ID: 1170874477

View in Genome Browser
Species Human (GRCh38)
Location 20:20237329-20237351
Sequence GGATGCGACCTGGAGAAACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874477_1170874485 5 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874485 20:20237357-20237379 CCTACAGGAGCTCCAGGACCAGG 0: 1
1: 0
2: 3
3: 25
4: 287
1170874477_1170874486 6 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874486 20:20237358-20237380 CTACAGGAGCTCCAGGACCAGGG 0: 1
1: 0
2: 1
3: 20
4: 194
1170874477_1170874483 -1 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874483 20:20237351-20237373 CTCATTCCTACAGGAGCTCCAGG 0: 1
1: 0
2: 0
3: 15
4: 169
1170874477_1170874489 25 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874489 20:20237377-20237399 AGGGAGCTCTGAGCCACCCAAGG 0: 1
1: 0
2: 4
3: 19
4: 274
1170874477_1170874490 28 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874490 20:20237380-20237402 GAGCTCTGAGCCACCCAAGGTGG 0: 1
1: 0
2: 2
3: 7
4: 190
1170874477_1170874481 -10 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874477 Original CRISPR GGATGCGACCTGGAGAAACG GGG (reversed) Intronic
903537579 1:24077146-24077168 GGACGGGACCTGGAGGAAAGTGG - Intronic
914355028 1:146877452-146877474 GGATGTGACTTGGAGCAACTTGG + Intergenic
924674466 1:246161465-246161487 GAAGGCTTCCTGGAGAAACGAGG - Intronic
1069748380 10:70730366-70730388 GGATGGGACCTGGACAGCCGAGG + Intronic
1073538831 10:104301543-104301565 GGATGTGGCCTGGAGAAAAGAGG + Intronic
1076515720 10:131043427-131043449 GGATGCAACCTGGAGGATGGAGG - Intergenic
1077393217 11:2309260-2309282 GGAAGGGACCTGGAGACCCGCGG + Intronic
1077994071 11:7438288-7438310 GGCTTTGACCTGGAGATACGTGG + Intronic
1078420307 11:11206386-11206408 AGGAGCGACCTGGAGAAATGAGG - Intergenic
1082801230 11:57416362-57416384 GGATGCGAAATAGAGAAAAGAGG + Intronic
1090261745 11:125326295-125326317 GGATGGGACCTGGACAACAGAGG + Intronic
1092340079 12:7668127-7668149 GGATGCGAAATGGAGATATGAGG + Intergenic
1104558459 12:129822958-129822980 GGATGGGACCTGGTGAGAAGTGG + Intronic
1106246331 13:27953670-27953692 GCCTGCCACCTGGACAAACGCGG - Intergenic
1113048921 13:106186927-106186949 GGATGCGGTCTGGAGAGAAGTGG + Intergenic
1122341093 14:101029010-101029032 GGATTTGACCTGGAGGAAGGTGG + Intergenic
1129104054 15:73293454-73293476 GACTGCGAGCTGGAGAAGCGAGG - Exonic
1131931524 15:97448452-97448474 GGAGGCAACCTGGAGAAAGAGGG - Intergenic
1132932661 16:2466931-2466953 GGATGACACCTGGAGAAAGCCGG + Intergenic
1133208278 16:4247335-4247357 GGAGGAGACCTGGAGCACCGTGG - Intergenic
1136068541 16:27774781-27774803 GGACGTGTCCTGGGGAAACGGGG - Intronic
1136556238 16:31009557-31009579 GGCTGCTACCTGGAGGAACTGGG - Intronic
1139978989 16:70838077-70838099 GGATGTGACTTGGAGCAACTTGG - Intronic
1140314554 16:73882494-73882516 AGAGGCCACCTGGAGAACCGCGG - Intergenic
1142258785 16:89032453-89032475 GGATGGGGCCAGGAGGAACGAGG - Intergenic
1143570533 17:7755262-7755284 GGATGCAGCCTGGAGAACCCAGG + Intronic
1144131998 17:12255063-12255085 GGATGAGACCTGCTGAAACCCGG - Intergenic
1147760479 17:42794884-42794906 AGATGGGACCTGGGGAAATGGGG - Exonic
1149492334 17:57094210-57094232 GGATGCGCCCAGGAGAAACGTGG - Intronic
1152912240 17:83011631-83011653 AGCTTCGACGTGGAGAAACGGGG + Intronic
1153560666 18:6369134-6369156 AGATGCTTCCTGGAGAAGCGGGG + Intronic
1159381679 18:67667817-67667839 TGGTGCGGCCAGGAGAAACGAGG - Intergenic
