ID: 1170873239

View in Genome Browser
Species Human (GRCh38)
Location 20:20227532-20227554
Sequence ACTTCCCTGCAGAAGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170873239_1170873241 20 Left 1170873239 20:20227532-20227554 CCTTGCAGCTTCTGCAGGGAAGT 0: 1
1: 0
2: 0
3: 43
4: 252
Right 1170873241 20:20227575-20227597 TCAGGTAATTTTTGTAAACATGG 0: 1
1: 1
2: 8
3: 68
4: 674
1170873239_1170873240 2 Left 1170873239 20:20227532-20227554 CCTTGCAGCTTCTGCAGGGAAGT 0: 1
1: 0
2: 0
3: 43
4: 252
Right 1170873240 20:20227557-20227579 ATGAAATCAATGACTAATTCAGG 0: 1
1: 0
2: 4
3: 21
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170873239 Original CRISPR ACTTCCCTGCAGAAGCTGCA AGG (reversed) Intronic
900010979 1:108184-108206 ACTTCCCTGTAAAAGCTTCCTGG + Intergenic
900027081 1:284748-284770 ACTTCCCTGTAAAAGCTTCCTGG + Intergenic
900264897 1:1752447-1752469 GCTTCCCTGCAGAAGTTTTAGGG + Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900524282 1:3120851-3120873 AAATCCCTGCAGAAGCGGAAAGG - Intronic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
901201915 1:7471931-7471953 ACTTCCCTGCAGATTCTGTATGG + Intronic
901771052 1:11530575-11530597 ACTGTCCTGCAGAACCTGCCTGG - Intronic
902110137 1:14071544-14071566 AGTTCCATGCAGAAGCAGGAGGG - Intergenic
902713008 1:18253434-18253456 TCAGCCTTGCAGAAGCTGCATGG + Intronic
904405717 1:30286767-30286789 GCCACCCTCCAGAAGCTGCAGGG - Intergenic
904794022 1:33045325-33045347 GCCACCCTGCAGAAGCTGAAAGG + Intronic
905500388 1:38432027-38432049 CGTTCCCTGCAGTACCTGCAAGG + Intergenic
906202807 1:43970954-43970976 TCTTCCCTGCAGCTGCTGCGTGG + Exonic
906202808 1:43970958-43970980 ACATCCACGCAGCAGCTGCAGGG - Exonic
908363283 1:63390851-63390873 ATTCCCCAGCAGCAGCTGCATGG - Intronic
908650419 1:66326969-66326991 ACTTCCCTGCACAGATTGCAGGG + Intronic
912669007 1:111607923-111607945 ACTTCCCAGTAGAGGCGGCAGGG + Intronic
913441150 1:118899027-118899049 ACCACCATGCAGAAGCAGCAAGG - Exonic
914671096 1:149870653-149870675 ACTTGCCTGGAAAAGCTGGAAGG + Intronic
915665598 1:157441468-157441490 AGCTCCCTGCAGCAGATGCAGGG + Intergenic
917930380 1:179818557-179818579 AAGTCCCTGCAGAAGCCCCAGGG - Intergenic
918218992 1:182418580-182418602 ACTTGCCTGCCAAAGTTGCAGGG + Intergenic
919966110 1:202526826-202526848 ACTTCCTTGTAGATACTGCATGG + Intronic
920933309 1:210408667-210408689 CCTTTCCTGCAGCAGCTGCCTGG - Intronic
922259424 1:223924191-223924213 ACTTCCCTGTAAAAGCTTCCTGG + Intergenic
924340605 1:243026937-243026959 ACTTCCCTGTAAAAGCTTCCTGG + Intergenic
1062902289 10:1155640-1155662 ACTTTGCTGCAGCAGCTGCGTGG + Intergenic
1065232703 10:23614824-23614846 ATTTCCCTGCAGAATATACAAGG - Intergenic
1065847505 10:29758146-29758168 TCTGCCCTTCAGAAGCTGGAAGG - Intergenic
1066545920 10:36500408-36500430 ATTTCCCAACAGAAGCAGCATGG - Intergenic
1066735894 10:38478662-38478684 ACTTCCCTGTAAAAGCTTCCTGG - Intergenic
1067130004 10:43555290-43555312 TCTTCTCTGCAGAAGTTGAATGG - Intergenic
