ID: 1170878978

View in Genome Browser
Species Human (GRCh38)
Location 20:20277998-20278020
Sequence TCTAGCAAATAGAATGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170878978_1170878987 15 Left 1170878978 20:20277998-20278020 CCCACCACATTCTATTTGCTAGA 0: 1
1: 0
2: 2
3: 35
4: 209
Right 1170878987 20:20278036-20278058 CCAGCCCATATTCAAGGAGTGGG 0: 2
1: 9
2: 48
3: 184
4: 648
1170878978_1170878982 -9 Left 1170878978 20:20277998-20278020 CCCACCACATTCTATTTGCTAGA 0: 1
1: 0
2: 2
3: 35
4: 209
Right 1170878982 20:20278012-20278034 TTTGCTAGAGGCAAGTTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 117
1170878978_1170878985 14 Left 1170878978 20:20277998-20278020 CCCACCACATTCTATTTGCTAGA 0: 1
1: 0
2: 2
3: 35
4: 209
Right 1170878985 20:20278035-20278057 ACCAGCCCATATTCAAGGAGTGG 0: 1
1: 5
2: 45
3: 150
4: 579
1170878978_1170878984 9 Left 1170878978 20:20277998-20278020 CCCACCACATTCTATTTGCTAGA 0: 1
1: 0
2: 2
3: 35
4: 209
Right 1170878984 20:20278030-20278052 CCAGGACCAGCCCATATTCAAGG 0: 1
1: 1
2: 11
3: 73
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170878978 Original CRISPR TCTAGCAAATAGAATGTGGT GGG (reversed) Intronic
902833091 1:19030136-19030158 TCTGGCACATAGAAGGTGCTCGG + Intergenic
903200114 1:21730025-21730047 TTTAAAAAATAGAATGTGGCAGG - Intronic
903785046 1:25855196-25855218 TCCAATGAATAGAATGTGGTAGG - Intronic
906717472 1:47980793-47980815 TCTAGGAGATAGAATGAGGAGGG - Intronic
906760645 1:48374003-48374025 TCTAGCCAATAGACTGTGCATGG - Intronic
906763632 1:48405715-48405737 TCTGATGAATAGAATGTGGTAGG - Intronic
906834145 1:49065112-49065134 AATAAGAAATAGAATGTGGTAGG + Intronic
907282171 1:53357101-53357123 TCTAGCCAATGGAATGTGAGTGG + Intergenic
908664683 1:66476932-66476954 TCTAGCCAAAAGGATGTGGGAGG - Intergenic
909526985 1:76635861-76635883 GCTGGCCAATAGAATGTGGGTGG - Intergenic
909665141 1:78123664-78123686 ACTGGCAAACAGAATGTGGATGG + Intronic
910462243 1:87460080-87460102 TCCAGAGAATGGAATGTGGTAGG + Intergenic
911938010 1:104005586-104005608 TCTAACCAATAGAATGTGGGTGG + Intergenic
913969808 1:143406141-143406163 TATGGCCAATAGAATGTGGGCGG - Intergenic
914064181 1:144231736-144231758 TATGGCCAATAGAATGTGGGCGG - Intergenic
914114969 1:144734618-144734640 TATGGCCAATAGAATGTGGGCGG + Intergenic
915704096 1:157826929-157826951 ACTAGCAAATACAATGAGGTTGG - Intergenic
916436633 1:164783790-164783812 TCTAGGTATTAAAATGTGGTAGG + Intronic
916734222 1:167592887-167592909 TCTTGGAAATATAATGTAGTGGG + Intergenic
919329049 1:196145793-196145815 CCTAACAAATAGAATATGGAAGG - Intergenic
919818041 1:201454213-201454235 TCTAACCAATAGAATGGGATGGG - Intergenic
