ID: 1170884226

View in Genome Browser
Species Human (GRCh38)
Location 20:20325137-20325159
Sequence TAAGTGGCTGGGGGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1950
Summary {0: 1, 1: 0, 2: 7, 3: 125, 4: 1817}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170884226_1170884234 12 Left 1170884226 20:20325137-20325159 CCTCCTCCACCCCCAGCCACTTA 0: 1
1: 0
2: 7
3: 125
4: 1817
Right 1170884234 20:20325172-20325194 TATTATTTACATCTTTAGTGTGG 0: 1
1: 0
2: 3
3: 44
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170884226 Original CRISPR TAAGTGGCTGGGGGTGGAGG AGG (reversed) Intronic
900001374 1:16705-16727 TCAGGAGCTGGGGGTGGTGGTGG + Intergenic
900021094 1:187227-187249 TCAGGAGCTGGGGGTGGTGGTGG + Intergenic
900154142 1:1197381-1197403 GCAGAGGCTGGGGCTGGAGGGGG - Intronic
900219948 1:1503071-1503093 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
900234587 1:1581770-1581792 AAATTAGCTGGGCGTGGAGGCGG + Intergenic
900261314 1:1731225-1731247 TAACTAGCTGGGTGTGGTGGCGG + Intronic
900283641 1:1888940-1888962 TTCGAGGCTGGGGATGGAGGTGG - Intronic
900413973 1:2526699-2526721 TCAGAGGCCGGGGGTGGGGGAGG - Intergenic
900643567 1:3698598-3698620 GAAGGGTCTGGGGGAGGAGGCGG + Intronic
900655411 1:3754410-3754432 AATGAAGCTGGGGGTGGAGGGGG + Intronic
900745313 1:4356730-4356752 TCAGTGGGTGGTGCTGGAGGCGG + Intergenic
900848187 1:5120640-5120662 TAGGTAGGTGGGTGTGGAGGTGG - Intergenic
901035298 1:6332669-6332691 TAATTAGCTGGGTGTGGTGGCGG + Intronic
901279983 1:8026379-8026401 TGATTGGCTGCGGGAGGAGGCGG - Intergenic
901375544 1:8835794-8835816 AAATTAGCTGGGGGTGGCGGTGG - Intergenic
901385450 1:8905530-8905552 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
901518293 1:9764140-9764162 GAGGTGGGTGGGGGAGGAGGAGG + Intronic
901659915 1:10792693-10792715 TGACTGGTTGGGGGTGGGGGTGG - Intronic
901662060 1:10804661-10804683 GATGTGGGTGGGGGAGGAGGAGG + Intergenic
901662318 1:10806216-10806238 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
901663296 1:10812636-10812658 GTAGTGGCAGGGGGTCGAGGAGG - Intergenic
901704688 1:11064387-11064409 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
901790198 1:11649921-11649943 TAAGGAGAAGGGGGTGGAGGAGG - Intronic
901810069 1:11762384-11762406 TAAGTGGACAGGGGTGGGGGTGG + Intronic
902040741 1:13490578-13490600 GGAGCGGGTGGGGGTGGAGGTGG - Intronic
902175138 1:14644159-14644181 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
902253373 1:15171097-15171119 GATGTGGCGGGGGGTGGAGGAGG - Intronic
902262537 1:15237523-15237545 TGAGGGGCTGGGGTTGGAGAGGG - Intergenic
902352650 1:15869181-15869203 TGAGTGGCTGGGACTGCAGGCGG + Intronic
902543629 1:17172464-17172486 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
902553467 1:17232972-17232994 TGAGGGGCTGGGGCGGGAGGTGG + Intronic
902590348 1:17469519-17469541 GAAGGGGGTGGGGGTGGGGGTGG + Intergenic
902776198 1:18676481-18676503 TGAGTGGCTGGGGGAGGGGAGGG + Intronic
902835389 1:19043770-19043792 TGGGTGGGAGGGGGTGGAGGGGG + Intergenic
902863918 1:19265231-19265253 AAAATGGCTGAGGGAGGAGGTGG + Intergenic
902880458 1:19368778-19368800 TCAGTGTCTGGGGGCTGAGGTGG - Intronic
902905771 1:19556051-19556073 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
903031748 1:20468585-20468607 CAGGTGGCTGGGGATGCAGGGGG - Intergenic
903040454 1:20525779-20525801 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
903116873 1:21185513-21185535 TAAGTAGCTGGGTTTGTAGGTGG - Intergenic
903538229 1:24081479-24081501 TATGAGGCTGAGGCTGGAGGAGG + Intronic
903557437 1:24203870-24203892 TGAGTGGGTGGGGGTCGGGGCGG - Intergenic
903883131 1:26525762-26525784 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
903895347 1:26599502-26599524 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
903906287 1:26689524-26689546 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
904014600 1:27409910-27409932 TCAGCTGCTGGTGGTGGAGGAGG + Exonic
904118362 1:28178621-28178643 TGGGGGGCTGGAGGTGGAGGAGG - Intronic
904328087 1:29740323-29740345 CCACAGGCTGGGGGTGGAGGAGG - Intergenic
904466181 1:30708908-30708930 TATTTGGCAGGGGGTGGGGGTGG - Intergenic
904556828 1:31370757-31370779 TAAGCTGCTGGGGGGAGAGGGGG - Intronic
904756552 1:32771490-32771512 TCAGGGGCAGGGGGTGGGGGAGG - Exonic
904796248 1:33058429-33058451 TGAGAGGGTGGGGCTGGAGGGGG + Intronic
904983073 1:34522993-34523015 TATGTGGTTGGCGGTGGTGGTGG + Intergenic
905018586 1:34793507-34793529 GAAGGGGGTGGGAGTGGAGGTGG + Intronic
905353408 1:37363267-37363289 TCAGTGCCTGGAGGAGGAGGGGG - Intergenic
905376761 1:37526795-37526817 AAAGTGGCTGGGTGTGGTGGTGG + Intergenic
905447145 1:38034810-38034832 TGTGAGGCTGGGTGTGGAGGTGG + Intergenic
905660850 1:39723079-39723101 AAATTAGCTGGGGGTGGTGGCGG + Intronic
905713132 1:40124696-40124718 TAATTAGCTGGGCGTGGTGGTGG - Intergenic
906160288 1:43643527-43643549 TAATTGCCTGGGGCTGGGGGTGG + Intergenic
906399872 1:45497021-45497043 AAAGTGGCTGGGCATGGTGGCGG + Intronic