1067163674 10:43848049-43848071 AGACCCATGCAGAAGCTGCAAGG + Intergenic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1070282176 10:75057990-75058012 TCTTCCCTCCAGGTGCTGCAGGG - Intronic
1070359360 10:75672327-75672349 ACTTCCCTACAAAATCTGAAAGG - Intronic
1071569557 10:86689428-86689450 ACTTGCCTGTAAAGGCTGCAAGG - Intronic
1072427194 10:95339444-95339466 CCTTCCCTGCTGAACCTGGAGGG + Intronic
1074229186 10:111516812-111516834 GGTTCCCTTCAGGAGCTGCATGG - Intergenic
1076235508 10:128861107-128861129 AGTTCCCAGCAGGAGCTGCCAGG + Intergenic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1077537086 11:3129579-3129601 GCTTCCATGGAGAAGATGCACGG + Intronic
1077610344 11:3639988-3640010 ACTGCCTCGCAGCAGCTGCAGGG + Exonic
1077798812 11:5518066-5518088 ATTCCAGTGCAGAAGCTGCAGGG - Intronic
1077986151 11:7353254-7353276 GCCTCCCTGCAGAAGCCTCAGGG - Intronic
1078244727 11:9563670-9563692 ACTCCCCAGCAGCTGCTGCATGG - Intergenic
1079182735 11:18208268-18208290 ACAGCCCAGCAGCAGCTGCATGG + Intronic
1079603637 11:22341194-22341216 ACTTTCTTGCAGGATCTGCAGGG - Intronic
1082807361 11:57459517-57459539 ACTTCCCTACAAAGGCTGCAGGG - Intergenic
1083104453 11:60344653-60344675 ACTTCCCTGCAGAAATAGAATGG - Intronic
1083419384 11:62544723-62544745 ACTTCCTTTCAGAAGCTGAATGG - Intronic
1083762298 11:64825354-64825376 ACAGCACAGCAGAAGCTGCAAGG + Intronic
1084563243 11:69915700-69915722 ACTCCACTGCTGAAGCGGCAGGG - Intergenic
1085342295 11:75740899-75740921 ACTTCCCTCCAGAGGCTCTAGGG + Intergenic
1085677963 11:78542929-78542951 ACTTTCTTGCAGTTGCTGCAAGG + Intronic
1090374435 11:126278957-126278979 ACTTCCCTCGAGGAGCTTCATGG - Intergenic
1090639156 11:128715957-128715979 ATTTCCCTGCAGGAGAGGCAGGG + Intronic
1091162203 11:133434346-133434368 ACTTAACTTCAGAAGCTGCAGGG - Intronic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1092010331 12:5104877-5104899 AGCTCCATTCAGAAGCTGCATGG + Intergenic
1092480741 12:8857178-8857200 ACAGCCCTGCAGAACCTGGATGG + Exonic
1094239003 12:28201058-28201080 ACTTCCCAGTAGAGGCGGCAGGG + Intronic
1094829895 12:34295303-34295325 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1094830974 12:34300127-34300149 CCTTCCCAGCAGCACCTGCATGG + Intergenic
1094835941 12:34322121-34322143 CCTTCCCAGCAGCTGCTGCATGG - Intergenic
1094837724 12:34329965-34329987 CCTTCCCAGCAGACCCTGCATGG - Intergenic
1096185957 12:49580700-49580722 CCTTTCCTGCAGAAGCCACAAGG - Intronic
1098856074 12:75654614-75654636 ACAGCCCAGCAGAAGCAGCAGGG + Intergenic
1099113983 12:78600854-78600876 ACTTCCCTAAAGAAGCAACAGGG + Intergenic
1099650283 12:85417847-85417869 ACCACCCTGGAGAAACTGCAAGG - Intergenic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1104657679 12:130585746-130585768 ACTTCCCTGCAGGGGCAGCCTGG - Intronic
1106698296 13:32202024-32202046 ACGTGCCTGCATGAGCTGCATGG - Exonic
1107354526 13:39552746-39552768 CCTTCACTTCAGAAGCTTCATGG - Intronic
1108440655 13:50449669-50449691 ACAACCCTGCAGAAGCCTCATGG - Intronic
1109213530 13:59562763-59562785 CCGTTCCAGCAGAAGCTGCAGGG + Intergenic
