ID: 1170874476

View in Genome Browser
Species Human (GRCh38)
Location 20:20237324-20237346
Sequence CGACCTGGAGAAACGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874476_1170874489 30 Left 1170874476 20:20237324-20237346 CCTTGCCCCGTTTCTCCAGGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1170874489 20:20237377-20237399 AGGGAGCTCTGAGCCACCCAAGG 0: 1
1: 0
2: 4
3: 19
4: 274
1170874476_1170874481 -5 Left 1170874476 20:20237324-20237346 CCTTGCCCCGTTTCTCCAGGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32
1170874476_1170874486 11 Left 1170874476 20:20237324-20237346 CCTTGCCCCGTTTCTCCAGGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1170874486 20:20237358-20237380 CTACAGGAGCTCCAGGACCAGGG 0: 1
1: 0
2: 1
3: 20
4: 194
1170874476_1170874483 4 Left 1170874476 20:20237324-20237346 CCTTGCCCCGTTTCTCCAGGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1170874483 20:20237351-20237373 CTCATTCCTACAGGAGCTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 169
1170874476_1170874485 10 Left 1170874476 20:20237324-20237346 CCTTGCCCCGTTTCTCCAGGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1170874485 20:20237357-20237379 CCTACAGGAGCTCCAGGACCAGG 0: 1
1: 0
2: 3
3: 25
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874476 Original CRISPR CGACCTGGAGAAACGGGGCA AGG (reversed) Intronic
903651913 1:24927727-24927749 CCACCTGAAGACACGGGGCGGGG + Exonic
903855827 1:26337093-26337115 CGACCTGGAGAAGAGCAGCAGGG + Intronic
905017576 1:34788126-34788148 CAGCCTGGAGAAAAGGGGCCAGG - Intronic
907762115 1:57371182-57371204 GGACCTGGACAACCGAGGCATGG + Intronic
911377360 1:97067551-97067573 AGACCTGTAGGAACAGGGCAGGG - Intergenic
920301556 1:204992126-204992148 CAGGCTGGAGAAACGAGGCAGGG + Intronic
921220500 1:212970253-212970275 GGACCTGGAGCAACTGGGAATGG - Intronic
921935883 1:220796649-220796671 CGGCCTGGAGATAGAGGGCAGGG + Exonic
924772264 1:247088436-247088458 GGGCCTGGAGAAACCTGGCAGGG + Intergenic
1062859929 10:803256-803278 GGACCTGGAGAGACAGGGCTCGG - Intergenic
1066586806 10:36944576-36944598 TGACCTGGAGAGCCTGGGCATGG - Intergenic
1070319444 10:75343656-75343678 GGACCTGGAGTCACTGGGCAGGG - Intergenic
1073098896 10:100997057-100997079 CGACCTGGTGGAGCGGGGCGGGG - Intronic
1074285727 10:112096419-112096441 AGACATGAAGAAACTGGGCAAGG + Intergenic
1074854929 10:117466560-117466582 GAACCTGGAGAATCGGGGCTTGG - Intergenic
1075155740 10:119974600-119974622 GGACCTCGAGAAATGGGGCCAGG + Intergenic
1075679723 10:124323467-124323489 TGCCCTGCAGAAAGGGGGCACGG + Intergenic
1077378517 11:2216638-2216660 CCTCCAGGAGAAAGGGGGCAGGG - Intergenic
1077989002 11:7384954-7384976 GGACCTGGAGAAATGAGGTAAGG - Intronic
1082884415 11:58067845-58067867 GGCCCTGCAGAAACGGGGAAGGG + Intronic
1083221699 11:61257098-61257120 TGAGCTGGAGCTACGGGGCAGGG - Intergenic
1083657299 11:64235657-64235679 GGATCTGGATAAACAGGGCAGGG + Intronic
1088223612 11:107594048-107594070 TGACATGGGGAAATGGGGCAGGG + Intronic
1090189011 11:124756350-124756372 GGAGCTGGAGGAACTGGGCAGGG + Exonic
1091021636 11:132105258-132105280 TCATCTGGAGATACGGGGCATGG - Intronic
1091284758 11:134402443-134402465 CATCCTGGGGAGACGGGGCAGGG - Intronic
1095280163 12:40341963-40341985 CCACCTGGAAAAAGTGGGCATGG + Intronic
1097190311 12:57216543-57216565 CGCCCAGGAGGAACGGGGCAGGG - Intergenic
1100689678 12:97026485-97026507 CGACCTGAAAAAATGGGTCAGGG - Intergenic
1103204425 12:119117357-119117379 CAACATGGAGAGATGGGGCAGGG - Intronic