906666944 1:47628628-47628650 TTGGTGGCTGGGGATGGAGTGGG + Intergenic
906676756 1:47698779-47698801 TAGTTGGCAGTGGGTGGAGGGGG - Intergenic
906809451 1:48811173-48811195 GTAGTGGGTGGGGGTGGGGGTGG + Intronic
907002204 1:50872748-50872770 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
907515045 1:54988442-54988464 TGGGGGGCTGGGGGTCGAGGAGG + Intronic
907835802 1:58107319-58107341 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
908143843 1:61216848-61216870 AAATTGGCTGGGCGTGGTGGTGG + Intronic
908400544 1:63768878-63768900 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
908626795 1:66053707-66053729 AAATTGGCCGGGGGTGGTGGCGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
908682897 1:66682288-66682310 TAGGTGGGTGGTGGTGGGGGAGG - Exonic
908747360 1:67388493-67388515 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
909042319 1:70669389-70669411 AAATTAGCTGGGTGTGGAGGGGG - Intergenic
909546563 1:76854647-76854669 TCAGGAGGTGGGGGTGGAGGAGG - Intergenic
909576327 1:77180703-77180725 GAAGTGGGTGGGGGTGGGGGGGG + Intronic
909937827 1:81574213-81574235 GAAGTGGGTGGTGGGGGAGGGGG + Intronic
910083127 1:83365633-83365655 TAGGTGGGTGGGGGTGAGGGTGG + Intergenic
910088779 1:83436839-83436861 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
910423652 1:87098214-87098236 TTAGAGACTGGGGGTGGGGGTGG + Intronic
910884092 1:91947923-91947945 TGGGAGGCTGGGGGTGGGGGTGG - Intergenic
911430746 1:97783542-97783564 TAATTAGCTGGGTGTGGTGGTGG - Intronic
911612511 1:99972046-99972068 AAATTGGCTGGGTGTGGTGGCGG - Intronic
911730521 1:101287798-101287820 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
911923014 1:103791088-103791110 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
912221445 1:107681801-107681823 AAAATAGCTGGGGGTGGTGGCGG - Intronic
912252980 1:108030282-108030304 TAAGTAGCTGAGTGTGGTGGCGG + Intergenic
912411526 1:109483784-109483806 TGAGTGGGTGGGGGGGGGGGGGG + Intronic
912465036 1:109866540-109866562 TATGGGGATGGGGGTGGGGGTGG + Intergenic
912467500 1:109883989-109884011 TAACTGGCTGAATGTGGAGGAGG - Intergenic
912983309 1:114400289-114400311 TAATTGCCAGGGGATGGAGGTGG - Intronic
913108861 1:115640611-115640633 TGGGAGGCTGGGGGTGGGGGAGG + Intergenic
913246617 1:116875622-116875644 CAGGTGGCTGGAGGTGGAGAGGG - Intergenic
913481686 1:119294846-119294868 GAACTGGATGGGGGTGGGGGTGG - Intergenic
913577294 1:120189463-120189485 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
913690048 1:121270940-121270962 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
913984509 1:143552784-143552806 AAAGTGGCCAGGGGTGGAGTTGG - Intergenic
914095867 1:144544009-144544031 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
914147495 1:145009025-145009047 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
914302656 1:146389956-146389978 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
914424794 1:147565891-147565913 TAAGAGGATGGGGGTGAAAGTGG - Intronic
914559207 1:148800890-148800912 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
914613626 1:149329333-149329355 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
914705636 1:150167531-150167553 TAATTAGCTGGGCGTGGTGGTGG + Intergenic
915102404 1:153509788-153509810 TGGAAGGCTGGGGGTGGAGGAGG + Intergenic
915131070 1:153695878-153695900 TAATTAGCTGGGCGTGGTGGTGG + Intergenic
915136084 1:153732593-153732615 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
915204401 1:154259338-154259360 AAATTAGCTGGGGGTGGTGGTGG - Intronic
915406811 1:155666269-155666291 AAACTGGCTGGGCGTGGTGGCGG - Intronic
915710166 1:157889584-157889606 TCAGGGTCTGGGTGTGGAGGAGG + Intronic
915741112 1:158118997-158119019 GGAGTGGTGGGGGGTGGAGGTGG + Intergenic
915851847 1:159332481-159332503 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
915890900 1:159772871-159772893 TAAGAGGATGGGGGTGGGGTTGG - Intergenic
915940885 1:160117549-160117571 TAAGAGGCTGGGTGAGGTGGGGG + Intronic
915947661 1:160165772-160165794 TAAGATGCTAGGTGTGGAGGGGG - Intronic
916064665 1:161126491-161126513 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
916222791 1:162461265-162461287 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
916536843 1:165711266-165711288 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
916889605 1:169103504-169103526 TGTGTGGCTGGGCGTGGAAGAGG - Intergenic
917555707 1:176086373-176086395 TAATTAGCTGGGCGTGGTGGCGG - Intronic
917843240 1:178999728-178999750 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
917938287 1:179891369-179891391 CAAGTAGCTGGGCGTGGTGGTGG - Intronic
918475506 1:184919910-184919932 TCAGGGGCTGGGGGAGGGGGAGG + Intronic
918485450 1:185024502-185024524 AAAGTAGCTGGGAGTGGTGGCGG - Intergenic
918538954 1:185606224-185606246 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
918652996 1:186989269-186989291 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
918788998 1:188801240-188801262 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