921827333 1:219687956-219687978 TCTGGCAAATAGAAAGTGGGTGG - Intronic
923143674 1:231182946-231182968 TCTAGCTAAGAAAATTTGGTTGG + Intronic
1063202489 10:3797304-3797326 TCTAGAAAACAGAAGGTGGGTGG - Intergenic
1070088154 10:73256565-73256587 ACTAGCAAATGAAAGGTGGTAGG + Intronic
1070219948 10:74430934-74430956 TATAGAAAATAGATGGTGGTTGG + Intronic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1073891516 10:108107969-108107991 TCAAGCAAATAGAAGGTGGTAGG - Intergenic
1074059721 10:109953963-109953985 TCTAGCCAACAGAATGTGAGTGG - Intergenic
1074405049 10:113174126-113174148 TTTGGCCAATGGAATGTGGTTGG - Intergenic
1075712262 10:124537027-124537049 TCTAGCACTTAGAATGTGCTAGG + Intronic
1075939998 10:126382912-126382934 TCTTGGAAATTAAATGTGGTAGG + Intronic
1076573172 10:131445806-131445828 TCTAGCAGATAACATGGGGTGGG + Intergenic
1078539104 11:12199287-12199309 CCTGGCAAATAGAATGTGCCAGG + Intronic
1078956295 11:16199331-16199353 CCTAGCACATAGAAAGTGTTTGG - Intronic
1079341362 11:19614196-19614218 TAAAGCAAATAAAATCTGGTGGG + Intronic
1080748349 11:35129153-35129175 TCTGGCCAATGGAATGTGGATGG + Intergenic
1081833409 11:46133968-46133990 TCTAGGAAATAGGATGGGATAGG + Intergenic
1084753072 11:71216795-71216817 TCTAGCACATACAATTTTGTAGG + Intronic
1085327071 11:75614398-75614420 TCTAACAAACAGAAGATGGTGGG + Intronic
1085821241 11:79795915-79795937 CCTAGCAGATAGTACGTGGTAGG - Intergenic
1086564433 11:88209392-88209414 TCTGGCCAATAAAATGTGGAGGG + Intergenic
1087260184 11:96002446-96002468 TTTGGCAAATAGAATGTCTTAGG + Intronic
1087335351 11:96837330-96837352 TCTATCAAAAAGAATGTGGGTGG + Intergenic
1087354871 11:97080054-97080076 TCTAGCCAATGGAATGTGAGAGG + Intergenic
1087884718 11:103465860-103465882 TTTGACCAATAGAATGTGGTAGG - Intronic
1088872856 11:113907163-113907185 TCTGGAAAGTAGAATGTGTTAGG - Intronic
1091909408 12:4216784-4216806 ACTAGCTAATGGAATGTGTTTGG - Intergenic
1092890040 12:12960826-12960848 TGTAACCAATAAAATGTGGTGGG + Intergenic
1096542450 12:52315520-52315542 TTTAGCAAGTAGAGTATGGTTGG + Intronic
1099774709 12:87110522-87110544 TTTGGCCAATAGAATGTGATTGG + Intergenic
1100858864 12:98783692-98783714 CCTAGAAATGAGAATGTGGTGGG + Intronic
1102243908 12:111342981-111343003 TCCAGCACATAGTATGTGGTGGG + Intronic
1103097569 12:118144356-118144378 TCAACCTAATAGAATGTGTTAGG - Intronic
1105409050 13:20155178-20155200 AGTAGCAAATTGAATGTGCTAGG - Intronic
1105597453 13:21852380-21852402 TGTAGCACATAGAATGTCTTGGG + Intergenic
1107406701 13:40121430-40121452 TTTAGCAAACAAACTGTGGTAGG + Intergenic
1107714481 13:43186711-43186733 TGTAGCTAATAAAATCTGGTTGG - Intergenic
1108182920 13:47858816-47858838 TCTAACTAACAGAATGTGGTGGG - Intergenic
