ID: 1170874472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:20237293-20237315 |
| Sequence | TCGTAAGGTACCCTGAGTCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1170874472_1170874481 | 26 | Left | 1170874472 | 20:20237293-20237315 | CCCAGACTCAGGGTACCTTACGA | No data | ||
| Right | 1170874481 | 20:20237342-20237364 | GGTCGCATCCTCATTCCTACAGG | No data | ||||
| 1170874472_1170874475 | 5 | Left | 1170874472 | 20:20237293-20237315 | CCCAGACTCAGGGTACCTTACGA | No data | ||
| Right | 1170874475 | 20:20237321-20237343 | GCTCCTTGCCCCGTTTCTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1170874472 | Original CRISPR | TCGTAAGGTACCCTGAGTCT GGG (reversed) | Intronic | ||