ID: 1170874472

View in Genome Browser
Species Human (GRCh38)
Location 20:20237293-20237315
Sequence TCGTAAGGTACCCTGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874472_1170874481 26 Left 1170874472 20:20237293-20237315 CCCAGACTCAGGGTACCTTACGA No data
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG No data
1170874472_1170874475 5 Left 1170874472 20:20237293-20237315 CCCAGACTCAGGGTACCTTACGA No data
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874472 Original CRISPR TCGTAAGGTACCCTGAGTCT GGG (reversed) Intronic