1112768035 13:102766705-102766727 TCTAGGTAATAGAATGTGTGAGG + Intronic
1112871646 13:103978408-103978430 TCATGGAAATAGAATGTGGAAGG + Intergenic
1114142009 14:19922901-19922923 TTTAGAAAATTTAATGTGGTTGG + Intergenic
1114258052 14:21018986-21019008 TTTACCAAATAGGATGGGGTGGG + Intronic
1118760433 14:68877739-68877761 TGTAGAAAATACAGTGTGGTGGG - Intronic
1118979291 14:70702988-70703010 TCTGGCCAATAGAATGTGAGTGG - Intergenic
1120420423 14:84278604-84278626 TCAAGTAAAGAGATTGTGGTAGG + Intergenic
1121893093 14:97616379-97616401 TCTTGCAAATAGAATATAGTTGG - Intergenic
1123124088 14:105932601-105932623 TAAAGCAAATAGACTGTTGTAGG - Intronic
1127747243 15:61991249-61991271 GCAAGCAAATAGAATATGTTTGG - Intronic
1129958420 15:79660661-79660683 TCTATGAAATAAAATGTGATTGG - Intergenic
1130580284 15:85131196-85131218 TCTTGTAGATAGAATGTAGTTGG + Intronic
1130736889 15:86559832-86559854 TCTGTCTAGTAGAATGTGGTTGG + Intronic
1133948149 16:10366597-10366619 TTTAACAAATAGAATATGGCAGG - Intronic
1134306213 16:13034693-13034715 TTTGGCCAATAGAATATGGTAGG + Intronic
1135338280 16:21623510-21623532 TATACCAATCAGAATGTGGTAGG - Intronic
1135795021 16:25433492-25433514 ACTAGCACATAGCATATGGTAGG - Intergenic
1137345131 16:47650522-47650544 TCTGTCAAACAGAATGAGGTAGG - Exonic
1138155554 16:54699994-54700016 TATAGCATCTAGAATGTGCTAGG - Intergenic
1139823636 16:69740091-69740113 TCTACCAAATAAAATTTGATGGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140614911 16:76650482-76650504 TCTATGAAATAGAATATGTTAGG - Intergenic
1140709975 16:77668466-77668488 TTTGGAAAATAGAATGTGGTTGG + Intergenic
1141572723 16:84943947-84943969 TCTAACAAATAGAACATGGTGGG + Intergenic
1142516884 17:437483-437505 TTTGGCCAATAGAATGTGGGTGG + Intergenic
1146716739 17:35092419-35092441 TCTGGCACATAGTAGGTGGTCGG - Intronic
1149051993 17:52316225-52316247 TCCAGCCAACAGAATGTGGTTGG - Intergenic
1150836598 17:68569605-68569627 CTTAGCAATTAAAATGTGGTGGG - Intronic
1155937466 18:31768522-31768544 TCAAGCAAAGACAAGGTGGTAGG - Intergenic
1156848446 18:41697536-41697558 TCTGGCATATAGAATGTGTTCGG - Intergenic
1157750305 18:50172648-50172670 TGTAGCACATAGAAGGTGCTTGG - Intronic
1158739698 18:60126168-60126190 TCAAGCAAAAATAATGTTGTAGG - Intergenic
1159424379 18:68265604-68265626 TGTAGCAAATACATTGTAGTAGG - Intergenic
1163242515 19:16072937-16072959 TCTGGCATTTAGAATGTGTTGGG - Intronic
1163894405 19:20044987-20045009 GCTTGCAAATAAAATATGGTAGG + Intergenic
1165556499 19:36637110-36637132 TTTAGCGAATAGAATGTGAGTGG - Intergenic
1166380943 19:42354943-42354965 TGGGGCATATAGAATGTGGTTGG + Intronic
