:202436343-202436365 CAAGCTACTCTGATTCTAAGGGG - Intronic
921713720 1:218397806-218397828 CAAGCTAGTCCCCCTCCTAGAGG - Intronic
1071752989 10:88502502-88502524 CATGCTACTTCCACTCAAGGTGG - Intronic
1072718286 10:97765784-97765806 GAAGCCACCCCCACTCTAATGGG - Intergenic
1078067394 11:8087369-8087391 CAAGCCACTCACACTTTCAGAGG - Intronic
1079928825 11:26531948-26531970 CAAGGTACACCCAGTCTAATGGG + Intronic
1081793715 11:45805586-45805608 CAACCTACTCCCACCCCGAGGGG - Exonic
1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG + Intronic
1086858855 11:91900505-91900527 CAAGTACCACCCACTCTAAGGGG + Intergenic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1092269539 12:7012319-7012341 CATGCTCCTCCCAATCTCAGCGG + Intronic
1093887292 12:24476702-24476724 CAAGGAACTCCCACTCTAATGGG - Intergenic
1094213027 12:27912450-27912472 CAACCTACTCTCTCTCTAAAGGG + Intergenic
1105378149 13:19863488-19863510 CCAGCCACCCCCACTCTCAGCGG + Exonic
1105947492 13:25202301-25202323 CAACCCAATCCCTCTCTAAGGGG + Intergenic
1107034199 13:35883455-35883477 CAAGCTACTTCCACTCATGGTGG - Intronic
1107897547 13:44980927-44980949 CAAGCTTCTCCCACACGAAAGGG - Intronic
1109462993 13:62687942-62687964 CAAGCTCCTCCCACTGCAAAGGG + Intergenic
1112499973 13:99935234-99935256 AAAGCTGCTCACACTCCAAGGGG - Intergenic
1114612822 14:24053490-24053512 CACCCTACTCCCTCTCTAATAGG + Intronic
1115137917 14:30133191-30133213 CAAGCTGCTTCCACTCATAGTGG - Intronic
1117760365 14:59020942-59020964 CAAGCCACCCCCACTGGAAGTGG - Intergenic
1119126179 14:72129490-72129512 CAAACTACTCCAACACTTAGTGG + Intronic
1119904443 14:78288792-78288814 CAAGCTATTCCATCTCTTAGTGG - Intronic
1121466819 14:94121049-94121071 CAAGATAGTCACACTCTAGGAGG - Intergenic
1124845335 15:33284469-33284491 CAAACCACTCCCACACTCAGTGG + Intergenic
1125957318 15:43799436-43799458 CCAGCTGCTGCCACTCTAGGTGG - Exonic
1129682589 15:77666210-77666232 CAAGGAACACCCACTCAAAGGGG - Intronic
1144170901 17:12658995-12659017 CTTGCTACTCTCACTTTAAGAGG - Intergenic
1144264566 17:13555522-13555544 CAAGATGCTTCCACTCTAAGGGG - Intronic
1149349039 17:55768821-55768843 GAGGCTACTCCAGCTCTAAGTGG - Intronic
1150075072 17:62185286-62185308 CAATATACTCCCACTTTAACAGG + Intergenic
1155715289 18:28934837-28934859 CAAGTTACTCCAACTCTATAAGG - Intergenic
1156506745 18:37600690-37600712 CATGCTCCTCCCTCTCCAAGTGG + Intergenic
1158532002 18:58271545-58271567 CTAGCTAATCTCACTCTAAAAGG - Intronic
1163009157 19:14413846-14413868 CCAGCTTCTCCCACTCTCTGTGG + Intronic
1165422382 19:35728661-35728683 CCCGCTACTCCCTCTCTATGTGG - Intronic
1166054615 19:40280873-40280895 CTAGCTCCTCCCCCTCTAACCGG + Intronic
926177963 2:10613916-10613938 CTAGCAACCCACACTCTAAGAGG + Intronic
927315633 2:21677853-21677875 CAAGCCCCTCCCACTCCAGGTGG + Intergenic
927378811 2:22453265-22453287 CAAACAACTCCCAATCTCAGTGG + Intergenic
