ID: 1170873452

View in Genome Browser
Species Human (GRCh38)
Location 20:20229573-20229595
Sequence CTGGGTAAGCAAATGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170873440_1170873452 21 Left 1170873440 20:20229529-20229551 CCAGCAGAGTTCTTAGCTCAGGA 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG 0: 1
1: 0
2: 0
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170873452 Original CRISPR CTGGGTAAGCAAATGGATGG AGG Intronic
902292589 1:15445119-15445141 CTGGTGGAGCAAATGCATGGAGG - Intronic
902527727 1:17070217-17070239 CTGGGTAGGAGAAAGGATGGAGG + Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
904600672 1:31671021-31671043 CTGGAGAAGAAAATGGCTGGTGG - Intronic
904800945 1:33092646-33092668 CTGCGTAAGCAAATGCATTGAGG + Intronic
905543879 1:38782165-38782187 CTAAGTAAGGAAATGGAGGGTGG + Intergenic
905799501 1:40834258-40834280 TTGGGTGACCAAGTGGATGGTGG - Intronic
908441594 1:64160655-64160677 TAGTGAAAGCAAATGGATGGGGG + Intronic
909025587 1:70478054-70478076 CTTTGTAAGCACATGGATGAAGG - Intergenic
910105835 1:83630235-83630257 CTAGGTGAGGAAATAGATGGAGG + Intergenic
910490211 1:87760887-87760909 CTGAGTAAGTAATTGGCTGGAGG - Intergenic
911036925 1:93560341-93560363 TTGGTTAAGCAAATGAAAGGGGG - Intergenic
915090288 1:153419457-153419479 CTGGGTGACCCACTGGATGGGGG - Exonic
915095205 1:153457634-153457656 CTGGGTGACCCACTGGATGGGGG + Intergenic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
916896860 1:169172458-169172480 CTTGGTAAGCAAGGGGATGATGG + Intronic
918270845 1:182897686-182897708 CTGGCTTTGAAAATGGATGGAGG + Intergenic
918637650 1:186797526-186797548 CTGGGTACTCAAATGTATTGTGG - Intergenic
920700576 1:208215445-208215467 CTAGGTAGACAAATGGATGATGG + Intronic
922282477 1:224139265-224139287 CTGGGAAAGAAAATTGGTGGTGG + Intronic
922743562 1:228030468-228030490 CTGGGTCAGCATATGCATGGTGG - Intronic
1063053559 10:2478599-2478621 CTGGGTTAGCAATGGGGTGGAGG - Intergenic
1064186516 10:13166762-13166784 CTGGGAAAGCGAATGAATTGAGG + Intronic
1066227981 10:33403208-33403230 CTAGGAAAGCAAGTGGATGGTGG - Intergenic
1067729030 10:48795819-48795841 CTGGGTCACCAAATGTATGCTGG + Intronic
1069285987 10:66716067-66716089 ATTGGCAAGCAAATGGATAGTGG - Intronic
1069668292 10:70179844-70179866 CCAATTAAGCAAATGGATGGTGG + Intergenic
1069939557 10:71945165-71945187 CTGGTTGAGCACATAGATGGGGG - Intergenic
1070498375 10:77046480-77046502 CTGGTTACTAAAATGGATGGGGG + Intronic
1071058367 10:81538545-81538567 CTGAGTGAGCAAAATGATGGAGG - Intergenic
1071226109 10:83530052-83530074 CTGGCTAAGGTAATGGATGAAGG - Intergenic
1072562537 10:96589394-96589416 CTGGGTTGGCAAATGCTTGGAGG + Intergenic
1075642057 10:124072002-124072024 CTGGGTAAGGAGAGGAATGGAGG - Intronic
1075672945 10:124276511-124276533 CTGGAAAAGCAAATGCACGGGGG - Intergenic
1078073047 11:8131354-8131376 TTGGGCAACCAAGTGGATGGTGG + Intronic
1078110828 11:8390435-8390457 CTGTGAAAGCAAATGGAGGAAGG + Intergenic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1079398013 11:20082722-20082744 CTGGCTCAGCAGATGGATGTTGG - Intronic
1081550592 11:44108176-44108198 CTGGTTAAGCACATCGATGGAGG - Exonic
1084616811 11:70241907-70241929 GTGGGTAAGTGGATGGATGGAGG - Intergenic