1167711344 19:51113239-51113261 TCTTGCAAACAGGATATGGTAGG - Intergenic
926580481 2:14629077-14629099 TCTGGCAAATGGAATGTGGGTGG - Intergenic
926827516 2:16921988-16922010 TCTAGCAGATAGAATAGAGTTGG + Intergenic
928315635 2:30243025-30243047 TCTAGCAAATAGAATCTCCAGGG + Intronic
928345163 2:30486689-30486711 TCTAGCCAATGGAATGTGAGTGG + Intronic
931718460 2:65048253-65048275 TCTAGCAAACAGCATGTGGGAGG - Intergenic
932345334 2:70991634-70991656 TCTAGTGAATAGAATTTGTTGGG - Intronic
933002173 2:76939042-76939064 TCTAGAAAGTAGAATGTGTGGGG - Intronic
934284817 2:91641403-91641425 TATGGCCAATAGAATGTGGGTGG - Intergenic
937159666 2:119748056-119748078 TGTAACAAATAGAATATTGTAGG + Intergenic
937494875 2:122407920-122407942 TCTAGCACATAGTAGGTGTTCGG - Intergenic
937803308 2:126106074-126106096 CATTGCAAAAAGAATGTGGTAGG + Intergenic
939021046 2:136958914-136958936 TCTTGGACATAGAATGTGGCGGG + Intronic
939101836 2:137903877-137903899 TCTACCCAATAGAATTTGGTAGG + Intergenic
939661218 2:144892396-144892418 TCTACCAAAGAGAATTTGCTAGG + Intergenic
939835005 2:147119212-147119234 TCTAACAAATAGAAAGTTGCAGG - Intergenic
939971981 2:148672356-148672378 TCTTGTAGATAGCATGTGGTCGG + Intronic
941867644 2:170351306-170351328 TCTGGGAAAAAGAATGGGGTAGG + Intronic
943809374 2:192164847-192164869 TCTAGCATCTAAAATATGGTTGG + Intronic
945199890 2:207271145-207271167 ACAAGGACATAGAATGTGGTAGG + Intergenic
946133579 2:217627116-217627138 TCTAGCCAATAGCATGTGAAAGG + Intronic
1168946445 20:1763239-1763261 TCTGGGAGATAGAATATGGTTGG + Intergenic
1169863512 20:10175692-10175714 TTTGACAAATAGAATGTGGCAGG - Intergenic
1169930137 20:10823725-10823747 TCTGGCCAATAGAATGTGGGTGG + Intergenic
1170149718 20:13216911-13216933 TCTGGCCAATAGAATATGGGTGG - Intergenic
1170878978 20:20277998-20278020 TCTAGCAAATAGAATGTGGTGGG - Intronic
1171410191 20:24941567-24941589 TCTAACAAATATAATGGGGTTGG - Intergenic
1172278292 20:33693169-33693191 TGTGGCTAATAGAATGTGGGAGG - Intergenic
1173237736 20:41263196-41263218 TCTTGCAAACAGAATGTTGTCGG - Intronic
1173915242 20:46702876-46702898 TTTAGCAACTAGTATGTGCTAGG + Intergenic
1174123430 20:48285003-48285025 TCTAGCCAATGGAATGTGATGGG + Intergenic
1174204060 20:48826960-48826982 TCTGGCACATAGTAAGTGGTCGG + Intronic
1176453705 21:6888559-6888581 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176831880 21:13753607-13753629 TCTACCCAATAGAATTTGGTAGG + Intergenic
1177037936 21:16068271-16068293 ACTAACACATAGAATGTGTTTGG - Intergenic
1177144907 21:17397077-17397099 TCTAGCAATTACATTGTGCTGGG - Intergenic
1177899982 21:26903095-26903117 TCCAGCAAATAGAATTTTTTTGG - Intergenic
1178220238 21:30648648-30648670 TATAGCAATAAGAATGTTGTAGG - Intergenic
