ID: 1170874473

View in Genome Browser
Species Human (GRCh38)
Location 20:20237294-20237316
Sequence CTCGTAAGGTACCCTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874473_1170874475 4 Left 1170874473 20:20237294-20237316 CCAGACTCAGGGTACCTTACGAG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170
1170874473_1170874481 25 Left 1170874473 20:20237294-20237316 CCAGACTCAGGGTACCTTACGAG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874473 Original CRISPR CTCGTAAGGTACCCTGAGTC TGG (reversed) Intronic
901218673 1:7569901-7569923 ATCGTCAGGTCCCCTTAGTCAGG + Intronic
902693514 1:18125351-18125373 CTCTTCATGTCCCCTGAGTCTGG + Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
920225416 1:204434937-204434959 CTCTTAAGGTCCCCTCAGTCTGG - Intronic
922008453 1:221556054-221556076 GTTTTAAGGCACCCTGAGTCTGG - Intergenic
923812171 1:237330806-237330828 CTCCTAAGGTAAGCTGGGTCTGG + Intronic
1065045887 10:21747445-21747467 CTCCTTAGGAACTCTGAGTCGGG - Intergenic
1079983844 11:27179572-27179594 CTCCAGAGGTACCCTGAGGCAGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1105379053 13:19869990-19870012 CTCATGAGAGACCCTGAGTCAGG - Intergenic
1114177530 14:20336416-20336438 CTACTAAGGTAGGCTGAGTCGGG + Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1124038093 15:26075079-26075101 CTCTTAAGGTTCCCTGAGGGAGG - Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1129232632 15:74205261-74205283 CTTCTAAGTTACCCAGAGTCAGG - Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1144055511 17:11537218-11537240 CTCCAAGGGGACCCTGAGTCAGG + Intronic
1161898548 19:7100454-7100476 CCCGTAGGGTACTCTAAGTCCGG + Intergenic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1165827054 19:38711507-38711529 CTCGGAAGGTCCCCTGGGGCAGG + Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
939789593 2:146555330-146555352 CTCATGAGATACCCTGAGCCAGG + Intergenic
948656489 2:239479695-239479717 CTCCTCATGCACCCTGAGTCAGG - Intergenic
1170874473 20:20237294-20237316 CTCGTAAGGTACCCTGAGTCTGG - Intronic
1181770771 22:25123742-25123764 CTCATGAGATACCCTGAGCCAGG + Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
994690739 5:103016470-103016492 CTCCAAAGGTGCCCTGGGTCTGG - Intronic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006681245 6:35798122-35798144 CTCCTAAGGGCCCTTGAGTCAGG - Intergenic
1013808462 6:114018319-114018341 CTCGTAGGGTACCCGAAGTCCGG - Intergenic
1023389269 7:39692728-39692750 CTACTAAGCTACTCTGAGTCAGG - Intronic
1027484430 7:78742834-78742856 CTGGTAAGGGACCCTGACCCAGG + Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1037556102 8:20024075-20024097 CTCATAAGATACCCTGAGCCAGG + Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1051192855 9:14533579-14533601 CGCTTAAGGTAGCCTGACTCTGG + Intergenic
1055024042 9:71700255-71700277 CTTGTAAGATAGCCTAAGTCAGG + Intronic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1192502510 X:71663224-71663246 CTCCTAAGGTACCATGATTGTGG + Intergenic
1192509713 X:71714600-71714622 CTCCTAAGGTACCATGATTGTGG + Intronic
1192516984 X:71766953-71766975 CTCCTAAGGTACCATGATTGTGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic