ID: 1170874475

View in Genome Browser
Species Human (GRCh38)
Location 20:20237321-20237343
Sequence GCTCCTTGCCCCGTTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874473_1170874475 4 Left 1170874473 20:20237294-20237316 CCAGACTCAGGGTACCTTACGAG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170
1170874474_1170874475 -10 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170
1170874469_1170874475 21 Left 1170874469 20:20237277-20237299 CCAGGGTTGAGTCACACCCAGAC 0: 1
1: 0
2: 0
3: 17
4: 105
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170
1170874472_1170874475 5 Left 1170874472 20:20237293-20237315 CCCAGACTCAGGGTACCTTACGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG 0: 1
1: 0
2: 3
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874475 Original CRISPR GCTCCTTGCCCCGTTTCTCC AGG Intronic
900858465 1:5205437-5205459 TCTCTTTGCTCCTTTTCTCCTGG + Intergenic
902598878 1:17527469-17527491 GCTCCCTGCCCTGTGGCTCCAGG - Intergenic
904430515 1:30461218-30461240 GCTCCCTGCCCAGCTTGTCCTGG - Intergenic
904677103 1:32205409-32205431 CCTCCTTGCGCCTTTCCTCCCGG + Intergenic
905017575 1:34788123-34788145 AGTCCTGGCCCCTTTTCTCCAGG + Intronic
906128751 1:43443330-43443352 GCTCACTGCCCTGTTTCCCCAGG + Exonic
912524503 1:110271139-110271161 TCTCTTTGCTCAGTTTCTCCAGG - Intronic
915299988 1:154946326-154946348 GGTCCTGGCCCCAGTTCTCCAGG + Exonic
915585108 1:156840245-156840267 GCTCCTTCCTCCTTTTCTCCAGG - Exonic
918045628 1:180939329-180939351 GCTGCATGCCCAGTTTCTCCTGG + Intronic
919416851 1:197321229-197321251 GCTCCTTGCCCAGTGTATTCTGG - Intronic
920080295 1:203368249-203368271 GCGCCTTGCCCCATTTCACCAGG - Intergenic
923473439 1:234312289-234312311 GCTCCTTCCCCCGTCCCTCCTGG - Intronic
924601578 1:245494349-245494371 TCTCCTAGCGCCTTTTCTCCTGG - Intronic
1063689485 10:8272712-8272734 GCACCTTGCCCAATGTCTCCTGG - Intergenic
1065367812 10:24952564-24952586 GCTCCCGGCCATGTTTCTCCCGG + Exonic
1069597361 10:69681122-69681144 GGTCCTTGCCCCTTTTCCACTGG - Intergenic
1070771961 10:79087856-79087878 TCCCCTTGCCCCGGTTCCCCAGG + Intronic
1072049280 10:91687435-91687457 ACTACTTACCTCGTTTCTCCTGG + Intergenic
1073284114 10:102376945-102376967 GACTCTTGCCACGTTTCTCCTGG - Exonic
1073538834 10:104301551-104301573 CCTCCTTCCCTCTTTTCTCCAGG - Intronic
1076768921 10:132652363-132652385 CCTCCTTTCCCCGCTCCTCCTGG - Intronic
1076917176 10:133430107-133430129 GCTCCAGGCCCAGCTTCTCCTGG + Intergenic
1076937271 10:133574866-133574888 GCTCCAGGCCCAGCTTCTCCTGG + Intergenic
1077378516 11:2216635-2216657 GCTCCCTGCCCCCTTTCTCCTGG + Intergenic
1079348245 11:19671494-19671516 GCTCCCTCCCCTGTTTCTCGTGG + Intronic
1081490697 11:43566270-43566292 GCTCCTCACCCCTTTTCTGCTGG - Intronic