1084965840 11:72744010-72744032 CCGGGTAAGCAAAGGCTTGGTGG - Intronic
1085519681 11:77130701-77130723 ACGGGTAAGCATATGGATGAGGG - Intronic
1085925773 11:81018835-81018857 CTGTGGAAGCAAATGGAATGGGG - Intergenic
1085931232 11:81086082-81086104 CTGAGGAAGCACCTGGATGGCGG - Intergenic
1086150074 11:83599369-83599391 CTGGATAAGCAAAAGCAAGGAGG - Intronic
1087990502 11:104742187-104742209 CTGGTTAGGCAGATGGATGTAGG + Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1091504162 12:1050078-1050100 CTGGAAAAGCAAATGGATGTGGG + Intronic
1092132497 12:6122625-6122647 CTGGGTCTGCAAATGGCGGGAGG - Intronic
1096159003 12:49360899-49360921 GTGGGTAAGGATATGGAAGGAGG - Intergenic
1097731959 12:63138537-63138559 ACGGCTAAGTAAATGGATGGTGG - Intergenic
1100868956 12:98890128-98890150 CTGGGTGGGTAAATGGAGGGAGG + Intronic
1101485571 12:105155227-105155249 CTGGGTAAGGAGATGTAAGGGGG + Intronic
1101967508 12:109291529-109291551 CTGGCCAAGCAGATGGAGGGAGG - Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1105529212 13:21203037-21203059 CTGGGGAAGCAAATGCTTGCTGG + Intergenic
1109375146 13:61483015-61483037 CTGGGTAAGAAACTGGATTCTGG + Intergenic
1110522754 13:76499996-76500018 CTATGAAAGCACATGGATGGAGG - Intergenic
1112624240 13:101084448-101084470 CTGGGTAAGGAAAGGGAGAGTGG - Intronic
1117448301 14:55826391-55826413 CTGGGAAATCAAAAGGTTGGAGG - Intergenic
1118470117 14:66067596-66067618 CAGGGAAATCAAATGGAAGGGGG - Intergenic
1119399088 14:74349641-74349663 CTGGGTGGGCCAAGGGATGGAGG - Intronic
1119461432 14:74807643-74807665 TTGGGAAAACAAATGGAAGGAGG + Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1124014752 15:25864996-25865018 CAGGGTAAGCAAATGGAATGAGG - Intronic
1129103337 15:73286788-73286810 CTTGGTAAATAAATGGATGTAGG - Intronic
1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG + Intergenic
1130180275 15:81620143-81620165 GCAGTTAAGCAAATGGATGGTGG - Intergenic
1136000094 16:27285928-27285950 CAGGGGACGCAAATGGGTGGAGG + Intronic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1141046064 16:80717094-80717116 TTGGGTTGACAAATGGATGGAGG + Intronic
1141110201 16:81265693-81265715 ATGGGTAGGTAGATGGATGGTGG - Intronic
1141266915 16:82505985-82506007 ATGGGTAAGTGAATGAATGGAGG + Intergenic
1142152351 16:88518250-88518272 GTGGGTGAGTAGATGGATGGTGG + Intronic
1144804421 17:17954931-17954953 GGGGCTGAGCAAATGGATGGAGG - Intronic
1146500800 17:33362827-33362849 CTGAATAAGCAAATGAATGGAGG + Intronic
1147878137 17:43636213-43636235 CTGGGTAAGCCCATGGTGGGTGG - Intergenic
1148683046 17:49485723-49485745 ATGGGGCAGCAAATGGATTGAGG - Intergenic
1149606920 17:57931628-57931650 CTGGGTATTCAAGTTGATGGTGG + Intronic
1151270991 17:72995906-72995928 CTTGGTAACCAATTGGATGTGGG - Intronic
1151593600 17:75063267-75063289 CTGGCTAAGCAAATGAAAGCAGG - Exonic
1152473339 17:80502633-80502655 CTGGGGAAGCACATGGGTGGGGG - Intergenic
1152826530 17:82469473-82469495 CTCTATAAGCAAATGGAGGGAGG - Intronic
1153761274 18:8334580-8334602 CTGGGCATCCAAATGGCTGGCGG - Intronic
1153822390 18:8843394-8843416 CTGGGAAAGCAAATGGAGCCAGG + Intergenic
1154304716 18:13222189-13222211 ATGAGTAAATAAATGGATGGGGG - Intronic
