ID: 1170882113

View in Genome Browser
Species Human (GRCh38)
Location 20:20305812-20305834
Sequence CAGTTTGCTCACGTACTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170882106_1170882113 30 Left 1170882106 20:20305759-20305781 CCACTCATTCAATTACAGGCTAT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1170882113 20:20305812-20305834 CAGTTTGCTCACGTACTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1170882109_1170882113 0 Left 1170882109 20:20305789-20305811 CCCTCATAAAAGGCAATCGAGGT 0: 1
1: 0
2: 1
3: 3
4: 44
Right 1170882113 20:20305812-20305834 CAGTTTGCTCACGTACTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1170882110_1170882113 -1 Left 1170882110 20:20305790-20305812 CCTCATAAAAGGCAATCGAGGTC No data
Right 1170882113 20:20305812-20305834 CAGTTTGCTCACGTACTCTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170882113 Original CRISPR CAGTTTGCTCACGTACTCTG GGG Intronic
902489722 1:16772507-16772529 CAGGCTGCTCATGGACTCTGAGG + Intronic
903286410 1:22279695-22279717 CAGGATGGTCACGAACTCTGGGG - Intergenic
907173609 1:52497045-52497067 CAATTTCCTGACGGACTCTGAGG + Exonic
907642336 1:56203631-56203653 CAGCCTGCTCAAGTGCTCTGAGG + Intergenic
908907216 1:69029509-69029531 CAGTATGCTTAGGTACTATGGGG - Intergenic
910006125 1:82399144-82399166 CTCTTTGGTCACTTACTCTGTGG + Intergenic
915036161 1:152927132-152927154 CAGATTGTTCAAGAACTCTGAGG + Intergenic
915640495 1:157220490-157220512 CAGTCTGCTCACTTTTTCTGGGG + Intergenic
919555468 1:199046753-199046775 CAGTTTGCAGACATGCTCTGTGG - Intergenic
920057025 1:203200143-203200165 CCGTTTGCTCACCTACTGAGAGG - Intergenic
920779702 1:208976687-208976709 CATTTTGCTCACAGATTCTGTGG - Intergenic
923530718 1:234810021-234810043 CAGGCTGCTCATGGACTCTGAGG - Intergenic
1062868112 10:874502-874524 CAAGTTGCTCATGTACTATGTGG + Intronic
1063991208 10:11565702-11565724 CAGTTTGCTACCCTACGCTGTGG - Intronic
1065052889 10:21813836-21813858 CAGTTGGCCCTCTTACTCTGTGG + Intronic
1068972238 10:62972029-62972051 CAGTTTGCTCAGATAAACTGAGG + Intergenic
1071665414 10:87551012-87551034 CAGATTGCTCAGATGCTCTGTGG + Intronic
1076568458 10:131414729-131414751 CAGTTGGCGCACGTCCTCCGAGG + Intergenic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1086177182 11:83905218-83905240 CAGTTTCCTCACCTACTAAGTGG - Intronic
1087348127 11:96997209-96997231 AAGTTTGCTCACAAATTCTGGGG + Intergenic
1089426517 11:118380859-118380881 CATTTTGGTCACTTGCTCTGGGG - Intronic
1091455285 12:602374-602396 CAGTGGGATCACATACTCTGTGG + Intronic
1095148075 12:38754933-38754955 TTGTTTCCTCACTTACTCTGTGG - Intronic
1102255560 12:111412779-111412801 CAGCTTGGTCTCGAACTCTGGGG + Intronic
1105868825 13:24486230-24486252 AAGTTTGCTCAAAAACTCTGTGG + Exonic
1106399864 13:29419325-29419347 CAGTTTCCTCAGGTAGTGTGGGG + Intronic
1107688329 13:42926402-42926424 CAGTTTGCTCAAGAACTCAGCGG + Exonic
1111896426 13:94147940-94147962 TATTTTACTCAAGTACTCTGTGG + Intronic
1119185683 14:72640670-72640692 CAGTTTTATCATCTACTCTGTGG - Intronic
1128385825 15:67147518-67147540 CAGTTTCCTCACGTGTTCAGGGG + Intronic
1140132942 16:72180076-72180098 GAGGTTGCTCATGTACTGTGCGG - Intergenic
1156188491 18:34690677-34690699 GGGTTTTCTCACATACTCTGTGG - Intronic
1159925041 18:74261821-74261843 CAGTTTGCTCACTTAGAATGAGG + Intronic
1159982558 18:74803220-74803242 CTGTTTGCTCCCGTGCTCTTGGG + Intronic