1083243005 11:61403744-61403766 GCTTCTTTCCCCATTCCTCCTGG + Exonic
1083641780 11:64149572-64149594 GGTCCCTGCACCCTTTCTCCTGG + Intronic
1083726552 11:64631352-64631374 GCTCTTTGCTCCCCTTCTCCAGG - Intronic
1084435147 11:69135148-69135170 GTTCCTGGCCCCATTTCTCAGGG + Intergenic
1084555497 11:69873542-69873564 GCTCCAGGCCCCATTTCACCAGG + Intergenic
1084796382 11:71507503-71507525 GCTCCTTGTCCTCTTTCCCCAGG - Intronic
1085119617 11:73958716-73958738 GCCCCTTACTCTGTTTCTCCCGG - Intronic
1088448357 11:109955599-109955621 ACTCCTTGCCCCTGCTCTCCTGG - Intergenic
1088557974 11:111082446-111082468 GCTCCATGACCCCTGTCTCCTGG - Intergenic
1091284757 11:134402440-134402462 ACTCCCTGCCCCGTCTCCCCAGG + Intronic
1094041633 12:26125752-26125774 GCTCCCCGCCGCGTTCCTCCAGG - Intronic
1095783436 12:46085696-46085718 TCTACTAGCCCTGTTTCTCCTGG - Intergenic
1097190309 12:57216540-57216562 ACGCCCTGCCCCGTTCCTCCTGG + Intergenic
1098895466 12:76055408-76055430 GCTGCTTGTCCCCTTCCTCCTGG + Intronic
1099143270 12:79007130-79007152 CCTCTATGCCCAGTTTCTCCTGG - Intronic
1100587893 12:95996234-95996256 GCTGCTGGCCCCCTTTCTTCAGG + Exonic
1101075897 12:101129597-101129619 CCTCCTTCCACCGTTTCCCCTGG - Intergenic
1102025003 12:109709482-109709504 TCTTCTTTCCCCGTTTCTCCAGG + Intergenic
1103727074 12:123003299-123003321 GCTCCTGGGCCCATTTCCCCAGG + Intronic
1111584683 13:90269152-90269174 TCTCATTGGTCCGTTTCTCCTGG - Intergenic
1112368509 13:98774966-98774988 CGTCCTTGCTCCGGTTCTCCTGG - Intergenic
1113741827 13:112716522-112716544 CCTCCTTGCCCCCTCTGTCCCGG - Intronic
1115854509 14:37616270-37616292 GCTCCTTTCCCTGATTCTTCTGG + Intronic
1118351015 14:64972387-64972409 GCTCCCCGCCCCCTCTCTCCGGG - Intronic
1120821283 14:88914015-88914037 GCTCCATGCCCCCTCTCTGCTGG - Intergenic
1122591944 14:102859845-102859867 TTTCCTTGCCCTGTTCCTCCAGG - Intronic
1122829665 14:104389615-104389637 CCTCCCTGCCCCTTCTCTCCAGG - Intergenic
1124045742 15:26148359-26148381 TCTCCCTGCCCCGATTCTGCTGG + Intergenic
1127006129 15:54572022-54572044 GCTCCTTTCCCAGTGTTTCCTGG + Intronic
1129054438 15:72808951-72808973 CTTCCTTGCCCTGTTTCTCTCGG - Intergenic
1129794116 15:78363066-78363088 GCCTCTGGCCCCGTTTCCCCAGG - Intergenic
1130670430 15:85907730-85907752 GCTCCATGTCCCTTCTCTCCTGG + Intergenic
1132466135 16:78166-78188 GCTCACTGCCCCCCTTCTCCCGG + Intronic
1132482856 16:175241-175263 GCTCCCTGCCCTGTCTCCCCAGG - Intergenic
1133312789 16:4861072-4861094 GCTCCTTAACGCGCTTCTCCAGG - Exonic
1133344781 16:5062536-5062558 GCTCCTGGGCCCACTTCTCCCGG + Exonic
1133627236 16:7582100-7582122 GCTCATTGCAACCTTTCTCCTGG + Intronic
1134846190 16:17442649-17442671 GGTCCTTGCCCCCTCTCTCAAGG - Intronic
1137277007 16:46941950-46941972 GCACCATGCCCTGTTTCTCAGGG + Intergenic