919091424 1:192982511-192982533 AAGGTGGGTGGGGGTGGGGGGGG - Intergenic
919537470 1:198806082-198806104 AAATTAGCTGGGTGTGGAGGTGG - Intergenic
919682417 1:200448939-200448961 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
919708320 1:200700454-200700476 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
919779584 1:201213360-201213382 TCAGGGGCTGAGGTTGGAGGAGG + Exonic
919867914 1:201796470-201796492 TAATTAGCTGGGTGTGGTGGCGG - Intronic
919991831 1:202712664-202712686 TAATAGGCTGGGTGTGGAGGGGG - Intergenic
919999483 1:202786177-202786199 TAAGAGACGGGGGGTGGGGGGGG + Intronic
920066716 1:203274284-203274306 TAGGTGGCTGGGGGTGGGGTGGG + Intergenic
920098163 1:203499987-203500009 GAAGTGGGTGGTGGTAGAGGTGG - Intronic
920329019 1:205191491-205191513 TAAATGGAGGGGGGTGGAGTTGG + Intronic
920369975 1:205472774-205472796 CAGGAGGCTGGGGGTGGAGGTGG + Intergenic
920399089 1:205666056-205666078 GTAGGGGCTGGGGGTGGTGGAGG - Intronic
920477368 1:206289420-206289442 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
920685525 1:208106124-208106146 TAAGTTGGCAGGGGTGGAGGGGG + Intronic
920868070 1:209769697-209769719 TAATGGTCTGGGGGTAGAGGAGG - Intronic
920907428 1:210184760-210184782 TAAATGGCGGGGGGTGGGGAGGG - Intergenic
921160465 1:212468703-212468725 TAAGGCGGTGGGGGTGGGGGGGG - Intergenic
921326300 1:213988762-213988784 CTGGTGGCTGGGGGTGGCGGTGG + Intronic
921371144 1:214424144-214424166 AAAGTAGCTGGGTGTGGTGGCGG + Intronic
921544265 1:216455285-216455307 TAATTAGCCGGGGGTGGTGGCGG + Intergenic
921607204 1:217169579-217169601 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
921641226 1:217557255-217557277 AAATTGGCTGGGCGTGGTGGCGG + Intronic
921672082 1:217936636-217936658 TCAGAGGCTGTGGGTGGTGGTGG + Intergenic
921733519 1:218600212-218600234 AAATTAGCTGGGTGTGGAGGTGG + Intergenic
921847237 1:219897228-219897250 TATGTTGGTGGGGGTGGGGGTGG - Intronic
922034039 1:221831078-221831100 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
922041885 1:221904830-221904852 GAAGTGGCTGAGGGTGATGGTGG - Intergenic
922226923 1:223653459-223653481 AAAGTGGCGGGGGGTGGTGATGG + Intronic
922236559 1:223726754-223726776 TCAGGGGCTGGGAGGGGAGGGGG - Intronic
922355775 1:224773881-224773903 TGAGGGGCTGTGGCTGGAGGAGG - Intergenic
922515145 1:226202196-226202218 TAATTAGCTGGGCGTGGTGGTGG - Intergenic
922587547 1:226746325-226746347 TAAGTGGCCAGGGGAGGTGGGGG - Intergenic
922639729 1:227217295-227217317 AAATTGGCTGGGTGTGGTGGCGG + Intronic
922771801 1:228189212-228189234 TTAGCTGCTGGGGGTGGTGGTGG + Intergenic
922957175 1:229612932-229612954 TCAATGGCTGTGTGTGGAGGTGG - Intronic
922982285 1:229837394-229837416 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
923141602 1:231164391-231164413 TAAGTTGCTGAGGGTGGCAGAGG - Intronic
923227811 1:231955637-231955659 AAATTGGCTGGGCGTGGTGGTGG - Intronic
923280141 1:232435975-232435997 TGTGTGCCTGGGGCTGGAGGAGG + Intronic
923349648 1:233091451-233091473 TAAAGGGGTGGGGGTGGAAGTGG + Intronic
923477323 1:234346255-234346277 TAAATGGGTGAGGGTGGTGGAGG + Intergenic
923639700 1:235742303-235742325 AAATTGGCTGGGTGTGGTGGTGG + Intronic
923643641 1:235792462-235792484 AAATTAGCTGGGGGTGGTGGTGG - Intronic
923720119 1:236459760-236459782 AAATTGGCTGGGTGTGGCGGTGG - Intronic
923749480 1:236734316-236734338 TAAGTGTATGGGGGCGAAGGGGG + Intronic
924275418 1:242381389-242381411 TAGGTGGTTGGGGGTGAGGGAGG + Intronic
924475844 1:244381174-244381196 GAAGTTGCTGGGGGCTGAGGAGG + Intronic
924580929 1:245323872-245323894 TGGGTGGATGGAGGTGGAGGTGG + Intronic
924580942 1:245323908-245323930 TGGGTGGATGGAGGTGGAGGTGG + Intronic
924580991 1:245324056-245324078 TGGGTGGTTGGAGGTGGAGGTGG + Intronic
924725939 1:246670811-246670833 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
924726720 1:246678283-246678305 GAAATGGTTGGGGGTGGGGGTGG - Intergenic
1063072703 10:2682123-2682145 TCAGAGGCTGCAGGTGGAGGTGG + Intergenic
1063235608 10:4112432-4112454 AAAGCTGTTGGGGGTGGAGGAGG - Intergenic
1063410552 10:5833501-5833523 CAAGTAGCTGGGCGTGGTGGCGG + Intronic
1063545931 10:6981546-6981568 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
1063616536 10:7604969-7604991 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1063641938 10:7838753-7838775 TAGGAGGCTGGGTGTGGAGGAGG - Intronic
1063680461 10:8182352-8182374 CAAATGTCTGGGGGTGGGGGTGG + Intergenic
1063933652 10:11054862-11054884 TAAGTAGCTGGGATTGGTGGCGG - Intronic
1063956166 10:11269657-11269679 GAAGAGGCTGGGGAAGGAGGGGG + Intronic
1064059671 10:12127559-12127581 CAAGCGGCGGGGGGTGGGGGGGG - Intergenic
1064135256 10:12745178-12745200 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1064228327 10:13506819-13506841 GGATTTGCTGGGGGTGGAGGCGG + Intronic
1064352165 10:14586219-14586241 TCAGTGGCCTGGGATGGAGGAGG - Intronic