1161896285 19:7083785-7083807 GAGTTTGCTCATGTTATCTGAGG - Exonic
925314032 2:2907764-2907786 CAGTTTGCTCAGGGAGTCTCAGG - Intergenic
927392133 2:22607504-22607526 CAGTGGGCTCACGTTCTCCGGGG - Intergenic
930109503 2:47666543-47666565 CTGTTTGCTCAGGTGCTTTGTGG - Intergenic
930561612 2:52966318-52966340 CAGTTTGCTCCTTTACTCTGTGG - Intergenic
940315263 2:152321123-152321145 CTGTGTGCTAAGGTACTCTGGGG - Intergenic
942208212 2:173644834-173644856 CAGCTTGCTGACAGACTCTGAGG - Intergenic
948227285 2:236320987-236321009 CAGTTTGCTGACCTGCTCCGTGG + Intergenic
1169324763 20:4666278-4666300 CAGTCTCCTCAAGTATTCTGGGG - Intergenic
1170882113 20:20305812-20305834 CAGTTTGCTCACGTACTCTGGGG + Intronic
1172946985 20:38697328-38697350 CATTCTGCTCACCGACTCTGTGG - Intergenic
1176692650 21:9934636-9934658 CAGTTTGCTTACGTATTTTCTGG + Intergenic
950624498 3:14234914-14234936 CAGTTTCATCACCCACTCTGCGG - Intergenic
960673918 3:120176779-120176801 CAGGTTGCTCTCGAACTCTTGGG + Intronic
961999589 3:131281733-131281755 AAGTTTGATAACGTACTTTGTGG - Intronic
962647397 3:137453947-137453969 CAGGTTGATCACGAACTCTTGGG - Intergenic
970516780 4:16839562-16839584 CAGTTTGCTCACGTAGAATGAGG - Intronic
972093068 4:35312942-35312964 AAATATGCTCACTTACTCTGTGG - Intergenic
976216146 4:82717297-82717319 CAGACTGCTCAGGTTCTCTGAGG + Intronic
980365233 4:131794846-131794868 CAGTTTGCTTACGTATTTTCTGG + Intergenic
980675828 4:136079203-136079225 CAGTTTCCTGAAATACTCTGAGG + Intergenic
981429315 4:144641886-144641908 CAGGTTGGTCTCGAACTCTGGGG + Intergenic
989531870 5:42516808-42516830 CAGTTGCCTCATGTCCTCTGTGG + Intronic
989762600 5:45036246-45036268 CAGTGGGCTCAAGTGCTCTGTGG - Intergenic
990558867 5:56963935-56963957 CAGTTTGCCCAGGTCCCCTGTGG - Intronic
992475656 5:77099510-77099532 CAGGTTCCTCAAGTACACTGAGG - Intergenic
993597905 5:89882363-89882385 CAGTCTGTTCACACACTCTGAGG + Intergenic
996846911 5:127909976-127909998 CAGTTTCCTCATTTCCTCTGTGG + Intergenic
997397969 5:133579927-133579949 CAGCTTGCTCACCTTCTCAGAGG - Intronic
1002599746 5:180347367-180347389 CAGTTTGGTCATGTGCCCTGTGG + Intronic
1006436530 6:34028584-34028606 CAGTTTCCTCACGTATAATGTGG + Intronic
1013111621 6:107069274-107069296 CAGTTTGCCCACGAACTCCAGGG + Exonic
1014552476 6:122804519-122804541 CAGGTTGGTCTCGAACTCTGGGG + Intronic
1015089204 6:129334120-129334142 CAGTTTCCTCACTTACTGTGTGG - Intronic
1015410533 6:132889017-132889039 CACTTTGCTCAGGTACTAAGTGG - Intergenic
1024782317 7:52865419-52865441 CAGTAGGTTCAGGTACTCTGTGG - Intergenic
1031728845 7:125271893-125271915 CAGTTTTCTTACTGACTCTGAGG + Intergenic
1035437345 7:158869004-158869026 TAATTTTCTCACATACTCTGTGG + Intronic
1044591148 8:93916152-93916174 ATGTGTGCTCACGTTCTCTGAGG - Intronic
1047818217 8:128488414-128488436 CAGTTTGCTCATATACTAGGAGG + Intergenic
1047844054 8:128786833-128786855 CAGTTTTCTTACCTACCCTGGGG - Intergenic
1051525145 9:18034621-18034643 CAGTTTTCTCTCCTTCTCTGTGG + Intergenic
1053629591 9:39920701-39920723 CAGTTTGCTTACGTATTTTCTGG + Intergenic
1054214296 9:62330001-62330023 CAGTTTGCTTACGTATTTTCTGG - Intergenic
1054365557 9:64335644-64335666 CAGTTTGCTTACGTATTTTCTGG + Intergenic
1054673188 9:67825357-67825379 CAGTTTGCTTACGTATTTTCTGG + Intergenic
1057889381 9:98857128-98857150 CAATTTTCTCAAGAACTCTGTGG + Intergenic
1187680050 X:21758725-21758747 CTGTTGTCTCACGTACTCTAAGG - Intergenic