1138226719 16:55302351-55302373 TCTCCTGGCCTCGTTTCTGCAGG + Intergenic
1138504865 16:57473256-57473278 GCAGCTTGCTCCCTTTCTCCAGG + Exonic
1143344214 17:6238244-6238266 GCTCCTTCCCCGGTCCCTCCGGG + Intergenic
1145117830 17:20227904-20227926 GCTCCATTCCACATTTCTCCTGG - Intronic
1149344185 17:55717644-55717666 TCTCCTTGTGCAGTTTCTCCAGG + Intergenic
1150643443 17:66964554-66964576 GGTCCGCGCCCCGTTTCTCTCGG - Intergenic
1151959897 17:77400382-77400404 GCTCCTTGCCCAGCTTCTGGTGG + Intronic
1152263184 17:79278232-79278254 GCTCCCTGGCCCGTGGCTCCAGG + Intronic
1153019137 18:611063-611085 GCTCCTTGCTCCCTTCCTCCTGG + Intronic
1154377599 18:13822823-13822845 GCTTGTCACCCCGTTTCTCCTGG - Intergenic
1160042842 18:75361052-75361074 TCTCCATGCCCAGTATCTCCTGG - Intergenic
1161156164 19:2732840-2732862 GCTCCTTGGCCAGGATCTCCAGG + Exonic
1161269631 19:3382698-3382720 CCTCCTTGCCCCGTGTCACCCGG - Intronic
1162315517 19:9936216-9936238 CCTCCCAACCCCGTTTCTCCGGG + Intronic
1163267266 19:16228639-16228661 GCCCCTGGCCCCACTTCTCCAGG - Intronic
1165461640 19:35947279-35947301 GCTCCTAGGCCCCTTTCCCCAGG - Intergenic
1166108780 19:40610467-40610489 CCTCCTTGCGTCGCTTCTCCCGG + Intronic
1166355369 19:42224365-42224387 GCTCCTGCCCCTCTTTCTCCAGG + Exonic
1167006250 19:46778089-46778111 ACTCCTTCCACCGTCTCTCCTGG - Intronic
1167332601 19:48865710-48865732 GGTCCTTGACCCATTTCTCAGGG - Intronic
1168327271 19:55544802-55544824 GCTCCTTGCCCAGCCTCACCAGG - Exonic
1202669360 1_KI270709v1_random:37044-37066 GCTCCTTGCCTCTTTTGTCTGGG - Intergenic
927128511 2:20036198-20036220 GCCCCTGGCCACCTTTCTCCAGG + Intronic
934753430 2:96809236-96809258 AATCCTGGCCCTGTTTCTCCAGG + Intronic
936977872 2:118237436-118237458 ACTCCCTTCCCAGTTTCTCCTGG - Intergenic
942664397 2:178301787-178301809 GCTCTTTGCCCTGCCTCTCCTGG + Intronic
944468619 2:200029571-200029593 GCTCCAGGCCCTTTTTCTCCTGG + Intergenic
947539642 2:230967237-230967259 CCTCCTTGCCCCCTTTCTATTGG - Intergenic
948676148 2:239597917-239597939 TCTCCTGGCCCCGTTTCTCTCGG - Intergenic
1170874475 20:20237321-20237343 GCTCCTTGCCCCGTTTCTCCAGG + Intronic
1170932821 20:20784100-20784122 GCTCCATCCCCCTTCTCTCCAGG - Intergenic
1172036578 20:32015053-32015075 GCACCTTGACCTCTTTCTCCAGG - Exonic
1172758131 20:37301851-37301873 GCCCCTTGCCCACTTTCACCTGG - Intronic
1173048187 20:39532656-39532678 CTTCCCTGCCCAGTTTCTCCTGG + Intergenic
1175424530 20:58855221-58855243 GCTTCTGGGCCCGCTTCTCCAGG - Exonic
1176069994 20:63221275-63221297 GCTCCTAGCCCCGGTCCTGCTGG + Intergenic
1176311535 21:5153330-5153352 GCTCCATGCCCCTCTTCACCTGG - Intronic
1176370682 21:6059993-6060015 GCTCCTTCCCTCTCTTCTCCTGG + Intergenic
1178910405 21:36669064-36669086 GCTCCTTCCTCTGTCTCTCCTGG - Intergenic
