ID: 1170874481

View in Genome Browser
Species Human (GRCh38)
Location 20:20237342-20237364
Sequence GGTCGCATCCTCATTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874476_1170874481 -5 Left 1170874476 20:20237324-20237346 CCTTGCCCCGTTTCTCCAGGTCG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32
1170874473_1170874481 25 Left 1170874473 20:20237294-20237316 CCAGACTCAGGGTACCTTACGAG 0: 1
1: 0
2: 0
3: 4
4: 43
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32
1170874477_1170874481 -10 Left 1170874477 20:20237329-20237351 CCCCGTTTCTCCAGGTCGCATCC 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32
1170874472_1170874481 26 Left 1170874472 20:20237293-20237315 CCCAGACTCAGGGTACCTTACGA 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32
1170874474_1170874481 11 Left 1170874474 20:20237308-20237330 CCTTACGAGACTTGCTCCTTGCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG 0: 1
1: 0
2: 1
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874481 Original CRISPR GGTCGCATCCTCATTCCTAC AGG Intronic
900498049 1:2985315-2985337 GGCCGCATCTTCATTCCACCGGG - Intergenic
902974343 1:20078165-20078187 GGTCACCTCCTCAGTCCTTCAGG - Intronic
907528133 1:55066013-55066035 GGTCTCAGTCTCATTCCTAGTGG - Intergenic
907926004 1:58955802-58955824 GGTTGCATCCTCATTGTTTCTGG - Intergenic
910015916 1:82523072-82523094 GGTCGCATCCTCAATCCTTCAGG - Intergenic
1091086594 11:132727341-132727363 GTTCCCATCCTCATTTCTCCCGG + Intronic
1094030847 12:26010034-26010056 GGTGGCATCCTGATGCCCACAGG + Intronic
1110600153 13:77363781-77363803 GGTCGCATCAACAATCCTTCAGG - Intergenic
1118081091 14:62361688-62361710 GGTGGCATCCTCATTCTCTCAGG + Intergenic
1125237980 15:37538270-37538292 GGTGACTTCCACATTCCTACAGG + Intergenic
1138829428 16:60359151-60359173 GGCCGCTTCCCCATTGCTACAGG + Exonic
1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG + Intronic
1160769067 19:822192-822214 GGTCGCGTCCTCCTCCCTTCGGG + Intergenic
927597640 2:24411107-24411129 TGGCAGATCCTCATTCCTACTGG + Intergenic
928088934 2:28362293-28362315 TCCCGCATCCTCCTTCCTACTGG - Intergenic
937119020 2:119429367-119429389 GGTCACATTCTCAGTCCTACAGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1175964332 20:62652962-62652984 GGCTGCATCCTCATTGCCACCGG + Intronic
1180987723 22:19915239-19915261 GATCACATCATCATTGCTACTGG - Exonic
1183784825 22:40023302-40023324 GGCCCCATCCCCATTCCTCCTGG + Intronic
1185228331 22:49666422-49666444 GGTCGCAGCATCATTCATAGAGG - Intergenic
970660807 4:18283498-18283520 GGTGGCATGCTCATTCCTGTTGG + Intergenic
974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG + Intergenic
975746883 4:77483603-77483625 GGTCCCAAACTCATACCTACCGG + Intergenic
980102180 4:128552730-128552752 GATCGCATCCTTATGCCTAGCGG + Intergenic
983246594 4:165294823-165294845 GTTCACATCATAATTCCTACAGG - Intronic
986252046 5:6068979-6069001 CCTCCCATCCTCATTCCTATGGG - Intergenic
995440444 5:112186022-112186044 GGTGGCATCTCCCTTCCTACAGG + Intronic
1010386273 6:75284445-75284467 GGTCTCATCTTCATTCCCATCGG - Exonic
1023165805 7:37342715-37342737 TGTAGGATCCTCATTCCCACTGG - Exonic
1026853415 7:73738442-73738464 GGCCGCTTCCGCTTTCCTACAGG - Exonic
1033210876 7:139459454-139459476 GGTCCCACCTACATTCCTACAGG + Intronic
1042508096 8:69582726-69582748 GGCCTCCTCCTCATCCCTACGGG - Intronic
1058180617 9:101793630-101793652 GGTCGAATCCGCATTCATAGGGG + Intergenic
1189927241 X:45969158-45969180 GTACTCATACTCATTCCTACAGG + Intergenic
1197839965 X:130735786-130735808 GATTACATCATCATTCCTACTGG - Intronic