1064391720 10:14947907-14947929 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1064406281 10:15066788-15066810 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1064701871 10:18030385-18030407 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1064968310 10:21037253-21037275 AATGAGGGTGGGGGTGGAGGGGG + Intronic
1065240350 10:23697502-23697524 AATTTGGCAGGGGGTGGAGGGGG - Intronic
1065324330 10:24537425-24537447 AAATTAGCTGGGTGTGGAGGTGG + Intronic
1065934964 10:30513066-30513088 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
1066098123 10:32092583-32092605 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1066191747 10:33062240-33062262 CCAGCGGGTGGGGGTGGAGGGGG + Intergenic
1066370919 10:34817280-34817302 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1066401899 10:35084968-35084990 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1067332474 10:45334579-45334601 TCAGTGACTGAGGGTGGTGGTGG - Intergenic
1068134127 10:52934990-52935012 TTTGTGGCTGGGGGTGGGGTTGG + Intergenic
1068576938 10:58694709-58694731 TATGTGTTTGGGGGTGGTGGTGG + Intronic
1069014082 10:63408251-63408273 AAATTAGCTGGGCGTGGAGGCGG + Intronic
1069055299 10:63838644-63838666 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1069185687 10:65419760-65419782 TAAGAAGCCGGGAGTGGAGGTGG - Intergenic
1069331813 10:67301817-67301839 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1069388016 10:67902357-67902379 TTATTAGCAGGGGGTGGAGGTGG - Intronic
1069457910 10:68568370-68568392 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1069595100 10:69665198-69665220 TTAGAGGCTGGAGGAGGAGGAGG + Intergenic
1069624094 10:69856757-69856779 TGAGGGGCTGGGGGTGGAGCAGG + Intronic
1069789944 10:71013123-71013145 CAAGTGGGTGGGGGTGGGGGAGG - Intergenic
1069824332 10:71246016-71246038 CACCTGGCTGGAGGTGGAGGTGG + Intronic
1069887296 10:71631964-71631986 GAGGTGGCTGGGGGTGGGAGAGG + Intronic
1070073350 10:73111124-73111146 AAAGTGGCTGGGCGTGGTGGCGG - Intronic
1070125730 10:73620161-73620183 TAATTAGCTGGGCGTGGTGGCGG + Intronic
1070242466 10:74696513-74696535 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1070387647 10:75940253-75940275 TAAGCGGCTGGGGGTGGGAAGGG + Intronic
1070392476 10:75983393-75983415 GAAGTGGCTGAGTGTGGCGGGGG + Intronic
1070473780 10:76812279-76812301 GAATTGGCTGGGGGAGAAGGTGG - Intergenic
1070617382 10:77979363-77979385 TAAGGGGCTGGGGTTCGAGAGGG - Intronic
1070774840 10:79103523-79103545 TGGGTGGGTGGGGGTGGAGAGGG + Intronic
1070788545 10:79176261-79176283 TAAGTGGTGGTGGCTGGAGGGGG - Intronic
1070841054 10:79488143-79488165 TAACTGGATGGGGGGGAAGGGGG + Intergenic
1070919077 10:80172740-80172762 ACAGTGGCTGGGAGTGGAGAGGG - Intronic
1071519578 10:86320948-86320970 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1071520411 10:86328769-86328791 CATGTTGGTGGGGGTGGAGGGGG - Intronic
1071723628 10:88173004-88173026 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1071741114 10:88359164-88359186 TAATTAGCTGGGCATGGAGGCGG + Intronic
1071896539 10:90074281-90074303 TAAAGTGCTGGGGGTGGAGGGGG - Intergenic
1072073439 10:91943999-91944021 AAATTAGCTGGGTGTGGAGGCGG + Intronic
1072446000 10:95499220-95499242 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1072608118 10:97000467-97000489 AACGAGGCTGTGGGTGGAGGTGG - Exonic
1072658539 10:97347718-97347740 TGAGAGGCTGGTGGCGGAGGTGG - Intergenic
1072722603 10:97789995-97790017 CAAGTGGGTGGTGGTGGTGGGGG + Intergenic
1072822515 10:98572088-98572110 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1072851687 10:98901191-98901213 TTTGGGGCTGGGGATGGAGGAGG + Intronic
1072972811 10:100031631-100031653 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1073076029 10:100826436-100826458 TACGCGGCAGGGGATGGAGGCGG - Intronic
1073093762 10:100967815-100967837 GAAATGGCTGGGGGGGGGGGGGG - Intergenic
1073240047 10:102051321-102051343 AAAGTAGCTGGGTGTGGTGGAGG + Intronic
1073274129 10:102293925-102293947 TAATTAGCTGGGCGTGGTGGTGG - Intronic
1073319119 10:102603382-102603404 TCACTGGCTGAGGGAGGAGGTGG - Intronic
1073367145 10:102952412-102952434 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1073410743 10:103339638-103339660 AAATTAGCTGGGTGTGGAGGAGG + Intronic
1073672569 10:105608575-105608597 TGTGTGGCAGGGTGTGGAGGAGG - Intergenic
1073695598 10:105863223-105863245 AAAATGGCTGGGCGTGGTGGTGG - Intergenic
1073728527 10:106264155-106264177 AAAATGGCTGGGGGTGGTGGCGG + Intergenic
1073738741 10:106382073-106382095 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1073795696 10:106985684-106985706 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1073945914 10:108750250-108750272 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1073955057 10:108860795-108860817 TGAATGGCTGAGGGTGTAGGGGG - Intergenic
1074378859 10:112961820-112961842 TACGTGGCTGGGGGGTGGGGTGG + Intronic
1074484925 10:113866742-113866764 GAAGGAGCCGGGGGTGGAGGCGG - Intronic
1074553613 10:114468421-114468443 AAAGTAGCTGGGGGTGGTGGCGG - Intronic
1074866572 10:117547449-117547471 GAAGGGGATGGGGCTGGAGGAGG - Intronic