1179204026 21:39256444-39256466 TCAAACAAATAAAATGTTGTGGG + Intronic
1181896362 22:26111385-26111407 TCTAACAAGTAGAATGTAGTGGG + Intergenic
1182706885 22:32288319-32288341 TCTAGCAAATGAAATGTGAGTGG + Intergenic
1184395209 22:44231434-44231456 TCTAGCAAATGAAATGTGAGTGG + Intergenic
949103785 3:179229-179251 TCCAGCCAATAGAATATGGGAGG - Intergenic
949368947 3:3313787-3313809 CTTAGCAAATAGAAATTGGTTGG - Intergenic
949434568 3:4014473-4014495 TTTTTCAAACAGAATGTGGTTGG + Intronic
949503423 3:4703967-4703989 TCTATCAAAAAGAATGTGCCTGG + Intronic
950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG + Intronic
950373032 3:12547198-12547220 TCCAGAAAGTAGAATATGGTGGG - Intronic
951650499 3:24946400-24946422 TTTAGAAATTAGAAGGTGGTGGG + Intergenic
952815243 3:37441979-37442001 TCTAACAAATAGGATATTGTGGG - Intergenic
953312749 3:41895772-41895794 TTTAGCGAATATAAAGTGGTAGG - Intronic
953709088 3:45254800-45254822 TATAACAAATACAATGTGGCTGG + Intergenic
954102653 3:48388660-48388682 TCTTGTAGATAGAATCTGGTTGG + Intronic
954261955 3:49445709-49445731 TCTATAAAATAGAATGAGGCTGG + Intergenic
959663971 3:108901206-108901228 GCTAGGAGATAGAATGTGGATGG + Intergenic
959883750 3:111475215-111475237 TCTAGCAACTATACTGTGTTTGG + Intronic
960208122 3:114927676-114927698 TTTAGAAAATATAATTTGGTTGG - Intronic
960813258 3:121645584-121645606 TCTAGGAGTTACAATGTGGTTGG + Intronic
962557936 3:136574256-136574278 TCTTGTAAATATTATGTGGTCGG - Intronic
965142360 3:164855119-164855141 TTGAGCACCTAGAATGTGGTAGG - Intergenic
969979253 4:11137551-11137573 TCTTGGGAAGAGAATGTGGTCGG + Intergenic
970290542 4:14566531-14566553 TTTGTCCAATAGAATGTGGTAGG + Intergenic
970555100 4:17223653-17223675 TCTGGCCAATAGAATATGGGTGG - Intergenic
970982258 4:22113538-22113560 TCTAGCAAGGAGAATATGATAGG - Intergenic
973860246 4:55057029-55057051 TCTAATAAATAGAATATGATAGG - Intergenic
973872394 4:55179492-55179514 TCTGGGGAATAGAATCTGGTGGG - Intergenic
974019460 4:56679772-56679794 TATAGCAAAAAGAAAGTGGCTGG - Intronic
974512868 4:62867700-62867722 ACTAACAAATATAATGAGGTTGG + Intergenic
975394462 4:73858788-73858810 TTTAAAAAATGGAATGTGGTAGG - Intergenic
975462961 4:74675939-74675961 TCTAGGAAGTAAAATGTGGATGG - Intergenic
975566038 4:75755196-75755218 TCTAACAACTAGAATATGATGGG - Intronic
976023034 4:80653973-80653995 TCATGCTAATATAATGTGGTGGG + Intronic
980081907 4:128353081-128353103 TCTGGCTAATGGAATGTGGGTGG + Intergenic
981208920 4:142077919-142077941 CCTAGAAACTAGTATGTGGTGGG + Intronic
981602897 4:146510906-146510928 TCTAGTGAATAGACTGTGGAAGG - Intronic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