1109727113 13:66356274-66356296 ACTTCCATGAAGGTGCTGCAGGG - Intronic
1112409734 13:99152735-99152757 ATTCCCAGGCAGAAGCTGCAAGG - Intergenic
1113584758 13:111457694-111457716 ACCTCCCCGCACACGCTGCATGG - Intergenic
1113941860 13:114022556-114022578 ACTTCCCTGCAGGATTCGCAAGG - Intronic
1114757037 14:25270896-25270918 TCTTCCCTCCAGAAGATGCAGGG - Intergenic
1115099844 14:29685363-29685385 GCTTCCCTGCAGATGATGAAAGG - Intronic
1117933103 14:60867975-60867997 TCATCACTGCAGCAGCTGCATGG - Intronic
1118913738 14:70083314-70083336 ACTGCCCTGCCCAACCTGCAGGG - Intronic
1119205995 14:72793907-72793929 ACCTCCATCCAGAAGCAGCAAGG - Intronic
1122199696 14:100114864-100114886 ACATCCTTGCGGAAGCGGCAGGG + Intronic
1122905070 14:104797832-104797854 AGGTCCCAGCAGCAGCTGCAGGG + Intergenic
1123146224 14:106133185-106133207 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1123186464 14:106522234-106522256 ACTCCTCTGCAGCAGCTCCAGGG + Intergenic
1202943079 14_KI270726v1_random:1267-1289 ACTCCTCTGCAGCAGCTCCAGGG - Intergenic
1124615972 15:31242432-31242454 TCTTCCCTGCAGAGACCGCATGG - Intergenic
1124697528 15:31877405-31877427 GCTTACCTGAAGAAGCTGCTAGG - Intergenic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1128791428 15:70437417-70437439 AGCTTCCTGGAGAAGCTGCAAGG - Intergenic
1130880037 15:88047003-88047025 ACCGCCCTGCAGAGGCTCCATGG + Intronic
1130993317 15:88889714-88889736 ACTTCCCTGCAGGGGCTGAGTGG + Intronic
1131763866 15:95654163-95654185 AGTTCACTGCAGAAGCAGCTAGG + Intergenic
1132004270 15:98212629-98212651 TCTCTTCTGCAGAAGCTGCAAGG + Intergenic
1133250492 16:4477137-4477159 ATTGCCCTGCAAAAGCTGCCGGG + Intronic
1136013424 16:27379499-27379521 CCCTCCCTGCAGAAGCCACATGG - Intergenic
1137012391 16:35335771-35335793 AGTTCCCTGCAGAGGAAGCATGG + Intergenic
1138211055 16:55163854-55163876 ACCTTCCTGCGGAGGCTGCACGG + Intergenic
1139871395 16:70111410-70111432 ACCTCCCTGCAGCACCGGCATGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1142453367 16:90198732-90198754 ACTTCCCTGTAAAAGCTTCCTGG - Intergenic
1142593545 17:1018533-1018555 AGCTTCCTGCAGAAGCTGCCAGG - Intronic
1142717679 17:1755819-1755841 GCTTCCCTGCTGGAGGTGCAGGG + Intergenic
1143061932 17:4209171-4209193 ACTGTGCTGCTGAAGCTGCAGGG + Intronic
1143135896 17:4712036-4712058 ATTGCCCTGGAGCAGCTGCAAGG - Intronic
1146595492 17:34164873-34164895 ACCTCCCTGCTAGAGCTGCACGG - Intronic
1146906806 17:36623157-36623179 GCTCCCCGGCAGAGGCTGCAGGG - Intergenic
1148160383 17:45446424-45446446 ACCTGCCTGCAGAACCTGCCAGG + Intronic
1148201457 17:45752691-45752713 AGTTCCAGGCAGAAGCTGCAAGG - Intergenic
1148577224 17:48720415-48720437 TCTTCCCTGGAGAAGATGCTTGG - Intergenic
1149599439 17:57884051-57884073 ACTTCCCTGGAGAGACTGCTTGG + Intronic
1150391669 17:64793303-64793325 ACCTGCCTGCAGAACCTGCCAGG + Intergenic
1151229955 17:72677358-72677380 ACATCACAGCAGATGCTGCAAGG + Intronic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1151834630 17:76574597-76574619 ACTCCCCTGCAGGGTCTGCAGGG - Intronic