1104019174 12:124980406-124980428 CGTCCTGGTGAAGTGGGGCAAGG - Intronic
1108437335 13:50413636-50413658 CGACCTGGAGAGTCGGGGAGAGG + Intronic
1114186100 14:20403675-20403697 CTTCCTGGAGAAAAGGGGCGTGG + Intronic
1114519625 14:23325066-23325088 GCACCTGGAGAACTGGGGCAGGG - Intronic
1116855172 14:49945811-49945833 CTACCAGGAGAAAGGGGGCAGGG - Intergenic
1122268296 14:100556893-100556915 TGACCTGCAGAGAGGGGGCATGG - Intronic
1122591942 14:102859842-102859864 AGCCCTGGAGGAACAGGGCAAGG + Intronic
1122829664 14:104389612-104389634 CTTCCTGGAGAGAAGGGGCAGGG + Intergenic
1125768696 15:42151311-42151333 CGTCCTGGAGAAGCGGCGGAGGG + Intronic
1129957687 15:79654527-79654549 AGATCTGGAGCAAGGGGGCATGG - Intergenic
1130108556 15:80946904-80946926 CAAACTGGAGAAAGTGGGCATGG - Intronic
1130613427 15:85381153-85381175 CGACCCGGGGACCCGGGGCAAGG - Intronic
1131786821 15:95922367-95922389 CGACCTGGACACTCTGGGCAGGG + Intergenic
1132562936 16:606681-606703 CGGCCTGGAGAAGCCGGGAAAGG - Intronic
1134152752 16:11818006-11818028 CGAAGTGGAGAAACAGAGCAAGG + Intergenic
1134846189 16:17442646-17442668 CCACCTTGAGAGAGGGGGCAAGG + Intronic
1136460556 16:30407715-30407737 CGACCTGGAGCTCTGGGGCACGG - Intronic
1138551418 16:57750941-57750963 CCAGCAGGAGACACGGGGCACGG - Intronic
1139475334 16:67200032-67200054 GGACCTGGAGCAAAGGGGCAGGG - Intronic
1139848434 16:69936357-69936379 GGACATGGAGATACTGGGCAAGG + Exonic
1140519320 16:75567712-75567734 GGTCCTGGAGTAACGGGCCATGG + Intronic
1144727772 17:17510505-17510527 CCATCTGGGGACACGGGGCAGGG + Intronic
1146941262 17:36845959-36845981 CCACCTGGAGACACGGAGCAGGG - Intergenic
1147225707 17:38975484-38975506 CAACATGGTGAAACCGGGCATGG - Intergenic
1150290120 17:63976258-63976280 CGAGCTGGAGAAATGTGGCTGGG + Intergenic
1150614049 17:66755260-66755282 AGACTTGGAGAAGCGCGGCATGG + Intronic
1203162345 17_GL000205v2_random:63484-63506 CGCCCCGGAGAACCGGGGCCTGG - Intergenic
1153931555 18:9883944-9883966 CAACCTGGAGAAAGGAGGCCGGG + Intergenic
1156599238 18:38584911-38584933 CTACCTGGAGGAATGAGGCAAGG - Intergenic
1157422075 18:47555781-47555803 CAAGCTGGAGACATGGGGCAAGG - Intergenic
1158524193 18:58197695-58197717 CCACCTGTAGGAACTGGGCATGG + Intronic
1163312499 19:16522632-16522654 GGCCCTGGAGAAGCCGGGCAGGG - Intronic
1163708448 19:18831632-18831654 CCAACTGGAGAGACTGGGCAGGG - Intergenic
925216305 2:2098614-2098636 CGCCCTGCAGACACAGGGCAGGG + Intronic
927151408 2:20198514-20198536 CAAGCTGGAGAGAAGGGGCAGGG + Intergenic
928511670 2:32009757-32009779 CGGCGTGGAGAAGCGGGGCTCGG + Intronic
928691683 2:33806202-33806224 GGACCTGGAGACACAGGGCTGGG - Intergenic
934753431 2:96809239-96809261 AGGCCTGGAGAAACAGGGCCAGG - Intronic
934761870 2:96861030-96861052 AGAGCTGGAGAAAGGGGCCAAGG - Exonic
937763796 2:125635634-125635656 CTACCGGGAGAAACAGGACAGGG + Intergenic
938489382 2:131753948-131753970 CGCCGTGGAGAAGCGGGGCCTGG + Intronic
938489487 2:131754358-131754380 CGCCTCGGAGAAGCGGGGCATGG + Intronic
944553480 2:200866021-200866043 AGGGCTGGGGAAACGGGGCAGGG + Intergenic
945906942 2:215604519-215604541 GGACCTGGGGACATGGGGCAGGG + Intergenic
946271020 2:218594391-218594413 CGCACTGGAGAAAAGGGGCAAGG + Exonic
947744533 2:232500761-232500783 CCACAAGGAGAAACTGGGCACGG + Intergenic
1169861318 20:10155760-10155782 CCATCTGGAGAAACTGGGGAAGG + Intergenic
1170874476 20:20237324-20237346 CGACCTGGAGAAACGGGGCAAGG - Intronic
1172036577 20:32015050-32015072 CTACCTGGAGAAAGAGGTCAAGG + Exonic