1179534298 21:42041317-42041339 GCTCCTATTCCCGCTTCTCCTGG + Intergenic
1179752837 21:43478548-43478570 GCTCCTTCCCTCTCTTCTCCTGG - Intergenic
1179788821 21:43743912-43743934 CCTCCGTGCCCCGCCTCTCCGGG + Intronic
1179845515 21:44108705-44108727 GCTCCATGCCCCTCTTCACCTGG + Intronic
1181908836 22:26221541-26221563 GCTCCTTGCACACTTTCTCAGGG - Intronic
1182661695 22:31929625-31929647 GTTCCTCTGCCCGTTTCTCCTGG + Intergenic
1183577224 22:38699885-38699907 GCTCCCTGCGCTGTTTCTCATGG + Exonic
1184936982 22:47731877-47731899 GCTCCTTTCCCGGTATTTCCAGG + Intergenic
950359866 3:12442576-12442598 GTTCCTTGCCCAGCGTCTCCTGG + Intergenic
950582869 3:13874040-13874062 TCTCATTGCCCTGTTGCTCCTGG - Intronic
954156986 3:48690994-48691016 GCTCCTTGCCCTCTTCCTCTAGG + Intronic
954353841 3:50068305-50068327 GCTCCTTTCCATGTTTCTCTGGG + Intronic
954690113 3:52391271-52391293 GCTCCTCGCCCACGTTCTCCAGG - Exonic
954759289 3:52862243-52862265 GCCCCTTTCCCCATTTCTACTGG + Intronic
955006536 3:54973884-54973906 ACTCCTTGCTACTTTTCTCCAGG - Intronic
955060383 3:55487968-55487990 TCTCTTTTCCCCGTTTTTCCAGG + Intronic
955885365 3:63592175-63592197 GCTCCTCTCCCAGTTTCTACTGG - Intronic
960055631 3:113274527-113274549 GCCCCCTGCCCCTTCTCTCCTGG - Exonic
960822493 3:121749507-121749529 CCTCCTCGCCCCGCCTCTCCCGG - Intronic
961015888 3:123467941-123467963 GCTGCTTCCACTGTTTCTCCTGG - Intergenic
962088747 3:132220628-132220650 GCTCAGTGCCCCATTTCTTCTGG - Intronic
968593642 4:1471845-1471867 GCTCCCTGCCCGGTGTCTCGGGG + Intergenic
968788741 4:2644295-2644317 GTTCCTTGTCCCGCTCCTCCTGG - Intronic
969036225 4:4256008-4256030 GCTTCCTGCCCTCTTTCTCCTGG - Intergenic
969955759 4:10889115-10889137 GCTCCCTGCCTCCTCTCTCCAGG - Intergenic
972404831 4:38735712-38735734 ACTCATTGCCTCCTTTCTCCTGG - Intergenic
973936748 4:55853932-55853954 CTTCCTTTCCCCGTTTGTCCCGG + Exonic
977839696 4:101687606-101687628 GATTCTTGCCACTTTTCTCCAGG + Intronic
979414963 4:120425675-120425697 CCTCCTTGCCCCCTCTCTTCTGG - Intergenic
986315103 5:6581894-6581916 TCTCCTTGCCTGGTTTCTCTGGG + Intergenic
989151215 5:38301551-38301573 TCTCCTGACCCTGTTTCTCCAGG - Intronic
990027907 5:51218180-51218202 GCTCCCTGCCCCTCTTCTCTTGG - Intergenic
992909888 5:81385722-81385744 GCTCCATGGCTCCTTTCTCCTGG - Intronic
992910887 5:81394594-81394616 GCTGCTTGCTCCACTTCTCCGGG - Intergenic
993121529 5:83780259-83780281 GCTCCTTGCTCCTTTTCTCCAGG + Intergenic
993872291 5:93267406-93267428 GCTGCTGGGCCCGGTTCTCCAGG - Intergenic
995072736 5:107943030-107943052 GCTCCTTGCCCTGCCTCTCTGGG + Intronic
997643603 5:135465948-135465970 GGCCCTTGCCCCGGTTCTGCAGG + Intergenic
1001259814 5:170218836-170218858 GCTCTTTTCCCCTTGTCTCCTGG - Intergenic
1002608991 5:180401573-180401595 GCTCCATGTCTCATTTCTCCAGG - Intergenic