1160408828 18:78660917-78660939 GCATGCGGCCTGGAGAGACTGGG - Intergenic
1160804495 19:986122-986144 CGAGGGGACCTGGAGAAAGGAGG - Intronic
1162323687 19:9985991-9986013 GGATGGGAGTTGGGGAAACGAGG + Intronic
1164414879 19:28038608-28038630 GGATGAGGCCTGGATAAACCTGG - Intergenic
1164519448 19:28967328-28967350 GGATGAGGCCTGGATAAACCTGG - Intergenic
1165266520 19:34666583-34666605 GGCTGGGACCTGGAGAGTCGGGG - Intronic
1167579606 19:50333675-50333697 GGGTGCGCCGTGGAGAAAAGGGG + Intronic
1167583114 19:50358046-50358068 GGGTGCGTCCTGGAGAAAAGGGG + Intronic
1168427917 19:56253753-56253775 GGATGAGAACTGGAGAAAGTAGG + Intronic
926743469 2:16131142-16131164 GGATCCGTCCTGCAGGAACGTGG + Intergenic
928436506 2:31257922-31257944 GGATGGCACCTGGAGATACTGGG + Intronic
928759405 2:34564334-34564356 GGATGCAGCCTGGAGAAAGCTGG - Intergenic
931028619 2:58144234-58144256 GGATGAGACCTGGGGAAAATGGG + Intronic
948462624 2:238137713-238137735 TGCTGCGACCTGGAGGAACTGGG - Intergenic
1170874477 20:20237329-20237351 GGATGCGACCTGGAGAAACGGGG - Intronic
949768761 3:7555087-7555109 GAATGAGACATGGAGAAACCAGG - Intronic
966525188 3:180912507-180912529 GGATCCCACCTGGAGAGTCGGGG + Exonic
967347993 3:188480083-188480105 GGATGCGGCCTTGAGAAGCAGGG - Intronic
967653863 3:192021789-192021811 GGATAAGACCTGGCAAAACGAGG + Intergenic
969209418 4:5675254-5675276 GGATGTGATCTGGAGAAAACTGG - Intronic
969553902 4:7893107-7893129 AGAAGAGACCAGGAGAAACGGGG - Intronic
976531795 4:86162879-86162901 GGATGCACACTGGAGAAACAGGG + Intronic
977867847 4:102051122-102051144 GCAGGAGACCTGGAGAAATGGGG + Intronic
980024376 4:127747913-127747935 GGAAGAGACCTAGAGAAACCAGG + Intronic
982583336 4:157206879-157206901 GGATGAGAACTGAAGAATCGTGG - Intronic
997626864 5:135337000-135337022 GGATGTGACCTGGATCAACGGGG + Intronic
998493672 5:142568411-142568433 GGATGTGAGCTGGACAAACTTGG - Intergenic
999759798 5:154691409-154691431 GGATGTGAGCTGCAGAGACGGGG - Intergenic
1012930642 6:105312813-105312835 GGATGGGTCATGGAGAAACGAGG + Intronic
1019961872 7:4467252-4467274 GGATGTCACCTGGAGAGATGGGG - Intergenic
1020025293 7:4895441-4895463 GGTTGCGGTGTGGAGAAACGGGG + Intergenic
1024047571 7:45595629-45595651 GGAACAGACCTGGGGAAACGTGG - Intronic
1024139495 7:46447325-46447347 GGATGCTTCCTGGAAAAACAAGG + Intergenic
1038258241 8:25970650-25970672 GGATGCAGCCTGCAGAAATGAGG + Intronic
1040313301 8:46247932-46247954 GGAACCTACCTGGAAAAACGGGG + Intergenic
1043627135 8:82274874-82274896 GGATCAAACCTGGAGAAACAGGG + Intergenic
1044080060 8:87872754-87872776 GGATGCAGCCCGGAGGAACGTGG - Exonic
1044337528 8:91004830-91004852 GGATGAGACCTGGAGAGTTGGGG + Intronic
1045348778 8:101318668-101318690 GGATGAGACCTTGAGAGACCAGG + Intergenic
1045719561 8:105092476-105092498 GGATGCGACCTCCAGCAACAAGG - Intronic
1048983053 8:139713522-139713544 GGGAGAGATCTGGAGAAACGGGG - Intergenic
1049604767 8:143524164-143524186 GGATGGGCCCTGGAGCAACATGG + Intronic
1052837721 9:33264365-33264387 GGAAGCGACCTGGAGTGAAGAGG - Exonic
1058453265 9:105116333-105116355 GGGTGAGGCCTGGAGAAACTCGG + Intergenic
1059578087 9:115513416-115513438 AGATGTGAGCTGGAGAAATGAGG - Intergenic
1186082037 X:5943570-5943592 GGATGGGATTTGGAGAAATGAGG + Intronic
1186903707 X:14087864-14087886 GGAGGAGAACTGGAGAAATGAGG - Intergenic
1192808350 X:74529199-74529221 GGAAAGGACCTGGAGAAACAAGG - Exonic
1200207751 X:154329502-154329524 CGATGCCACCTGGGGAAACAAGG - Exonic