982940500 4:161546798-161546820 TCTAGAAAATAAAATGGGGCTGG + Intronic
989317543 5:40100177-40100199 ACTAGAGGATAGAATGTGGTAGG + Intergenic
989423805 5:41272334-41272356 ACCAGCAAGCAGAATGTGGTAGG + Intergenic
989485431 5:41985292-41985314 TTTAGCAAATATAATGTTCTAGG - Intergenic
993545837 5:89212058-89212080 TCTTGCCAATGGAATGTGGTTGG + Intergenic
997095937 5:130911565-130911587 TCTTGTAAATAGCATGTGGTTGG - Intergenic
998675547 5:144403883-144403905 TCTACCAAATAGAATGGGGGTGG - Intronic
998893477 5:146771805-146771827 TCTAGCCAATGCAATGTGGGTGG + Intronic
999752989 5:154643848-154643870 TTTAGCCAAAGGAATGTGGTAGG + Intergenic
1000053023 5:157578283-157578305 GCTTCCAAATACAATGTGGTGGG + Intergenic
1001675839 5:173514519-173514541 TCTAACCAATAGAATGTGAGGGG + Intergenic
1004136087 6:12968185-12968207 TTTAGCAAATGGAATGTGGGGGG - Intronic
1004423077 6:15488731-15488753 CCTAGCAAATAGTATGCAGTTGG + Intronic
1004880181 6:19999841-19999863 TCCAGCCAATAGACTGTGGGAGG + Intergenic
1009055077 6:58325356-58325378 TTTAGCCAATAGAATGTGGCAGG + Intergenic
1009236086 6:61125214-61125236 TTTAGCCAATAGAATGTGGCAGG - Intergenic
1011522612 6:88225897-88225919 TCTAGCCAAGGGAATGTGGGGGG + Intergenic
1012012212 6:93803580-93803602 TCTAGCAAAAAGATTTTGTTTGG + Intergenic
1012615967 6:101280692-101280714 TGTAGGAAATAGTATGTGGTGGG - Intergenic
1013497848 6:110716835-110716857 TTTAATAAATAGAATGTGGCAGG + Intronic
1016226445 6:141745009-141745031 TTTGACCAATAGAATGTGGTGGG + Intergenic
1016317096 6:142802306-142802328 TCTAGTGAATGGAATGTGGGGGG - Intronic
1016848291 6:148591076-148591098 TCTAGCCAATGGAATGTGAGAGG + Intergenic
1017670567 6:156765907-156765929 GCTAGAAATTAGAATGTGGCAGG + Intergenic
1021412717 7:20346409-20346431 TCTAGGGATTAGAATGTGTTGGG + Intronic
1021422248 7:20458952-20458974 TTTAAAAAATTGAATGTGGTGGG - Intergenic
1022383196 7:29879920-29879942 TTTGGCTAAGAGAATGTGGTAGG - Intronic
1022654624 7:32307419-32307441 TCTGGCTAACAGAATGTGGGAGG - Intergenic
1023709069 7:42972770-42972792 TCTAGCCAATAGAACGAGGGTGG - Intergenic
1025574586 7:62620004-62620026 TTCAGCAAAAAGAATGTAGTAGG - Intergenic
1027454272 7:78368302-78368324 ACTATTAAACAGAATGTGGTTGG + Intronic
1028664746 7:93328581-93328603 AGCAGCAAATAGACTGTGGTGGG + Intronic
1030739791 7:113095111-113095133 TTCAGCACATAGAATTTGGTTGG + Intergenic
1031092235 7:117372317-117372339 TTTAGCAAATAAAATATGATTGG + Intronic
1037874201 8:22531373-22531395 TCTAACCAATAGACTATGGTGGG - Intronic
1038104671 8:24419052-24419074 CCTTCCAAATAGCATGTGGTTGG + Intergenic
1039687441 8:39820150-39820172 ACTAGCAAATATAATGAGATTGG + Intronic
1041184450 8:55284720-55284742 TCTAATGAATGGAATGTGGTGGG - Intronic