927599369 2:24427105-24427127 GAAGCAATTCCCACTCTGAGGGG - Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG + Intergenic
948268758 2:236657737-236657759 CAAGCTTCTTCCACTCTCTGTGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1173048870 20:39539798-39539820 CAAGCTGCTTCCACTCAAGGTGG - Intergenic
954874053 3:53789580-53789602 CAGGCCACGCCCACTCTCAGGGG - Intronic
958967931 3:100579711-100579733 CAAGCTGCTTCCACTCACAGCGG - Intergenic
969848551 4:9938735-9938757 CAAGCTACTCAGCCTCTGAGTGG + Intronic
977920600 4:102638454-102638476 CAAGACACTCAAACTCTAAGTGG - Intronic
979354021 4:119681251-119681273 CAATTTAATCACACTCTAAGAGG - Intergenic
979678931 4:123438313-123438335 CTAACTCCTGCCACTCTAAGAGG - Intergenic
982751948 4:159172649-159172671 CATGCTACTTCCTCTGTAAGTGG + Intronic
986409645 5:7464533-7464555 CAAGCTACCCCCAATCTAGGTGG - Intronic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
993950952 5:94174638-94174660 CAAGCTTATCCCCCTTTAAGAGG + Intronic
994821160 5:104652733-104652755 TATGCTACTCCCACTGAAAGTGG + Intergenic
998261766 5:140637141-140637163 CACCCTACTCCCACTCTTGGGGG - Intergenic
998861588 5:146449036-146449058 CAAGCAACTTCCAATCCAAGAGG - Intronic
999048913 5:148500486-148500508 GAAGCTAGGCCAACTCTAAGAGG + Intronic
1000315842 5:160089776-160089798 CAGTTTACTCCCACTCCAAGGGG + Intronic
1001043166 5:168351479-168351501 GAAGCGACTTCCACTCTAGGAGG + Intronic
1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG + Intronic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1013298903 6:108784637-108784659 CAAGAAATTCCCACTCTAATAGG + Intergenic
1019331019 7:460864-460886 CAAGCACCTCCCACTCAAAGGGG + Intergenic
1032436220 7:131902399-131902421 CAGGCTACTTCCACTCATAGTGG - Intergenic
1033551668 7:142452989-142453011 GAAGCTGTTCCCACTCTACGGGG + Intergenic
1037602807 8:20412328-20412350 CAAACTACTCCCAAACTTAGTGG + Intergenic
1040436025 8:47392321-47392343 TAGGCTACTACCACTCCAAGTGG + Intronic
1041390574 8:57343883-57343905 CAAGCTACTTAAACTCTCAGAGG + Intergenic
1046770612 8:118112897-118112919 CAAGCTCCTGCCACTCCCAGTGG + Intergenic
1046943794 8:119956149-119956171 CAAGCTACTCCCAAACTTGGTGG - Intronic
1048216757 8:132502672-132502694 AAAGCTACTGCCTTTCTAAGCGG + Intergenic
1048473035 8:134720293-134720315 AAAACTACTCCCACACTTAGTGG - Intergenic
1048514293 8:135091840-135091862 CAAGCTACTTCCCCTCTCAAAGG - Intergenic
1051972487 9:22907123-22907145 CAATCTACACCCACTCAAAATGG + Intergenic
1053424409 9:38001681-38001703 CAGTCTCCTCCCACTCTAAGAGG - Intronic
1189355909 X:40309798-40309820 CAAGCTACCCCCAAACTAAGTGG - Intergenic
1196624259 X:117860177-117860199 CAAGCAACACCCTCTCTGAGAGG - Intergenic
1197489214 X:127096731-127096753 CAAGAAACTCCCACTCAAAAGGG - Intergenic
1198314900 X:135455426-135455448 CAAGCTACTCCTACTAAAACTGG + Intergenic
1199575630 X:149311409-149311431 CATGCTTCCCCCACTGTAAGGGG - Intergenic