1075104490 10:119529302-119529324 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
1075118971 10:119651003-119651025 TATGGGGGAGGGGGTGGAGGTGG + Intergenic
1075331558 10:121577861-121577883 GAAGAGGCTGGTGGAGGAGGAGG - Intronic
1075508209 10:123045326-123045348 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1075730726 10:124634753-124634775 CCAGTGGCTGGGAGTGGTGGTGG + Intronic
1075792866 10:125097969-125097991 AAAGTAGCTGGGTGTGGCGGCGG + Intronic
1076078395 10:127555947-127555969 AAAGTGGCTTGGGGTGACGGGGG + Intergenic
1076379015 10:130012343-130012365 CAAGTGGCGAGGGGTGCAGGTGG + Intergenic
1076615616 10:131752233-131752255 TGTGGGGCTGGGGCTGGAGGTGG + Intergenic
1076617123 10:131762709-131762731 GAAATAGCTGGGGGTGGCGGGGG + Intergenic
1076998909 11:312498-312520 GATGTGGCTGGGGCTGGAGGCGG + Intronic
1077000344 11:319225-319247 TTAGTTCCTCGGGGTGGAGGGGG - Intergenic
1077080615 11:723028-723050 GAAGGGGCGGTGGGTGGAGGTGG - Intronic
1077107312 11:847857-847879 TCTGTGGCTGGGGGTGGAAGGGG - Intronic
1077149709 11:1065438-1065460 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
1077166854 11:1146076-1146098 TAAGCGGCTGGGGGTGGACACGG + Intergenic
1077412631 11:2410704-2410726 TAGCTGGCTGGGGCTGGTGGAGG - Intronic
1077464669 11:2728047-2728069 AGAGTGGCTGGGGAGGGAGGAGG - Intronic
1077534115 11:3111148-3111170 TCTGTGGCAGGGGGTGGGGGTGG - Intronic
1077613257 11:3658181-3658203 AAATTAGCTGGGTGTGGAGGCGG + Intronic
1077666214 11:4112511-4112533 AAATTGGCTGGGTGTGGTGGCGG - Intronic
1077722552 11:4643209-4643231 TACGTGGCTGGTGTTGGGGGTGG + Intergenic
1077801846 11:5547103-5547125 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1078079994 11:8197199-8197221 GAAGTGGCTGGTGGTGCAGCAGG - Intergenic
1078137176 11:8661254-8661276 TGACTGGCTGGGGCTGGAGATGG + Intronic
1078222547 11:9363985-9364007 TAAGTGGGTGGGGGTAGGAGTGG + Intergenic
1078311600 11:10248944-10248966 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1078535944 11:12174355-12174377 GCAGGGGCTGGGGGTGGGGGTGG - Intronic
1078610038 11:12811841-12811863 TATCTGGGTGGGGGTGGGGGTGG + Intronic
1078773074 11:14368992-14369014 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1078785985 11:14492994-14493016 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1079029968 11:16979366-16979388 GAAGGTGGTGGGGGTGGAGGTGG - Intronic
1079166025 11:18044270-18044292 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
1079196550 11:18332403-18332425 TCAGAGGCAGGGGATGGAGGTGG + Intronic
1079494068 11:21021270-21021292 GATGGGGCTGGGGGTGGGGGTGG + Intronic
1079726553 11:23886835-23886857 GAAGGGGCGGGGGGTGGGGGTGG - Intergenic
1080226352 11:29965525-29965547 GAAGTGGGTGGGTGTGGGGGTGG - Intergenic
1080353243 11:31410168-31410190 TGACTGGCTGGGTGTGGTGGTGG - Intronic
1080549522 11:33360285-33360307 TAATTGGCTGGTGGAGTAGGGGG - Intergenic
1080551168 11:33375414-33375436 TCAGTGACTGGGGATGGATGAGG + Intergenic
1080695569 11:34600568-34600590 TGAGTGGGTGGGGGTGGAGAGGG - Intergenic
1081091760 11:38878646-38878668 TAGGTGGCAGGGGGTGGAAGGGG - Intergenic
1081290093 11:41314065-41314087 TAAGGGGCTGGGGGTAGATTGGG + Intronic
1081614922 11:44585127-44585149 TAAGGGGCTGGGGGAGAAGTAGG - Intronic
1081632538 11:44699631-44699653 TGAGAGGCAGGGGGTGGTGGTGG + Intergenic
1081647907 11:44802671-44802693 GAGGTGGCTGGGGCTGCAGGTGG + Intronic
1081718503 11:45268384-45268406 TGAGTGGTGGGGGGTGGGGGTGG + Intronic
1081998874 11:47381845-47381867 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1082000181 11:47389862-47389884 GAAGTCGCTGTGGGTGGCGGTGG - Intergenic
1082093534 11:48108728-48108750 TAAAGGGCAGGGGCTGGAGGAGG + Intronic
1082784129 11:57307534-57307556 TAAGTGGAAGGGGTTGGTGGTGG - Intronic
1082928865 11:58579101-58579123 TGAGTGGCAGGGGGTGGGGGGGG + Exonic
1083155759 11:60821964-60821986 GCAGGGCCTGGGGGTGGAGGGGG - Intergenic
1083205535 11:61146566-61146588 CAAGGGGCTGGGAGGGGAGGAGG + Intronic
1083241660 11:61393053-61393075 TACGGGGGTGGGAGTGGAGGGGG - Intronic
1083261740 11:61526874-61526896 TAAGTGGCTGGGAAGGCAGGTGG + Intronic
1083301368 11:61741125-61741147 GAGGAGGCTGGGGGTGGTGGAGG - Intronic
1083402583 11:62434257-62434279 TTAATGGCTGAGGCTGGAGGTGG - Intronic
1083692402 11:64418238-64418260 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1084028469 11:66467097-66467119 TGCGTGTCTGGGGGTGGTGGAGG + Intronic
1084175268 11:67419500-67419522 TCAGTGGCTGGCGCTGGCGGGGG + Exonic
1084193536 11:67509949-67509971 TGAGTAGGTGGGGGTGGAAGCGG + Intergenic
1084194704 11:67517861-67517883 AAAAGGGCTGGGGGTGGCGGTGG + Intergenic
1084485323 11:69444628-69444650 TATGTGGCTGGGGGTGACGGTGG - Intergenic
1084535744 11:69755641-69755663 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1084650705 11:70487576-70487598 TAAGTGGTTGGGGAAGGTGGTGG + Intronic
1084669925 11:70599640-70599662 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1084677396 11:70643900-70643922 TAAGGGACTGCAGGTGGAGGGGG + Intronic
1084718864 11:70891350-70891372 AAAGTAGCCGGGGGTGGTGGCGG + Intronic