1155910368 18:31498280-31498302 ACTTACCAGGAGAAGCAGCAGGG - Exonic
1156198860 18:34807564-34807586 ATTTCCCTGGAGATGCTCCAGGG + Intronic
1156386415 18:36609265-36609287 ACTTAGCAGCAGAGGCTGCAGGG + Intronic
1157947800 18:52000421-52000443 ACTTCCCTGGAGAATCTGAGAGG - Intergenic
1159026235 18:63184313-63184335 ACTTCCCTGCAGAGAGAGCATGG + Intronic
1160545986 18:79655931-79655953 ACTTTCCTTCAGAAGCCACAGGG + Intergenic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1162202672 19:9032468-9032490 GCTCCCCAGCAGAAGCTGTATGG + Intergenic
1162222752 19:9192123-9192145 AGTGCCCTGCAGCAGCTGCATGG + Intergenic
1162224085 19:9205200-9205222 AGTGCCCTGCAGAGGCTGCACGG + Intergenic
1162567954 19:11454375-11454397 ACGTCCCTGCGGAAGCCACAGGG - Exonic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1163318378 19:16556935-16556957 GGTTCCCCGCAGAAGCTGCAGGG - Intronic
1163507540 19:17717206-17717228 ACTTCCATTCAGAAGCTCCTGGG + Intergenic
1167276547 19:48543560-48543582 CCTTCCCTGCAGTGGCTTCAGGG - Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925270957 2:2607051-2607073 ACATCTCTTCAGAAGCAGCATGG - Intergenic
925931982 2:8715359-8715381 ACTTCTCTGGAGGAGCTGTAAGG + Intergenic
926343870 2:11927804-11927826 AGCTCCCTGCAGAAGCTGGGTGG - Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
927917612 2:26947047-26947069 ACTCTCCAGCCGAAGCTGCAGGG + Exonic
928288403 2:30014805-30014827 ACATCCCTGCACATGCTCCATGG - Intergenic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
928573016 2:32627543-32627565 ACTTCCCTGCACCAGCGGCAGGG + Intergenic
929078295 2:38096467-38096489 AATTGCCTGCAGGAGCTGCAGGG - Intronic
929555180 2:42921462-42921484 AATTCCCTGAAGAAGGTCCAGGG - Intergenic
930065103 2:47321871-47321893 ACTTTCTTCCAGAAGCTACAGGG + Intergenic
930439798 2:51391271-51391293 CCTTCCCAGCAGCAGCTACATGG - Intergenic
931917249 2:66969555-66969577 GCTTCCCTGGGGCAGCTGCATGG - Intergenic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
932709723 2:74053615-74053637 TCTTCCCTGAAGAAGCCACAGGG + Intronic
933339574 2:81004921-81004943 ACCTCCTGGCAGCAGCTGCATGG - Intergenic
934966646 2:98730469-98730491 AATTCCCTGCGAAGGCTGCACGG + Intronic
936532922 2:113289453-113289475 ACTTCCTTGCAGTAACTGAATGG - Intergenic
937242501 2:120471373-120471395 GCTTCTCTGGAGAGGCTGCATGG + Intergenic
937790657 2:125957702-125957724 AGTTCCCTGCAGAGCCTTCAGGG + Intergenic
938182595 2:129196528-129196550 ACTGTCCTCCAGAAGCTGGATGG + Intergenic
938548115 2:132353247-132353269 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
939615402 2:144356540-144356562 ACTTCCCAGCAGAAGCTTTAAGG + Intergenic
940659677 2:156531409-156531431 ACTTCTCTCCAGAAGATGCAAGG + Intronic
941567365 2:167126107-167126129 ACACCCTGGCAGAAGCTGCAAGG + Intronic
944910608 2:204306820-204306842 TCTTCTCTGCAGTAGTTGCAGGG - Intergenic
945147900 2:206758216-206758238 ATGTCCCAGCAGGAGCTGCAAGG + Intronic
947452257 2:230219791-230219813 ACTTCGCGGCAGCAGCTGCAGGG - Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947951948 2:234155429-234155451 ACATCCTTGAGGAAGCTGCAGGG - Intergenic