1154313862 18:13288286-13288308 TTGGCTAAGCTAATGGAAGGTGG - Intronic
1156085812 18:33400436-33400458 CTGGCTAAGCTAATTGATGAAGG - Intronic
1156954071 18:42940096-42940118 CTGCATAAACAAATGCATGGGGG - Intronic
1158302278 18:56065416-56065438 CTGGGTAAGCATATGGACTCTGG + Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1161797274 19:6394255-6394277 TTGGCTAAGCAAAGGGAAGGCGG + Intergenic
1161857888 19:6776197-6776219 ATGGATGAGCAGATGGATGGAGG - Intronic
1163889464 19:19998017-19998039 CTGGCTAAGTGAATGCATGGGGG - Intronic
1166228570 19:41412272-41412294 GTGGGCAAGCAGGTGGATGGTGG - Intronic
1166511232 19:43410295-43410317 TGGGGTAAACAAATGCATGGGGG + Intronic
1167254149 19:48417269-48417291 CTGTGGAAGCAAGTGGCTGGTGG + Intronic
1167430911 19:49453872-49453894 CTGGGTAATCAAAGGGATGAAGG - Intronic
1167557759 19:50206281-50206303 CTGGGGAAGGAAAGGGCTGGGGG + Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
925260169 2:2521912-2521934 ATGGGTAGATAAATGGATGGAGG - Intergenic
926421050 2:12699758-12699780 ATGAATAAGTAAATGGATGGAGG + Intergenic
928669218 2:33583706-33583728 CTGTGAAAGAAAATGGCTGGAGG - Exonic
930130972 2:47850204-47850226 TTGGGCAATCCAATGGATGGTGG + Intronic
932746551 2:74338248-74338270 CTGGGGAGACACATGGATGGGGG + Intronic
934080936 2:88467331-88467353 CTGGGAAAGCAGAGGGATAGGGG + Intergenic
935266923 2:101402858-101402880 CTGGGTAAGCTATTGGAACGAGG - Intronic
935518547 2:104076520-104076542 CTGGAAAAGCAAAAGAATGGAGG - Intergenic
935891133 2:107679723-107679745 CCTGGTAAGCAAATGTTTGGTGG + Intergenic
937122938 2:119453268-119453290 TTGGGTAAGCTAACGGAAGGAGG - Exonic
937854659 2:126663612-126663634 ATGAGTCAGCAAACGGATGGAGG + Intronic
942080453 2:172395358-172395380 GTGGGAAAGCAAATGGACAGGGG + Intergenic
942625978 2:177901251-177901273 CTGAGTTAGCTCATGGATGGGGG - Intronic
944195967 2:197053231-197053253 TTGTGTACGCAAATGGATGTGGG - Intronic
944224266 2:197334514-197334536 AGGGGTAATGAAATGGATGGTGG - Intergenic
944943396 2:204654465-204654487 CTGGGGAAGTAAATGGAATGTGG + Intronic
947136736 2:226983451-226983473 CTGGGAAAAGAAATGGATTGAGG - Intronic
948169256 2:235888070-235888092 CATGATAAGCAAATGGAAGGAGG - Intronic
948278421 2:236727848-236727870 CTGGAAAAGCAAATGGGTTGAGG + Intergenic
1169653940 20:7901232-7901254 CTAGCTAAGAAAATTGATGGAGG + Intronic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1170934432 20:20797283-20797305 CTGGCTAAGCATATGTATGTCGG + Intergenic
1172939480 20:38644644-38644666 GTGGGTAAGTAGATGGGTGGGGG - Intronic
1173009730 20:39170754-39170776 CTGGGTCAGGCAATAGATGGGGG + Intergenic
1175220654 20:57414638-57414660 CAGGGTAAGCGAAGCGATGGAGG + Intergenic
1176887203 21:14270881-14270903 CTGGGTCAGCATATGTAGGGAGG + Intergenic
1177300326 21:19236048-19236070 TTCTGTAAGAAAATGGATGGAGG - Intergenic
1185075572 22:48680376-48680398 CTGGGCAGGCAACTGCATGGCGG - Intronic
950653712 3:14423729-14423751 CTGGGTTAGCAAGTGCATGTAGG + Intronic
950769631 3:15301224-15301246 CTAGGTAAGCAGATGGAGAGTGG - Intronic
950918789 3:16671466-16671488 CTAGGTAAGTAAATGAATTGGGG + Intergenic
951685293 3:25337189-25337211 GTTGGTAAGAAAAAGGATGGTGG - Intronic
952055469 3:29439750-29439772 CTGGGTAAGAAAAAGGGGGGAGG - Intronic