1084978844 11:72817810-72817832 GAAGTGGCAGGAGGAGGAGGAGG + Exonic
1084990342 11:72917132-72917154 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1085040796 11:73325217-73325239 CAGGAGGCTGGGGGTGGGGGAGG - Intronic
1085437599 11:76522515-76522537 AAATTAGCTGGGGGTGGCGGCGG - Intronic
1085625973 11:78073340-78073362 AATTTGGCTGGGGGTGGTGGCGG + Intronic
1085689261 11:78652196-78652218 GCAGTGACTGGGGGTGGTGGTGG + Intergenic
1085767340 11:79294697-79294719 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1085810769 11:79678967-79678989 GAAGTAGCTGGGGGTGGCAGTGG + Intergenic
1086781422 11:90910882-90910904 TAAGTGTGAGGGGTTGGAGGAGG + Intergenic
1086882297 11:92162898-92162920 TAAGTGGGTAGGGGTGGGGGTGG + Intergenic
1087002741 11:93437051-93437073 GATGTGTCTTGGGGTGGAGGTGG - Intronic
1087207468 11:95412116-95412138 AAGGGGGCTGGGGCTGGAGGTGG - Intergenic
1087457544 11:98406039-98406061 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1087526812 11:99324789-99324811 AAAGTAGCTGGGCGTGGTGGAGG - Intronic
1087679639 11:101205022-101205044 TAATTAGCTGGGTGTGGTGGTGG - Intergenic
1087761018 11:102104542-102104564 TACATGGCTGGTGATGGAGGAGG + Intergenic
1089072827 11:115714425-115714447 TAAGTGGGAAGGGGTGGAAGGGG + Intergenic
1089081258 11:115777926-115777948 TATGTGGCTGGTGGTGGTGGTGG + Intergenic
1089202019 11:116730264-116730286 TCTGTGGCTGGGGCTGGAGCTGG - Intergenic
1089257868 11:117203493-117203515 GAAGAGGCTGGGGGAGGAGGTGG + Intronic
1089272154 11:117308801-117308823 AAAATAGCTGGGGGTGGTGGCGG + Intronic
1089465514 11:118682886-118682908 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
1089476637 11:118768865-118768887 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
1089581460 11:119484127-119484149 AGAGTGGCTGGGCATGGAGGAGG + Intergenic
1089606370 11:119643816-119643838 TCAGTGTCGGGGGGTGGGGGTGG + Intronic
1089722930 11:120446046-120446068 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1089923496 11:122232523-122232545 TAAATGGCTGTGGTGGGAGGTGG - Intergenic
1090076118 11:123581035-123581057 TAAGGTGCGGGGTGTGGAGGAGG - Intronic
1090084637 11:123640529-123640551 AAAGTGGCAGGGGGTTGGGGTGG + Intronic
1090229639 11:125092379-125092401 GGGGTGGCTGGGGGAGGAGGAGG + Intergenic
1090298125 11:125608474-125608496 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1090306209 11:125693383-125693405 TAAGTGGGTAGGGGAGAAGGAGG - Intergenic
1090517965 11:127448633-127448655 AAATTAGCTGGGGGTGGCGGTGG + Intergenic
1090600482 11:128364735-128364757 AAAGTGGTTGGGGGTGTATGGGG - Intergenic
1090631531 11:128653380-128653402 TATGCAGCTGGGGGTGGAAGGGG + Intergenic
1090775071 11:129957465-129957487 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1091241784 11:134057820-134057842 AAATTGGCTGGGCGTGGTGGAGG - Intergenic
1091374463 12:16820-16842 TCAGGAGCTGGGGGTGGTGGTGG + Intergenic
1091621502 12:2092603-2092625 TCAGTGGCTGGGGAAGGAGAGGG + Intronic
1091731444 12:2883851-2883873 GAAGTGGCTAGGGGTGTAGATGG + Intronic
1091844510 12:3645498-3645520 CAAGGGGCTGGGGGTGGTGGGGG + Intronic
1092049311 12:5456611-5456633 CCAGGGGCTGGGGGTGGGGGTGG - Intronic
1092312744 12:7375657-7375679 TAATTGGCTGGGGCTAGAGATGG - Intronic
1092348817 12:7739260-7739282 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1092373873 12:7939331-7939353 AAATTAGCTGGGCGTGGAGGCGG + Intergenic
1092797259 12:12124631-12124653 TCTGTGGCTGGGGATGGTGGAGG + Exonic
1092798609 12:12139974-12139996 TATGTGGCTGGGGCTGAAAGAGG + Intronic
1092847807 12:12600362-12600384 GAAGTGGCAGGGCGTGGTGGAGG + Intergenic
1093030200 12:14281422-14281444 TAAATTGCTGGGCGTGGTGGTGG - Intergenic
1093030773 12:14286520-14286542 TAAGTGGCTGGGATTACAGGCGG - Intergenic
1093456111 12:19366525-19366547 TGAGTAGCTGGGATTGGAGGTGG - Intronic
1093516230 12:19989840-19989862 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1093518574 12:20020628-20020650 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
1093662737 12:21775409-21775431 TAAGGGGCCGGGGGTGGTGGGGG - Intronic
1094188598 12:27672619-27672641 TAATTGGGTGGGGGTGAAGGTGG + Intronic
1094216221 12:27945479-27945501 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
1094285626 12:28789909-28789931 TAAAAGGCTGGGTGGGGAGGGGG - Intergenic
1095046905 12:37517065-37517087 AAAATGGCTGGGCGTGGTGGTGG - Intergenic
1095697059 12:45155091-45155113 TTAATATCTGGGGGTGGAGGGGG + Intergenic
1095976001 12:47941660-47941682 GCAGTGGCTGGGGCTGGGGGAGG + Intronic
1096254586 12:50055308-50055330 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1096363534 12:51008863-51008885 TGAGTGACTGGGGGAGGGGGAGG - Intronic
1096363802 12:51011276-51011298 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1096399305 12:51291835-51291857 GCAGTGGCTCTGGGTGGAGGAGG + Exonic
1096475544 12:51907102-51907124 GTAGTGGGTGGGGGTAGAGGGGG - Intronic
1096536118 12:52275907-52275929 CCAGTGGCTGACGGTGGAGGTGG + Exonic