949084810 2:242143381-242143403 ACTTCCCTGTAAAAGCTTCCTGG - Intergenic
1168876800 20:1177467-1177489 ACTTCCCCTCAGTATCTGCAAGG - Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171406567 20:24915777-24915799 ACCTGTCTGCAGAATCTGCAGGG - Intergenic
1171814001 20:29767293-29767315 ACTTAACTGTAGAAGCTGAATGG - Intergenic
1171876984 20:30586019-30586041 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1173573936 20:44097801-44097823 ACTGCCCTGCTGACACTGCACGG - Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174136943 20:48386281-48386303 ACGTCCATGCAGGAGCTGCTGGG - Intergenic
1175697589 20:61114017-61114039 ACATCCCTGTTGAGGCTGCAGGG + Intergenic
1176882573 21:14215807-14215829 ACTTCATTGCAGAAGCTCCCAGG - Intergenic
1178300314 21:31447655-31447677 ACATTCCTGCAGATGCTTCAGGG - Intronic
1179245980 21:39634636-39634658 GCATCCCTGCAGGGGCTGCAGGG + Intronic
1179568208 21:42262200-42262222 ACTTCCTAGCAGAGGCTGCAAGG + Intronic
1180317453 22:11287896-11287918 ACTTATCTGCAGATGCTGAATGG - Intergenic
1180669482 22:17542266-17542288 ACTTATCTGCCCAAGCTGCAAGG - Exonic
1180675045 22:17581116-17581138 ACTCGCCTGCAGAACCAGCATGG + Exonic
1182695512 22:32196705-32196727 TCTTCCCTGGAGCAGCTGAAAGG - Intronic
1183080319 22:35451900-35451922 AGTCCCCTGCAGAAGCCACAGGG - Intergenic
1183515680 22:38264490-38264512 CATACCCTGCACAAGCTGCAGGG + Intronic
1183751653 22:39724325-39724347 GGCTCCCTGCAGAGGCTGCAAGG - Intergenic
1184300029 22:43553237-43553259 AGTTCCCTGCAGACACTGCGTGG - Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184500770 22:44870299-44870321 ACTTCAGTGCAGAGGCTGCCAGG - Intergenic
1185147234 22:49145222-49145244 CCTTCCCTCCTGTAGCTGCAGGG + Intergenic
949991204 3:9580695-9580717 ACCACACAGCAGAAGCTGCAAGG - Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
952391396 3:32883906-32883928 ACTTCCCTTCTGAAGCTGGAAGG - Intronic
952912842 3:38205135-38205157 ATTTCCCAGAAGTAGCTGCAGGG - Intronic
961321249 3:126078048-126078070 ACCTCCCTGAAGGACCTGCAGGG + Intronic
961615072 3:128172779-128172801 ACTTTGCTGCAGATGCTCCAAGG - Intronic
963139749 3:141937634-141937656 ACTGCCCTGCAGCACCTCCATGG + Intergenic
963912582 3:150827213-150827235 ACTGCCCTGCTGAAGCTGTAAGG - Intergenic
967902873 3:194474802-194474824 ACTTGCCGGCAGCAGCTGTAAGG - Intronic
971137499 4:23885955-23885977 ACTTGCCTCCAAAAGCCGCATGG - Intronic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
977468289 4:97409444-97409466 AGTTGTGTGCAGAAGCTGCAAGG + Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979262246 4:118661624-118661646 ACTTCCCTGTAAAAGCTTCCTGG - Intergenic
980529072 4:134027173-134027195 AGATCCAGGCAGAAGCTGCATGG - Intergenic
981700268 4:147600242-147600264 ACATGTCTGAAGAAGCTGCAGGG - Intergenic
981812592 4:148792808-148792830 ACTTCCCTGAAAAACCTCCAAGG + Intergenic
983149591 4:164261713-164261735 ACTTCCCTGTAAAAGCTTCCTGG + Intronic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