952428747 3:33201730-33201752 CTGGGTCAGCACATGCTTGGGGG - Intronic
959571843 3:107893210-107893232 CTGGCTAAGCCAAGGCATGGAGG + Intergenic
960221418 3:115113859-115113881 CTGGTTGAGCAAATAGAAGGTGG - Intronic
960458175 3:117899556-117899578 CTGGGAAAGCCATAGGATGGAGG - Intergenic
962171355 3:133104788-133104810 GTGGGCAAGGAAATGAATGGAGG - Intronic
964119460 3:153167388-153167410 CTGGGTAAGAAACTGGAGGAGGG - Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
970895468 4:21098266-21098288 CTAGCTAAGAAAATTGATGGAGG + Intronic
972179229 4:36443440-36443462 CTGAGTAAGGAAATTGATGTAGG - Intergenic
972292409 4:37701913-37701935 ATGGGTAACCAAAAGGTTGGTGG - Intergenic
973009198 4:45051278-45051300 TTGGGTAAGAAATTGCATGGAGG - Intergenic
981218379 4:142200096-142200118 CTGAATAAGTAAATGAATGGAGG - Intronic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
987387896 5:17347542-17347564 CTGGGTATGAAATTGAATGGGGG - Intergenic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
990338774 5:54801825-54801847 CTTGGTAAGAAAATGGATGAAGG - Intergenic
992473308 5:77077977-77077999 ATCGGTAAGAAAATGGAGGGCGG - Intronic
992846618 5:80755725-80755747 CTTGGTAATCAAAAGGATTGGGG + Intronic
1001335713 5:170795171-170795193 CAGGGTATGGAAATGGATGGGGG - Intronic
1002424955 5:179169484-179169506 CTGGGTGAGGAGGTGGATGGAGG + Intronic
1002472236 5:179442400-179442422 GTGGGTGAACAAATGGATGAAGG + Intergenic
1002472264 5:179442578-179442600 GTGGGTGAACAAATGGATGAAGG + Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004145734 6:13064340-13064362 CTGAGCAATTAAATGGATGGAGG + Intronic
1004519913 6:16352159-16352181 CTGGTTAACCCAAGGGATGGTGG + Intronic
1004543668 6:16575465-16575487 CTGGGTAAGGAAATAAATGCTGG - Intronic
1004713740 6:18196635-18196657 TTGGGAAAAAAAATGGATGGTGG + Intronic
1007013859 6:38443082-38443104 CTTGGCAGGCAAATGGATTGTGG + Intronic
1007481755 6:42154870-42154892 CTGGGTTGGCAGATAGATGGTGG - Intergenic
1008405850 6:51117784-51117806 CTGGGTAAGAACATGGTAGGTGG + Intergenic
1009418329 6:63439680-63439702 CTGGGAAAGAAAATAGATGGGGG - Intergenic
1011842508 6:91519345-91519367 CTGGCAAAGCAAATGGGTGATGG - Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013426463 6:110017316-110017338 CTGGGTAGACAAGAGGATGGTGG + Intergenic
1016494642 6:144646687-144646709 CTGGGAAAGCAAATGTATCAGGG + Intronic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017557040 6:155582982-155583004 GTGGGTAAGAAAATCGGTGGAGG + Intergenic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1021629346 7:22629202-22629224 CTGGCTTAGAAAATGGAGGGAGG + Intronic
1023883488 7:44334901-44334923 CTGGCAAAGCCAGTGGATGGAGG + Intergenic
1023935540 7:44737347-44737369 CTGGGTATGGACATGGGTGGGGG + Intergenic
1028698122 7:93741363-93741385 CTGAATAAGTAAATGAATGGAGG - Intronic
1029436240 7:100565500-100565522 CTGGGGAAGCAAAACAATGGGGG - Exonic
1030757155 7:113300924-113300946 TTGAATAAGTAAATGGATGGTGG - Intergenic
1031684806 7:124720450-124720472 CTGTGTAAACAAATGTAAGGTGG - Intergenic
1031815233 7:126425575-126425597 CTGGCTAAGACAATGAATGGAGG - Intergenic
1032980232 7:137273576-137273598 CCATGTAAGCAAATGAATGGAGG + Intronic