1096640966 12:52994199-52994221 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1096653126 12:53071931-53071953 TAAGTGGCTGAAGGTGTTGGGGG + Intronic
1096713839 12:53478652-53478674 AAAGTAGCTGGGAGTGGTGGTGG + Intronic
1096825785 12:54276572-54276594 CAAGTGGCTGGGGCTGGAGATGG + Intronic
1096864442 12:54553678-54553700 TGAGTGGCGGGGGGAGGAGTAGG + Intronic
1097173418 12:57129426-57129448 AAAGGGGGTGGGGGTGGGGGGGG + Intronic
1097245163 12:57604107-57604129 AAAGTGGCTCGAGGTGGTGGTGG - Intergenic
1097246573 12:57610686-57610708 TAAGAAGCTGGGGGTGGGGTGGG + Intronic
1097333458 12:58356780-58356802 TAAGTTGGTGGAGGTTGAGGAGG + Intergenic
1097603321 12:61721805-61721827 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1097792968 12:63834209-63834231 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1097823221 12:64148429-64148451 AAAGTAGCTGGGTGTGGTGGCGG - Exonic
1097862726 12:64534109-64534131 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
1097929843 12:65170691-65170713 TAAGTGGCGGGGGCAGGAGAGGG - Exonic
1097984402 12:65768347-65768369 GAAGTGGGTGGTGGTGGGGGTGG + Intergenic
1098569767 12:71975193-71975215 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1099093028 12:78337794-78337816 TAATTAGCTGGGCGTGGTGGTGG + Intergenic
1099289241 12:80754761-80754783 AAATTGGCTGGGTGTGGAGGTGG + Intergenic
1099317866 12:81106993-81107015 TGTGGGGGTGGGGGTGGAGGTGG + Intronic
1099964267 12:89428704-89428726 AAAGTAGCTGGAGGTGGTGGTGG - Intronic
1100075678 12:90780075-90780097 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1100082430 12:90869313-90869335 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1100117055 12:91319654-91319676 TCTGTGGCTGGGGGAGGAGGTGG + Intergenic
1100281098 12:93119076-93119098 TAATTAGCTGGGTGTGGTGGTGG - Intergenic
1100407833 12:94286384-94286406 TAGGTGGCTGAGGGTGGTGGGGG - Intronic
1100451675 12:94712660-94712682 TGGGAGGCTGGGGGTGGGGGTGG - Intergenic
1100686559 12:96992725-96992747 TGGGTGGCGGGGGGTGGGGGTGG - Intergenic
1100729883 12:97453371-97453393 GCAGTGGCTGGGGGTGGAGGGGG - Intergenic
1101277738 12:103220768-103220790 TCTGTGGCTGAGGGAGGAGGAGG + Intergenic
1101370747 12:104127787-104127809 TAGGGGGCTGGGGGCTGAGGTGG - Intronic
1101644171 12:106613510-106613532 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1101850951 12:108401864-108401886 GAGGTGGCTGGGGATGGAGGCGG - Intergenic
1101965896 12:109281647-109281669 TCAGTGGCTGGGGTGGGAGCTGG + Exonic
1102079246 12:110084764-110084786 TGGGTTGCTGGGTGTGGAGGTGG - Intergenic
1102148993 12:110675754-110675776 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1102258975 12:111431892-111431914 GAAGAGGCTGGGTGTGGTGGTGG - Intronic
1102261305 12:111445065-111445087 TCAGCTGCTGGGGGTGGAGCTGG + Intronic
1102282522 12:111629653-111629675 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1102323744 12:111960340-111960362 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1102342632 12:112135581-112135603 TAATTAGCTGGGAGTGGTGGTGG - Intronic
1102448339 12:113021388-113021410 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1102487906 12:113270628-113270650 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1102587488 12:113933341-113933363 AAAGAGGGTGGGGGTGGGGGAGG + Intronic
1102686884 12:114731926-114731948 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
1102907361 12:116687239-116687261 TGGGTGGGTGGGGATGGAGGGGG + Intergenic
1103379820 12:120485403-120485425 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1103542775 12:121677858-121677880 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1103655943 12:122470401-122470423 TAAATAGCTGGGCGTGGCGGTGG - Intergenic
1103693781 12:122797688-122797710 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1103875485 12:124123930-124123952 TCAGTGGCTGGGGGAGGGAGGGG - Intronic
1103884003 12:124187560-124187582 TAGGTGGGGGTGGGTGGAGGGGG + Intronic
1104020690 12:124990063-124990085 AAACTAGCTGGGGGTGGTGGCGG - Intergenic
1104029115 12:125051542-125051564 ACAGTGCCTGGGGGTGGAGAGGG + Intergenic
1104461741 12:128962080-128962102 CAAGTGGCGGGAGGTGGAGGGGG - Intronic
1104533631 12:129596808-129596830 TTATTGGCGGGGGGTGGATGGGG - Intronic
1104533754 12:129597884-129597906 TTATTGGCGGGGGGTGGATGGGG + Intronic
1104931690 12:132342472-132342494 CAAGGGGCTGAGGGTGGAGCAGG - Intergenic
1105037179 12:132934127-132934149 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1105261977 13:18786280-18786302 TGAATGGCTGGGGGTTGGGGAGG - Intergenic
1105910232 13:24857529-24857551 TAAGATGCTGGGGGTGTGGGTGG + Intronic
1106134464 13:26963571-26963593 TTAGTGGCTGGAGGGGGTGGGGG + Intergenic
1106226454 13:27790473-27790495 TATGGGGGTGGGGGTGGGGGTGG - Intergenic
1106419850 13:29577199-29577221 AAAGTGGCTGGGAGAGAAGGTGG - Intronic
1106476329 13:30101641-30101663 GAGGTGGTGGGGGGTGGAGGGGG - Intergenic
1106481993 13:30143611-30143633 CAGGTGGCTGGGGGTGATGGTGG - Intergenic
