ID: 1170874536

View in Genome Browser
Species Human (GRCh38)
Location 20:20237705-20237727
Sequence TCCGTGCTCAGTTTTCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170874533_1170874536 7 Left 1170874533 20:20237675-20237697 CCATAACTCCTTAATATCATCTA No data
Right 1170874536 20:20237705-20237727 TCCGTGCTCAGTTTTCCCAGTGG No data
1170874532_1170874536 8 Left 1170874532 20:20237674-20237696 CCCATAACTCCTTAATATCATCT No data
Right 1170874536 20:20237705-20237727 TCCGTGCTCAGTTTTCCCAGTGG No data
1170874531_1170874536 9 Left 1170874531 20:20237673-20237695 CCCCATAACTCCTTAATATCATC No data
Right 1170874536 20:20237705-20237727 TCCGTGCTCAGTTTTCCCAGTGG No data
1170874534_1170874536 -1 Left 1170874534 20:20237683-20237705 CCTTAATATCATCTAATACCAGT No data
Right 1170874536 20:20237705-20237727 TCCGTGCTCAGTTTTCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170874536 Original CRISPR TCCGTGCTCAGTTTTCCCAG TGG Intronic