ID: 1170874474

View in Genome Browser
Species Human (GRCh38)
Location 20:20237308-20237330
Sequence GGCAAGGAGCAAGTCTCGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874474_1170874486 27 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874486 20:20237358-20237380 CTACAGGAGCTCCAGGACCAGGG 0: 1
1: 0
2: 1
3: 20
4: 194
1170874474_1170874475 -10 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170
1170874474_1170874485 26 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874485 20:20237357-20237379 CCTACAGGAGCTCCAGGACCAGG 0: 1
1: 0
2: 3
3: 25
4: 287
1170874474_1170874483 20 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874483 20:20237351-20237373 CTCATTCCTACAGGAGCTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 169
1170874474_1170874481 11 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874474 Original CRISPR GGCAAGGAGCAAGTCTCGTA AGG (reversed) Intronic
902578729 1:17394977-17394999 GGCATAGAGGAAGTCTCGGAGGG - Exonic
906108411 1:43308075-43308097 GGCAGGGAGTCAGTCTGGTAGGG + Intronic
908922550 1:69212863-69212885 GGGAAGGAGCAAGCCTCTTGAGG + Intergenic
915616859 1:157045847-157045869 GGGAAGGAGAAAGGCTCGCAGGG - Intergenic
919877489 1:201880696-201880718 CTCAAGGAGCTAGTCTAGTAGGG + Exonic
920916932 1:210265289-210265311 GGCAAGGGCCGAATCTCGTAGGG + Intergenic
922327638 1:224543683-224543705 GGCAGGAAGCAAGTCTGGCAAGG - Intronic
1063372422 10:5530503-5530525 GGAAAGGAGCCAGGCTCTTAGGG + Intergenic
1069276234 10:66594466-66594488 GGCAAGGACCAGGTCATGTAGGG - Intronic
1073594524 10:104786703-104786725 GGCAAGGACCTGGTCTCGAATGG - Intronic
1074187351 10:111108347-111108369 GGCAAGGAGCAGGCCTCTCAGGG - Intergenic
1077321419 11:1944201-1944223 GGCAAGAAGCCAATCTCGAAAGG + Intergenic
1083544648 11:63539133-63539155 GGCCAGGAGCAAGGCTGGGAAGG - Intronic
1084091441 11:66881663-66881685 GGCAAGGAGCAAGGCTCTGCTGG - Intronic
1084556803 11:69880424-69880446 GGGAAGGAGCAGGTCTGATAAGG - Intergenic
1096009803 12:48203206-48203228 GGCAAAGAGCAATGCTCGTGTGG + Exonic
1101859660 12:108472698-108472720 GCCAAGGGGCAAATGTCGTATGG - Intergenic
1103144926 12:118587316-118587338 GGCTAGGAGCAAGCATCTTATGG - Intergenic
1110985066 13:81956704-81956726 GGCATGGTGCCAGTCTCTTAAGG + Intergenic
1111986410 13:95070769-95070791 GGCAAGGAGCTGGCCACGTAAGG + Intronic
1112291906 13:98151439-98151461 GCCAAAGAGCAAGTATTGTAAGG + Intronic
1119600451 14:75972545-75972567 GGCAAGGAGCACTTCACGGAAGG + Intronic
1126285821 15:47009435-47009457 GGCAAGGACCCAGTCCTGTAAGG - Intergenic
1126699446 15:51354922-51354944 GGCAAGAAACAATTCACGTATGG + Intronic
1126793542 15:52242047-52242069 GGCAAGGAGGAGGTATCGAAAGG - Exonic
1128776263 15:70322823-70322845 GGAAAGGAGCAGGTCTCTTGAGG - Intergenic
1134625756 16:15721332-15721354 GGCCAGGAGCTAGCCTCGCATGG + Intronic
1143491892 17:7289730-7289752 GGCAAGGAACAAGGCTCTGAGGG + Intronic
1147583849 17:41641418-41641440 GGCAAGGAACAAGTCTCTCCTGG + Intergenic
1151429529 17:74053061-74053083 CGCAATGCGCAAGTCTCGGAAGG - Intergenic
1151949905 17:77345806-77345828 GCCAAGGAGAAAGACTCATAAGG + Intronic