1033198367 7:139346832-139346854 CTTGGTTAGCAAGTGCATGGTGG - Intronic
1035279031 7:157765792-157765814 ATGGGTGAGTGAATGGATGGAGG - Intronic
1035814333 8:2522811-2522833 CTGGGTAAGGAAATAGAGAGTGG + Intergenic
1038024337 8:23575616-23575638 CAGGGCAAGCAGATTGATGGTGG + Intergenic
1039824099 8:41158195-41158217 CTGGGGAAGAAAAGGGATGGGGG + Intergenic
1040845456 8:51833224-51833246 CTGGGTAAGCAAAACAAAGGAGG + Intronic
1041371923 8:57170999-57171021 CTGGGGAGGCAAATGCATGCAGG - Intergenic
1044855361 8:96469869-96469891 CTAGAGAAGCAAAGGGATGGTGG - Intergenic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045726494 8:105179465-105179487 GTGGGTAAAGAAATGCATGGAGG - Intronic
1045918046 8:107497084-107497106 CTGGGTAAGCCAAGGTTTGGGGG - Intronic
1046999294 8:120557500-120557522 CTGGGTAAGAAGATAGATGTTGG + Intronic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1048979783 8:139697083-139697105 GTGGGTGAACAGATGGATGGTGG + Intronic
1049029793 8:140025929-140025951 CTGGGGACGGAAATGGATGATGG - Intronic
1049385663 8:142341794-142341816 CTGGGTAATTAACGGGATGGTGG - Intronic
1049456121 8:142690404-142690426 CTGGGTAAGTAACTGAATTGGGG - Intergenic
1049736694 8:144211391-144211413 CTGGGTAAGCAAATGGTACCTGG - Intronic
1050704726 9:8384244-8384266 CTGGGCAACCACATGGAAGGAGG - Intronic
1052206588 9:25848438-25848460 CTAGGTAAGTAAATGAATTGGGG + Intergenic
1052409663 9:28106652-28106674 CTGGGCAAGAAAATGGTGGGTGG - Intronic
1052984635 9:34477711-34477733 CTGGGTGACTAAATGGATAGTGG + Intronic
1053543592 9:38999486-38999508 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1053808022 9:41822991-41823013 CTGGGTAAGCAGCAGGATAGGGG - Intergenic
1054622570 9:67364437-67364459 CTGGGTAAGCAGCAGGATAGGGG + Intergenic
1055126806 9:72728265-72728287 ATGGGAAAGCAAATATATGGGGG + Intronic
1056315057 9:85380370-85380392 CTGTGTCTGCACATGGATGGAGG + Intergenic
1057408892 9:94799011-94799033 GAGAGTAAGAAAATGGATGGAGG - Intronic
1057633648 9:96742100-96742122 CTGTGTAACCACATAGATGGAGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058822977 9:108749386-108749408 CTGGGTAAGGAAAGCCATGGAGG + Intergenic
1059846257 9:118280293-118280315 CAGAGTTAGCAAATGAATGGTGG - Intergenic
1060010335 9:120038186-120038208 CTATATAAACAAATGGATGGTGG - Intergenic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1187073676 X:15913372-15913394 CAGGGCAAGCATGTGGATGGAGG - Intergenic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1189331836 X:40148915-40148937 CTGGGTGAGCATCTGCATGGAGG + Intronic
1189670981 X:43408372-43408394 CTGGATAAGCAGATCCATGGCGG + Intergenic
1190501447 X:51082672-51082694 CTGGGGAAGCAACATGATGGTGG - Intergenic
1191139186 X:57097524-57097546 CTGGGTAAGTAAATAAATGAAGG + Intergenic
1195756752 X:108206216-108206238 ATGGGTGAGGAAATGGAAGGTGG + Intronic
1196411417 X:115424157-115424179 GTGGGTAAGGAAATGGAGGAAGG - Intergenic
1196513241 X:116539069-116539091 CTGAGTGAGCAAATGAATGATGG - Intergenic
1197814708 X:130485246-130485268 CTAGGCAAACAAATGGAAGGTGG - Intergenic
1199539383 X:148942238-148942260 CAGGATAAGCAAAGGCATGGAGG + Intronic
1200275612 X:154729558-154729580 CTGGGTCACCAAATGCATGTGGG + Intronic