1172628095 20:36360304-36360326 CGGCCTGGAGGACCGGGTCAGGG - Intronic
1173048189 20:39532659-39532681 CTCCCAGGAGAAACTGGGCAGGG - Intergenic
1174289428 20:49497229-49497251 GAAGCTGGAGAAACAGGGCAAGG - Intergenic
1174736560 20:52971500-52971522 CAAAATGGAGAAATGGGGCAGGG + Intergenic
1179024978 21:37672413-37672435 AGACCTGGAGAAAAGGAGCTGGG + Intronic
1179505681 21:41838693-41838715 AGACCTGGGGAAACTGGCCAGGG + Intronic
1185328597 22:50240364-50240386 GGACCTGGAGACACAGGGAAGGG + Exonic
950727004 3:14923132-14923154 GGAGCTGAAGAAGCGGGGCAGGG + Exonic
953676535 3:45007188-45007210 CGATATGGAAAAACAGGGCAAGG - Intronic
955006535 3:54973881-54973903 AGACCTGGAGAAAAGTAGCAAGG + Intronic
957326443 3:78701052-78701074 CGAACTGGAGAGGCCGGGCATGG - Intronic
960770066 3:121183954-121183976 AGACCTGGAGAAGAGGGGCCTGG + Intronic
962583602 3:136819467-136819489 CCTCCTGGAGAACCGGGACACGG + Exonic
968066983 3:195764198-195764220 GGACCTGGAGAAGCTTGGCAGGG + Intronic
968410708 4:387276-387298 AGACCTGGAGGAACAGGACAGGG - Intergenic
968534129 4:1113085-1113107 CGAGGGGGAGAAACGGCGCATGG - Intronic
969055955 4:4402843-4402865 CCACCTGGAGAAGCCAGGCATGG + Intronic
971403894 4:26302433-26302455 AGAGCTGGAGAAACGGGACTGGG - Intronic
974213180 4:58809485-58809507 GGAGATGGAGAAATGGGGCAAGG - Intergenic
974386037 4:61202315-61202337 CGACCTGGGCAAAAGGGGCCAGG - Intronic
980832360 4:138147369-138147391 AGACCTGGAGAAATGGGAGAAGG - Intergenic
987075782 5:14380461-14380483 CGCCCTGGAGCAGAGGGGCAAGG - Intronic
990967747 5:61467989-61468011 CCAGCTGGAGAAACAGGGGAGGG - Intronic
993121530 5:83780262-83780284 GTACCTGGAGAAAAGGAGCAAGG - Intergenic
997355808 5:133262227-133262249 CGACCTGTAGAACAGGGGCTGGG - Intronic
998167312 5:139851665-139851687 CAACCTGGAGGAGCGGCGCAGGG - Exonic
1005824108 6:29622175-29622197 CGACCTGGAGGAACGAGTGAAGG - Exonic
1007987178 6:46218422-46218444 CGACCTGGAGGCACTGGCCATGG - Intergenic
1008531441 6:52464288-52464310 AGTCCTGGAGACAGGGGGCAGGG - Intronic
1015149521 6:130020854-130020876 CGAGGTGGAGAAGCGGGCCAAGG - Intronic
1018464481 6:164031091-164031113 CGATGTGGAACAACGGGGCATGG + Intergenic
1019001340 6:168755514-168755536 CGACATAGACAAATGGGGCAGGG - Intergenic
1019632602 7:2057928-2057950 GCACCTGGAGGAAAGGGGCATGG + Intronic
1020913484 7:14162902-14162924 CGACCTGGATAAAGGGGAAATGG - Intronic
1022840649 7:34160924-34160946 CCACTAGGAGAAACGGGGCCCGG + Intergenic
1035643455 8:1200887-1200909 CGGCGTGGAGAAACCGAGCACGG - Intergenic
1038578174 8:28723219-28723241 GGACCTGGAGAAGCTGGACAAGG - Intronic
1039772246 8:40699067-40699089 GGACCTGGAGGTAAGGGGCAGGG + Intronic
1041200896 8:55451407-55451429 CGCACTGGAGTAGCGGGGCATGG + Intronic
1042715047 8:71763418-71763440 TGACCTGGAGAAATTGGGCAGGG + Intergenic
1046058069 8:109102195-109102217 TAACATGGAGAAACGAGGCAAGG + Intronic
1047999326 8:130364671-130364693 CCACCTGGAGGAATGGGGCAAGG - Intronic
1049970556 9:818360-818382 CTAACTGGAGAAAAGGGCCAAGG - Intergenic
1052969698 9:34369925-34369947 TGATCTGGAGGAAGGGGGCATGG - Exonic
1053042400 9:34885683-34885705 GGAGATGGAGAAACAGGGCAGGG - Intergenic
1054324823 9:63707737-63707759 CGCCGTGGAGAAGCGGGGCCTGG + Intergenic
1058547505 9:106076573-106076595 CAACATGGAGGCACGGGGCATGG + Intergenic
1059411831 9:114137433-114137455 GGCCCTGGAGGAATGGGGCACGG - Intergenic
1062405154 9:136392701-136392723 AGCCCTGGAGAAGCAGGGCAGGG - Exonic
1186044384 X:5519300-5519322 GGAGATGGAGAAAGGGGGCATGG - Intergenic