1161854112 19:6753859-6753881 GCCTAGGAACAAGTCTCGTGTGG + Intronic
1165838198 19:38771914-38771936 AGCAAGGAGCAAGGCTCCTGGGG - Exonic
1165841367 19:38790783-38790805 AGCAAGGAGCAAGGCTCCTGGGG + Exonic
1165881792 19:39049360-39049382 GGCAAAGAGCACGTCTTATATGG + Intergenic
925440205 2:3879183-3879205 GGCAATGAGGAAGTCTCAGAAGG + Intergenic
931235827 2:60412012-60412034 GGTAAGGAGCAAGGGTTGTATGG - Intergenic
936029546 2:109059981-109060003 GTCAAGGAGCAGGTCTGGGAAGG - Intergenic
1170812257 20:19683734-19683756 GACAAGGAGGAATTCTCTTATGG + Intronic
1170874474 20:20237308-20237330 GGCAAGGAGCAAGTCTCGTAAGG - Intronic
1174267491 20:49342448-49342470 GTCAAGGAGCAAGTCTCCATTGG - Intergenic
1175642824 20:60645275-60645297 GGCATGGAGCAACTCTGGGAGGG + Intergenic
1177338066 21:19759749-19759771 GGCAAGGAGGAACCCTCGAAAGG - Intergenic
1182934724 22:34210256-34210278 GGGAAGAAGCAAGTGCCGTAAGG + Intergenic
1185371701 22:50463958-50463980 TGCAAGGAACAGGTCACGTATGG + Intronic
952502689 3:33978692-33978714 GGAAAGGAGCTAGTCCCATATGG - Intergenic
954441432 3:50524417-50524439 GGCAAGGTCCAAGTCTCGCGTGG - Intergenic
954665544 3:52249523-52249545 AGCAAGCAGCAAGTCTGGGAGGG - Intronic
959446473 3:106446555-106446577 GGCAAGGAGCAAAGCTAGCAAGG - Intergenic
963208260 3:142658514-142658536 GGCAAGGAGCAGGGCTTGCAGGG - Intronic
974602627 4:64105135-64105157 GGCAAGAAGTAAGTCTCCCATGG - Intergenic
975272262 4:72449733-72449755 GGGAAGAAGCCAGTCTTGTATGG - Intronic
976112225 4:81688140-81688162 GGCAATGAGCTAGGCTCCTAAGG + Intronic
979210504 4:118095326-118095348 GGCAAGGACCAAGTAATGTAAGG + Intronic
982037770 4:151363120-151363142 GGCATGTAGCAAGTCCTGTAGGG - Intergenic
985777779 5:1853908-1853930 GGGAAGGAGCCAGTCTGGGAAGG - Intergenic
987859080 5:23460624-23460646 GTCAAGGAGCCAGTTTCATAGGG + Intergenic
998401452 5:141850910-141850932 GGCCATGAGAAAGTCTCTTAAGG - Intergenic
1000479946 5:161760457-161760479 GGTAAGGAGCAAATTTGGTAAGG + Intergenic
1001651340 5:173318305-173318327 GGAATGGAGCAAGTCCCGAATGG + Intronic
1003447044 6:6194247-6194269 GACAAGGAGCAAGTCTCTCAGGG + Intronic
1004566952 6:16807144-16807166 GGCAAGGAGGAACTCTTGTGGGG - Intergenic
1011283370 6:85699801-85699823 GGCAAGGAGCTAGTTTCCTTTGG + Intergenic
1015041835 6:128730020-128730042 GGCAAGGAGCAACTCTTCTGAGG - Intergenic
1033451667 7:141467521-141467543 GGGAAGGGGCAAGTCTGGCAAGG - Intronic
1035579016 8:728275-728297 AGCAAGGAGCAAGTCCTGTATGG + Intronic
1040558343 8:48500844-48500866 TGCAAGGAGCAAATCTCCAAGGG - Intergenic
1045680867 8:104658407-104658429 GGCAAGGACCAAGTCACTTATGG + Intronic
1056514880 9:87340635-87340657 GGGAAGGAGCAAGTCTGCTCAGG - Intergenic
1056562362 9:87742788-87742810 GGCAAGGAGGAAGTCTGCTTTGG - Intergenic
1059827552 9:118048663-118048685 AGCAAGGAGCACATCTAGTAGGG - Intergenic
1187246936 X:17561320-17561342 GGTAAGGGGCAAGACTTGTAGGG - Intronic
1187466572 X:19532774-19532796 GGCAGGGACCAGGTCTCTTAAGG - Intergenic
1195597278 X:106706208-106706230 GGCTAGGAGGAAATCTCTTAGGG + Intronic
1197033832 X:121851275-121851297 GCCAAGGAGCATGACTCATATGG + Intergenic
1200958768 Y:8977342-8977364 AGCAAGGTGCTAGTCTCTTATGG - Intergenic