1043262743 8:78222330-78222352 TTTAGCAAAATGAGTGTGGTTGG + Intergenic
1043405757 8:79931236-79931258 TCTATAAAATAGAATTTGATAGG - Intronic
1043996125 8:86818833-86818855 TCTAGTAAATATATTGTGTTTGG + Intergenic
1044911853 8:97068288-97068310 TCTACCTAATAGAATGGAGTGGG + Intronic
1046729290 8:117707908-117707930 GCTAGAAAACAGAATGGGGTTGG - Intergenic
1047570289 8:126090625-126090647 TTTGGCCAATAGAATGAGGTAGG + Intergenic
1048571740 8:135662584-135662606 TTTAACAAATTGCATGTGGTAGG - Intergenic
1050477536 9:6055588-6055610 TCTAGTATATAAGATGTGGTTGG + Intergenic
1051021294 9:12546863-12546885 TTTGGCCAACAGAATGTGGTTGG - Intergenic
1051290231 9:15538052-15538074 TCTAGGAAATAGTAGGTGTTGGG + Intergenic
1051425727 9:16929864-16929886 ATTTGCAAATAGAATGTTGTTGG + Intergenic
1051858179 9:21593607-21593629 TCTAACCAATAGAATGTGATTGG - Intergenic
1052760752 9:32588609-32588631 TCTGGCAAATAGAATGTGGATGG - Intergenic
1054722243 9:68615854-68615876 TCTAAGAAAAAGAATGTGTTTGG + Intergenic
1056499426 9:87193270-87193292 TCTGGCCAATAGAATGTGCATGG + Intergenic
1056726364 9:89122629-89122651 TTTAACTAATAGAATGTGGAGGG - Intronic
1058027618 9:100159549-100159571 TCTAGCAAATAGGAGGTAATTGG - Intronic
1058174742 9:101723687-101723709 TCTAGCTAATCTAATCTGGTGGG - Intronic
1058535294 9:105952887-105952909 TCTTGTAGATAGAATTTGGTTGG + Intergenic
1059341616 9:113600654-113600676 GCTGGCAAATAGGTTGTGGTGGG + Intergenic
1059351671 9:113669800-113669822 TCTGGTCAATAGAATGTGGATGG + Intergenic
1059772026 9:117435696-117435718 CCTAGCAAATAGCAAGTGCTTGG + Intergenic
1059995570 9:119905262-119905284 TTTAGCAAAATGAAAGTGGTGGG - Intergenic
1186011274 X:5136524-5136546 TCTTGTAAATAGTATGTTGTTGG - Intergenic
1186276220 X:7940972-7940994 TCTGGCAGAGAGAATGTGATTGG + Intergenic
1186456884 X:9716761-9716783 TCTAGAAAATAGAAAGTGTTGGG - Exonic
1186762717 X:12740189-12740211 TGTAACCAATAGAATTTGGTGGG - Intergenic
1186829368 X:13375557-13375579 TCTAGAAAATAGAATATTGTGGG + Intergenic
1187205735 X:17179261-17179283 TTCCACAAATAGAATGTGGTGGG + Intergenic
1188861157 X:35258591-35258613 TCTAGCCAATAGACTGTGGGTGG + Intergenic
1190778279 X:53572903-53572925 ACAAGAAAATAGAATGGGGTGGG - Intronic
1195895345 X:109740641-109740663 TCTAGGAAATAGTATGAGGTAGG - Intergenic
1196688647 X:118535149-118535171 TCAAGGAAATAAAATGTGGTAGG + Intronic
1198187201 X:134265066-134265088 TCTAACCAATAGAATGTGACAGG - Intergenic
1198694286 X:139319458-139319480 GATGGCAAATAGAATGTGGGTGG + Intergenic
1199860131 X:151793978-151794000 ACTAGCAAATAAAATGTGACTGG - Intergenic
1200369462 X:155707823-155707845 TCCAGCAAATAGCATATAGTTGG + Intergenic