985024054 4:185721500-185721522 GTTTGCCTGCAGAAGCTTCAGGG - Intronic
985620722 5:953604-953626 ACTGCCCTGCACACACTGCAGGG - Intergenic
985724263 5:1507505-1507527 ACTTCCCAGCAGAAGGCCCAGGG + Intronic
988807771 5:34756368-34756390 TCATCCCTTCAGAGGCTGCAAGG + Intronic
989168991 5:38456850-38456872 ACTTCCCTTCAAAAGCTTGATGG + Intronic
990689776 5:58350625-58350647 ATTTCCCTGCAGAAGAGGCTAGG - Intergenic
991262790 5:64685135-64685157 TCTCTCCTGAAGAAGCTGCAGGG - Intergenic
991658419 5:68926453-68926475 ACTAAACTGCAGAAGCTGGAGGG - Intergenic
992073346 5:73168952-73168974 AGCTGCCTGCAGAAGCAGCATGG + Intergenic
992447762 5:76849428-76849450 ACCTGCCTGCTGAAGCTTCATGG - Intergenic
992712591 5:79474760-79474782 AATTCTCTGCAGAAACTGAAAGG + Intronic
995051932 5:107716833-107716855 CCTTCCCTCCAGAAGCACCAGGG - Intergenic
995271087 5:110220306-110220328 TTTTCCATGAAGAAGCTGCATGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
998165787 5:139842756-139842778 ACCTCGCTGGAGAAGCTGGAAGG + Exonic
998768877 5:145519085-145519107 ACTTCTCTGGTGGAGCTGCATGG + Intronic
999389454 5:151179703-151179725 CATTCCCTGCAGTGGCTGCAAGG + Intergenic
1000025225 5:157353007-157353029 CATTCCCTCCAGAAACTGCAGGG - Intronic
1001749894 5:174120844-174120866 TGTTCCCTGCAGCAGCTGCAGGG + Intronic
1002640515 5:180628557-180628579 TCTGCCCTGCAGAATCTCCAGGG - Intronic
1006463109 6:34175377-34175399 ATTCCCCTGCAGCAGCTACATGG - Intergenic
1006950841 6:37820000-37820022 ACTTACCCCCAGAAGCCGCAGGG - Exonic
1007740706 6:44008017-44008039 ACTTCCCTGCTGTAACTGCAGGG - Intergenic
1008439795 6:51520074-51520096 AAGTGCCAGCAGAAGCTGCAGGG - Intergenic
1011579194 6:88840115-88840137 ACTTCCCTGAAAATGCTGTAAGG + Intronic
1011945943 6:92903524-92903546 ACTTCCCTGGAGATGCTGTGGGG - Intergenic
1012480689 6:99663770-99663792 ACTCACCTGGAGAAGCAGCAAGG - Intergenic
1013618743 6:111869297-111869319 CCTTCCGTTAAGAAGCTGCAAGG + Intronic
1016733573 6:147452172-147452194 AATTCTCATCAGAAGCTGCATGG - Intergenic
1016947730 6:149549828-149549850 ACTCCCCTACAGAAGCAGAATGG - Intergenic
1017140112 6:151182567-151182589 ACTTTGCTGCCGAAGCTGGAGGG - Intergenic
1017724428 6:157267305-157267327 AGCTCCATGCAGAAGCCGCATGG - Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1021385231 7:20021291-20021313 ACTTCTCTTCAGAAGCTTCTAGG - Intergenic
1022083359 7:27045054-27045076 ACTTCCCAGTAGAGGCGGCAGGG - Intergenic
1022449012 7:30496526-30496548 ACTCCACTACAGATGCTGCATGG + Intergenic
1027170992 7:75872332-75872354 GCCTCCCTGGAGAAGCTTCAGGG - Intronic
1027710928 7:81600505-81600527 AAATCCCTGCAGAAGGTGAAGGG - Intergenic
1028070614 7:86445626-86445648 ACTTCCAGGCAAAAGCTGTAAGG + Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1030682626 7:112449969-112449991 ACTTCCCTGCGGCACCTGCCAGG - Intronic
1031137702 7:117902914-117902936 ATTTCACTGCAGAGGCTGCAAGG - Intergenic
1032364305 7:131285052-131285074 CTTTTCCAGCAGAAGCTGCAGGG + Intronic
