ID: 1170879754

View in Genome Browser
Species Human (GRCh38)
Location 20:20286247-20286269
Sequence CGCCACTATCAGGCAGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170879754_1170879764 22 Left 1170879754 20:20286247-20286269 CCACATCCTGCCTGATAGTGGCG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1170879764 20:20286292-20286314 GTCCAGCCTCCAGCCAGGTTAGG 0: 1
1: 0
2: 2
3: 17
4: 204
1170879754_1170879759 -3 Left 1170879754 20:20286247-20286269 CCACATCCTGCCTGATAGTGGCG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1170879759 20:20286267-20286289 GCGCCTCCTGGGCTCTTAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 155
1170879754_1170879761 0 Left 1170879754 20:20286247-20286269 CCACATCCTGCCTGATAGTGGCG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1170879761 20:20286270-20286292 CCTCCTGGGCTCTTAGCAGGTGG 0: 1
1: 1
2: 1
3: 24
4: 251
1170879754_1170879763 17 Left 1170879754 20:20286247-20286269 CCACATCCTGCCTGATAGTGGCG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1170879763 20:20286287-20286309 AGGTGGTCCAGCCTCCAGCCAGG 0: 1
1: 0
2: 1
3: 33
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170879754 Original CRISPR CGCCACTATCAGGCAGGATG TGG (reversed) Intronic
900917187 1:5647075-5647097 AGCAGCTATCAGGCAGGAGGAGG + Intergenic
901433734 1:9234036-9234058 CACCATTATCAGGCAGTAGGTGG - Intergenic
902316105 1:15619737-15619759 AGCCACTATCGGGCCGGGTGCGG - Intronic
907509956 1:54950607-54950629 AGGCACTCTCAGGCACGATGTGG - Intergenic
907522000 1:55030029-55030051 AGCAACTATAAGGCAGGCTGGGG - Intergenic
907654155 1:56325309-56325331 CCCCACTACCTGGCAGGAGGAGG + Intergenic
908375912 1:63540625-63540647 CATCACTATGAGGCAGTATGGGG - Intronic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
923712315 1:236397059-236397081 CGACAGTACCAGGCAAGATGGGG + Intronic
1068998392 10:63235379-63235401 CCCAGCTATCAGGGAGGATGAGG + Intronic
1078290947 11:10008918-10008940 CCCCATTATCTGGCAGGATTTGG - Intronic
1079493227 11:21012426-21012448 AGCCACTCCCATGCAGGATGGGG - Intronic
1091737278 12:2933229-2933251 ATTCACTATCAGGCAGGGTGTGG - Intronic
1092938393 12:13385456-13385478 GGACACTATCAGGCAGGAAGAGG + Intronic
1100340542 12:93675314-93675336 CACCACTCTCAGGCAGGTTTTGG + Intergenic
1101503789 12:105328624-105328646 CAATCCTATCAGGCAGGATGGGG + Intronic
1104092171 12:125526305-125526327 TGTCACTATCAGGAAGGAAGGGG + Intronic
1106771164 13:32961917-32961939 TGCAAATATAAGGCAGGATGTGG + Intergenic
1114635370 14:24184148-24184170 TGCTACCACCAGGCAGGATGGGG + Intronic
1120043998 14:79785998-79786020 CCCCACCATGAGGCAGAATGAGG + Intronic
1120875442 14:89371210-89371232 GGCCACTTTCGGGCAGGAAGAGG - Intronic
1121086110 14:91147219-91147241 TGCCACATCCAGGCAGGATGAGG - Intronic
1121328348 14:93034609-93034631 CCCCACCTTCATGCAGGATGTGG - Intronic
1122941088 14:104981721-104981743 CCCCACAAACAGGCAGGCTGCGG + Intergenic
1127604339 15:60571044-60571066 AGCCACTAGCAGGCAAAATGAGG - Intronic
1128643413 15:69357377-69357399 CCCCACTACCAGGGAGGCTGAGG - Intronic
1129262492 15:74376430-74376452 CTCCACCATCAGCCAGGATCGGG + Intergenic
1130513731 15:84609793-84609815 GGACACAATCAGGCAGGAAGGGG + Intronic
1134667051 16:16026316-16026338 CCCCGCTATGTGGCAGGATGAGG + Intronic
1139917317 16:70436851-70436873 GGCCAAAATAAGGCAGGATGTGG + Intronic
1141564437 16:84891813-84891835 CCCCACTATCACCCAGGGTGTGG + Intronic
1141607466 16:85162806-85162828 CGCCTCTAGCAGGAAGGATCTGG + Intergenic
1144053141 17:11515064-11515086 TGCCACTGTCAGGGAGCATGTGG + Intronic
1144589435 17:16511739-16511761 CCCCACAGTCAGGCAGGAAGGGG - Intergenic
1151769561 17:76151129-76151151 CTCCACGCTCAGGCAGGAAGGGG + Intronic
1152968005 18:134336-134358 CCCCACAATCAGGCCGGGTGCGG + Intergenic
1153046421 18:859369-859391 TGCTACTTTCAGGCTGGATGTGG - Intergenic
1160095836 18:75872081-75872103 CGCAGATATCAGGCAGGCTGCGG - Intergenic
1161660206 19:5541150-5541172 CACCATTATCAGGCTGGGTGCGG + Intergenic