1004274697 6:14225339-14225361 GCTCCTAGCACCCTTTCTCAGGG + Intergenic
1006022002 6:31122855-31122877 CCTCCTTGCCCAGGTCCTCCAGG - Intronic
1013616796 6:111850895-111850917 CCTCATTGCCACGTTTCCCCAGG + Intronic
1016062523 6:139645566-139645588 ACTCCTTTCCCAGGTTCTCCTGG - Intergenic
1018543728 6:164913117-164913139 GATCCTTCCCCCGTTACTCCAGG + Intergenic
1018686369 6:166307602-166307624 CCTACTCGCCCCGTGTCTCCCGG - Exonic
1019416994 7:932393-932415 GGCCCTTGCCCCGTTTGCCCTGG + Intronic
1019632603 7:2057931-2057953 TCTCCATGCCCCTTTCCTCCAGG - Intronic
1019799533 7:3077925-3077947 ACTCCCTCCCCAGTTTCTCCTGG + Intergenic
1023610708 7:41967711-41967733 GGTCCCTGCCGGGTTTCTCCTGG + Exonic
1023846164 7:44121840-44121862 GCTGCTGGGCCCGGTTCTCCAGG + Exonic
1023938846 7:44757522-44757544 GCTCCTGGCTCTGCTTCTCCTGG - Exonic
1027735510 7:81927858-81927880 GCCCTTTGCCCCATTCCTCCAGG - Intergenic
1028382291 7:90212303-90212325 TCTCCTTGCCTTCTTTCTCCTGG - Intronic
1032095275 7:128935121-128935143 GCCCCTTCCCCCATTTCCCCTGG - Intergenic
1034814990 7:154164273-154164295 GCTCCTTCCCTCCTTCCTCCAGG + Intronic
1038410492 8:27354823-27354845 GCTCCTTGTTCTGTCTCTCCTGG + Intronic
1039174883 8:34792627-34792649 CCTCCTAGCCCCCTTTGTCCTGG + Intergenic
1039289215 8:36076091-36076113 ACTCTTTGTCCCTTTTCTCCAGG + Intergenic
1041838888 8:62247689-62247711 GCTCCTTGCGCAGTTCCACCAGG + Intergenic
1042715048 8:71763421-71763443 GGTCCCTGCCCAATTTCTCCAGG - Intergenic
1044214404 8:89591808-89591830 GCTCCCCACCCCTTTTCTCCAGG + Intergenic
1045108902 8:98920742-98920764 GCCTCTTGCCCTGCTTCTCCAGG - Intronic
1047999325 8:130364668-130364690 GCTCCTTGCCCCATTCCTCCAGG + Intronic
1050151071 9:2620440-2620462 TCTCCTTGCCCTGGTTCTCCTGG - Intergenic
1053314008 9:37036819-37036841 GCCCCTTGTCCCGTATCTCTAGG - Intergenic
1053479120 9:38402971-38402993 GCTTCTTGCCTCATCTCTCCTGG - Intergenic
1054763075 9:69020730-69020752 CCTCCTTGCCCTCTTTCACCTGG + Intergenic
1056494441 9:87141947-87141969 GCTCCTTCCCCCACTTCCCCGGG - Intergenic
1060198502 9:121638459-121638481 GCTCCCTGCGCCTTTCCTCCAGG - Intronic
1061422750 9:130480935-130480957 GCTCACTGGCCCTTTTCTCCAGG + Intronic
1062035353 9:134380346-134380368 GCTCCTGACCCAGGTTCTCCAGG - Intronic
1062465172 9:136677680-136677702 GCTCCCTCCCCTGTGTCTCCCGG - Intronic
1062484039 9:136765292-136765314 GCTCCTTGCCCAGTGTCCCTGGG - Intronic
1062584866 9:137244705-137244727 GCTTCATTCCCCGTTTCACCTGG - Exonic
1189734650 X:44057537-44057559 TCTCCTTGCCCAGGCTCTCCTGG - Intergenic
1196496173 X:116327714-116327736 CCTCCCTGGCCCGTTTCCCCTGG + Intergenic
1196520696 X:116667689-116667711 GCTCCTACCCCCATTGCTCCTGG - Intergenic
1199815185 X:151391466-151391488 CCTCCTTGCCTTGCTTCTCCTGG + Intergenic