1036412423 8:8514462-8514484 ACTTCCCTACAGTGGCTGAATGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038776092 8:30532002-30532024 ATTTCCCTGGTGAAGCTGGAGGG + Intronic
1039153245 8:34529021-34529043 ACTTCCCAGTAGAAGCGGCCGGG + Intergenic
1039346291 8:36709378-36709400 ATTTCCTTGCAGATGCTGAAAGG - Intergenic
1039891480 8:41688584-41688606 ACTTCCCTGCAGAAGAAGAAAGG + Exonic
1042563678 8:70092441-70092463 AATGCACTGCAGAGGCTGCAGGG + Intergenic
1045381531 8:101632218-101632240 ACTTCCCATCAGAGGCTGGATGG - Exonic
1047986314 8:130238058-130238080 ACTTCCCTGAAGAAGCCGAAAGG + Intronic
1048752945 8:137700168-137700190 AGTTCCCTGCAGAAGCTTCTTGG + Intergenic
1049439156 8:142601347-142601369 ATTTCCCTGCAGGTGCTGAAAGG + Intergenic
1051181687 9:14418354-14418376 ACTTCCCTGGGGAAACAGCATGG - Intergenic
1052872640 9:33523669-33523691 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1053752320 9:41269184-41269206 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1053752770 9:41273441-41273463 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054257847 9:62833516-62833538 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054258295 9:62837793-62837815 TCTGCCCTGCAGCAGCTGCACGG - Intergenic
1054333475 9:63782248-63782270 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1054351584 9:64021294-64021316 TCTGTCCTGCAGCAGCTGCACGG + Intergenic
1056135975 9:83629631-83629653 ACTTCCCTGAGGAAGCAGCATGG - Intronic
1056249754 9:84735447-84735469 GATGCCCTGCAGAAGCTGGAGGG + Intronic
1056309158 9:85321965-85321987 ACTGCCCTGGAGTAGATGCAGGG - Intergenic
1056482691 9:87021698-87021720 ACTTCCGTGCACGAGCTACATGG + Intergenic
1057204850 9:93165069-93165091 ACTCCCCTGCCTCAGCTGCAGGG + Intergenic
1062568787 9:137175021-137175043 ATTGACCTGCAGGAGCTGCAGGG - Exonic
1202800478 9_KI270719v1_random:170582-170604 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1202800924 9_KI270719v1_random:174864-174886 TCTGCCCTGCAGCAGCTGCACGG + Intergenic
1187213692 X:17254211-17254233 ACATCCCTCCAGCAGCTGCCTGG + Intergenic
1189251672 X:39605115-39605137 TGTTCCCAGCAGAAGCTGCAAGG + Intergenic
1189478421 X:41374924-41374946 ACTTCACTCAAGAAGCTGCAAGG - Intergenic
1191650150 X:63528769-63528791 ACCCCCCAGCAGCAGCTGCATGG + Intergenic
1192203399 X:69081310-69081332 GCTTCCCTGGGGGAGCTGCAGGG - Intergenic
1193455224 X:81724014-81724036 ACTTCCCAGCAGCAGCTGAATGG + Intergenic
1198228247 X:134666305-134666327 ACTTCCCAGCAAAAGCAGGAAGG + Intronic
1199513463 X:148649134-148649156 ACTTTCCTGCAGCCTCTGCAGGG + Intronic
1200394915 X:155979383-155979405 ACTTGGCTGCAGTGGCTGCAGGG - Intergenic
1202050930 Y:20779916-20779938 ATAGCCCTGCAGAAGTTGCAAGG - Intronic
1202231445 Y:22663259-22663281 GCTTCCATGGAGAAGCTGAAAGG - Intergenic
1202301723 Y:23422615-23422637 ACTTCCTTGTAGATACTGCATGG + Intergenic
1202311713 Y:23532906-23532928 GCTTCCATGGAGAAGCTGAAAGG + Intergenic
1202559089 Y:26137688-26137710 GCTTCCATGGAGAAGCTGAAAGG - Intergenic
1202569088 Y:26247983-26248005 ACTTCCTTGTAGATACTGCATGG - Intergenic