1161968876 19:7564724-7564746 CCCAACTACCAGGGAGGATGAGG - Intergenic
1166217548 19:41345379-41345401 CGCCACTATTTGGGAGGCTGAGG + Intronic
1167676430 19:50889279-50889301 GGCCAGTGTCTGGCAGGATGTGG + Intergenic
1168166631 19:54553125-54553147 CGTCACTAGCACCCAGGATGAGG - Intergenic
926825486 2:16901712-16901734 GGCCACTGACTGGCAGGATGAGG + Intergenic
926894354 2:17668648-17668670 ATACCCTATCAGGCAGGATGAGG - Intronic
931653200 2:64487428-64487450 GGTCACCATCAGGCATGATGAGG - Intergenic
937288662 2:120768770-120768792 GGCCTCTTTCAGGCAGGAGGAGG - Intronic
937407147 2:121640602-121640624 TGCCACTATCTGGCAGCATCTGG - Intronic
938921045 2:135995299-135995321 TGTCACTATCAGGGAGTATGTGG + Intergenic
944538827 2:200737686-200737708 CACCACAATCAGTCAGGAGGAGG + Intergenic
1170879754 20:20286247-20286269 CGCCACTATCAGGCAGGATGTGG - Intronic
1175064641 20:56274459-56274481 CGCCACTATCTGGAAAGAGGGGG + Intergenic
1175758025 20:61542203-61542225 AGCCTCTATCAGTCAGGATGGGG - Intronic
1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG + Exonic
950495051 3:13328760-13328782 TGCCACTAACAGGTAGGATGTGG - Exonic
961244612 3:125440588-125440610 CTCCAATGTCAGGCAGGATTGGG + Intergenic
962643347 3:137411487-137411509 AGCCACTATAAGACAGGAAGAGG - Intergenic
966880033 3:184344972-184344994 TGCCACTGCCAGGCATGATGTGG - Exonic
968069897 3:195778300-195778322 CACCTCTCTCAGGCAGGATGGGG + Exonic
971768993 4:30871828-30871850 CACCACCATCAGCAAGGATGGGG - Intronic
972651429 4:41021267-41021289 CGCCCCTATCCAGCAGGAAGTGG + Intronic
978824637 4:113006810-113006832 CCCCACCATGAGGCAGGATAAGG - Intronic
999141648 5:149366280-149366302 TCCCAGAATCAGGCAGGATGGGG - Intronic
999425469 5:151484443-151484465 TGCCACCCTCAGGCAGGACGTGG + Intronic
1002201415 5:177530851-177530873 AGCCATTTCCAGGCAGGATGGGG + Intronic
1005339789 6:24832456-24832478 CACCACATTCAGGAAGGATGAGG - Intronic
1006896798 6:37476373-37476395 ACCCACTGCCAGGCAGGATGGGG - Intronic
1009938929 6:70267215-70267237 CTCCACCATCAGGAAGGAGGTGG - Intronic
1015079455 6:129205905-129205927 CCCCACTACCAGGGAGGCTGAGG + Intronic
1015465328 6:133542720-133542742 CTCCACCCCCAGGCAGGATGAGG - Intergenic
1015962821 6:138668325-138668347 CGCAACTACTAGGGAGGATGAGG + Intronic
1020075216 7:5253339-5253361 CGCCACCATCAGGAGAGATGAGG - Intergenic
1023401132 7:39793479-39793501 GGCCACTGGGAGGCAGGATGTGG + Intergenic
1024074635 7:45812210-45812232 GGCCACTGGGAGGCAGGATGTGG + Intergenic
1024075118 7:45814138-45814160 GGCCACTGGGAGGCAGGATGTGG + Intergenic
1024648481 7:51387202-51387224 GGCCACTGGGAGGCAGGATGTGG - Intergenic
1025052332 7:55741671-55741693 GGCCACTGGGAGGCAGGATGTGG - Intergenic
1025130003 7:56370201-56370223 GGCCACTGGGAGGCAGGATGTGG - Intergenic
1025203860 7:56980226-56980248 CGCCACCATCAGGAGAGATGAGG + Intergenic
1025668080 7:63596705-63596727 CGCCACCATCAGGAGAGATGAGG - Intergenic
1029489018 7:100860267-100860289 CCCCACCAGCTGGCAGGATGGGG + Intronic
1030067953 7:105674812-105674834 CACCACTATTGGGCAGGATCTGG + Intronic
1035766218 8:2107697-2107719 CACCACTCACAGGCAGGGTGGGG + Intronic
1036062085 8:5334868-5334890 TGGCACTACCAGGCAGGGTGAGG - Intergenic
1040617528 8:49053174-49053196 CACCACTATCAGGATGTATGAGG + Intergenic
1041969987 8:63729499-63729521 CACCACTCCCAGGCAGGCTGAGG + Intergenic
1042843427 8:73147421-73147443 TGCCCCTGTCAGGCAGGAGGGGG - Intergenic
1044716121 8:95101396-95101418 CGCCACTCTCAGGTATGTTGTGG - Intronic
1049602536 8:143514582-143514604 CGCCCCTAGCAGCCAGGACGGGG + Intronic
1056443525 9:86642990-86643012 CGACCCTATAAGGCAGAATGTGG - Intergenic
1057579972 9:96279045-96279067 CTCCACTACGTGGCAGGATGTGG + Intronic
1058928114 9:109689002-109689024 CGCCACCATCAGTCAGTAGGAGG + Intronic
1062572415 9:137191762-137191784 GGCCACTGTGAGGCAGGCTGAGG + Exonic
1062721272 9:138045534-138045556 CGCCACTGTCAGGCAGAAACTGG - Intronic
1192184727 X:68939352-68939374 CGCCAGTCTCATGGAGGATGTGG - Intergenic
1200380333 X:155830706-155830728 CCCAACTACCAGGCAGGCTGAGG + Intergenic