ID: 1170874472

View in Genome Browser
Species Human (GRCh38)
Location 20:20237293-20237315
Sequence TCGTAAGGTACCCTGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874472_1170874481 26 Left 1170874472 20:20237293-20237315 CCCAGACTCAGGGTACCTTACGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32
1170874472_1170874475 5 Left 1170874472 20:20237293-20237315 CCCAGACTCAGGGTACCTTACGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874472 Original CRISPR TCGTAAGGTACCCTGAGTCT GGG (reversed) Intronic
901389413 1:8934075-8934097 TTGAAAGGTACCATGAGTCTTGG + Intergenic
902929679 1:19722193-19722215 TCTTTTGGAACCCTGAGTCTAGG + Intronic
915610256 1:156986248-156986270 TCAAAAGGGGCCCTGAGTCTTGG + Intronic
917791933 1:178504517-178504539 TGGTCAGCTACCCTGAGGCTGGG + Intergenic
920225415 1:204434936-204434958 TCTTAAGGTCCCCTCAGTCTGGG - Intronic
1072237822 10:93468405-93468427 TGGTAATGTCCCCTGTGTCTTGG - Intronic
1085726547 11:78960015-78960037 TTCTAAGGTACCCTGATTTTAGG - Intronic
1112027519 13:95425281-95425303 TGGGAAGATACCTTGAGTCTAGG + Intergenic
1161565659 19:5000502-5000524 TGGTAAGGGACCCTGGGTGTGGG - Intronic
1167499121 19:49835749-49835771 CCCTACGGTACCCTGAGGCTGGG - Exonic
929766988 2:44853058-44853080 ACATAATGTACCCTGATTCTAGG + Intergenic
935066609 2:99653738-99653760 TCGTAGGGTGCCCTGTCTCTCGG - Intronic
948818573 2:240526569-240526591 TCCTCAGGTACCCTGAGTGCTGG + Intronic
1170559250 20:17541950-17541972 TCTCAAGGTAACCTGAGTTTTGG + Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1172085318 20:32377564-32377586 TAGTAAGGTACCTTGAGGATGGG + Intronic
1181389183 22:22567239-22567261 TGGTAGGGTAGCCTGAGTCGTGG + Intergenic
1181438529 22:22924023-22924045 CTGTGAGGTTCCCTGAGTCTGGG + Intergenic
949441372 3:4084499-4084521 TCTTCAGGTATCCTGTGTCTGGG - Intronic
953860106 3:46537046-46537068 TGGCAAGGATCCCTGAGTCTAGG + Intronic
963195636 3:142525938-142525960 TAGTAAATTACCCTGAGGCTGGG - Intronic
967536024 3:190604407-190604429 TGTTAAGGTAGCCTGATTCTTGG + Exonic
973650998 4:52997120-52997142 TGGAGAGGTACCCTCAGTCTGGG - Intronic
982740254 4:159050454-159050476 TCTTAAGGCTCTCTGAGTCTGGG - Intergenic
992880537 5:81105121-81105143 TCTTAAGATACCCTGATTGTGGG + Intronic
1005521439 6:26604259-26604281 TCCTAATGTAACCTGACTCTTGG - Intergenic
1005875211 6:30006260-30006282 TCTCAATGTTCCCTGAGTCTTGG - Intergenic
1008501739 6:52190392-52190414 TCCAAAGGAAGCCTGAGTCTAGG - Exonic
1019723225 7:2586360-2586382 CAGGAAGGTACCCTGTGTCTTGG - Exonic
1021074067 7:16278899-16278921 TCAGAAGGTACCCTGATTCAAGG + Intronic
1023152259 7:37213249-37213271 TCTTGAGGTACCCTGAAACTAGG - Intronic
1024576148 7:50766204-50766226 TCACAAGGGACCCTGAGTATAGG - Intronic
1024594281 7:50918831-50918853 TGGGAAGGTACCCGGACTCTGGG - Intergenic
1025781325 7:64604384-64604406 TCATAATGTACCCTGAGTGAAGG - Intergenic
1026651087 7:72216526-72216548 GCGTAAGGTACCCTGACCCTAGG + Intronic
1028144192 7:87304038-87304060 TAGAAAGCTACCCTCAGTCTTGG + Intergenic
1028717243 7:93985196-93985218 TCATAATCTACCTTGAGTCTGGG + Intronic
1043326195 8:79054882-79054904 GAGCAAGGTAACCTGAGTCTGGG - Intergenic
1051192856 9:14533580-14533602 GCTTAAGGTAGCCTGACTCTGGG + Intergenic
1055030953 9:71770770-71770792 TTGTAAGCTACACTGAGTTTGGG + Intronic
1058326038 9:103698917-103698939 TCATAAAGTACCCTTACTCTCGG + Intergenic
1198255573 X:134921485-134921507 TCATAAGGTAGCCTGAGTAGAGG + Intergenic
1199101400 X:143804949-143804971 TCGTATGATACCATGACTCTAGG + Intergenic