1106599067 13:31171878-31171900 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1106677467 13:31976348-31976370 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1106704737 13:32268244-32268266 TAATTGGCAGGGGGAGGAGGTGG + Intronic
1106723329 13:32458212-32458234 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1106773901 13:32990276-32990298 CAAGGGGCTGGGGGTGCTGGGGG - Intergenic
1106859071 13:33885484-33885506 TAGATGGCTGGGAGGGGAGGAGG - Intronic
1107026975 13:35811682-35811704 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1107241409 13:38239116-38239138 AAATTAGCTGGGCGTGGAGGCGG + Intergenic
1107288584 13:38824965-38824987 GAAAAGGTTGGGGGTGGAGGGGG + Intronic
1107418737 13:40225500-40225522 GTAGTAGCTGGAGGTGGAGGTGG + Intergenic
1107570171 13:41649032-41649054 AAAGTAGCTGGGCGTGGTGGGGG + Intronic
1107665859 13:42689783-42689805 TTAGGGGCTGGGGCTGGGGGTGG + Intergenic
1108047345 13:46395678-46395700 AAAGTAGCCGGGGGTGGTGGTGG + Intronic
1108297751 13:49041659-49041681 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1108361151 13:49669027-49669049 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1108496552 13:51030988-51031010 AAAGTAGCTGGGCATGGAGGTGG - Intergenic
1108990108 13:56644817-56644839 TTAGTGGCTAGGGATGGAAGTGG - Intergenic
1109215415 13:59584216-59584238 GAAATTGTTGGGGGTGGAGGTGG - Intergenic
1110152954 13:72276856-72276878 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1110697418 13:78507674-78507696 TATGTGACTGGGGGTGGCGGTGG - Intergenic
1111350021 13:87015847-87015869 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1111482621 13:88851136-88851158 TCAGAGGCTGGGTGTGGTGGTGG + Intergenic
1112027192 13:95422104-95422126 TAATTAGCTGGGTGTGGTGGCGG - Intergenic
1112484771 13:99810433-99810455 AGAGAGGCTGTGGGTGGAGGGGG + Intronic
1113080977 13:106519420-106519442 TAAATGTGTGGGGGGGGAGGAGG + Intronic
1113118182 13:106896417-106896439 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1113412205 13:110100401-110100423 TCAGAGGCTGGAGGAGGAGGAGG - Intergenic
1113466523 13:110517310-110517332 TACTTTGCTGGGGTTGGAGGTGG + Intergenic
1113871833 13:113564623-113564645 GAAGTGGCTGTGGGTTGGGGAGG - Intergenic
1113873711 13:113581380-113581402 TTTGTGTCTGGGGGTGGTGGGGG + Intergenic
1114166095 14:20219911-20219933 CAAGCGGATGGGGCTGGAGGAGG + Intergenic
1114429456 14:22647964-22647986 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1114492418 14:23111706-23111728 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
1114551313 14:23534268-23534290 CAGGTGGCTGTGGGTGGAGAGGG + Exonic
1114683735 14:24508005-24508027 GCAGTGGGTGGGGGTGGGGGTGG + Intronic
1115160700 14:30390292-30390314 AATGAGGCTGGGGGTGGAAGGGG + Intergenic
1115223965 14:31084860-31084882 TCAGTAGATGGGGGTGGTGGAGG - Exonic
1115381402 14:32744464-32744486 GAATTGGCTGGGTGTGGTGGCGG - Intronic
1115406478 14:33022513-33022535 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1115629649 14:35231387-35231409 TGAGTGGCTGAGAGTGGAAGTGG + Intronic
1115781807 14:36777106-36777128 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1116347410 14:43812404-43812426 AAAGTAGCCGGGGGTGGTGGCGG - Intergenic
1116469906 14:45275072-45275094 AAAGGGGGTGGGGGTGGGGGCGG - Intergenic
1116525139 14:45894833-45894855 TAAGGGGCTGGGGGTGGTCGGGG + Intergenic
1117417351 14:55509413-55509435 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1117457136 14:55909702-55909724 TCTGGGGCTGGAGGTGGAGGTGG + Intergenic
1117723875 14:58653081-58653103 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1118011171 14:61612043-61612065 TAAGTGTGTGTGTGTGGAGGGGG - Intronic
1118189153 14:63564850-63564872 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1118277155 14:64395424-64395446 TGAGTGGGTGGGGGTGGGGGAGG + Intronic
1118357068 14:65023183-65023205 TGAGTAGCTGGGGCTAGAGGTGG + Intronic
1118595121 14:67429378-67429400 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1119081001 14:71693347-71693369 TAATTAGCTGGGTGTGGTGGCGG + Intronic
1119100149 14:71871959-71871981 AATGTGTATGGGGGTGGAGGGGG + Intergenic
1119244274 14:73090198-73090220 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1119339470 14:73864017-73864039 TGAGTAGCTGGGGTTGTAGGTGG + Intronic
1119667461 14:76495353-76495375 TAAGAAGCTGGAGGTGGAGGAGG + Intronic
1120008123 14:79382995-79383017 TGGGTGGGTGAGGGTGGAGGAGG + Intronic
1120126414 14:80749106-80749128 GAACTGCCTGGAGGTGGAGGAGG - Intronic
1120620910 14:86763260-86763282 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1120787322 14:88549746-88549768 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1120868026 14:89312133-89312155 AAAGTAGCTGGGTGTGGTGGCGG + Intronic
1121043547 14:90771031-90771053 CCAGTGGCTGGGGGTGGGAGGGG + Intronic
1121077358 14:91080518-91080540 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1121184647 14:91956092-91956114 AAATTTGCTGGGCGTGGAGGTGG - Intergenic
1121209091 14:92193261-92193283 AAAGTGACTGAGGGTGGAGTGGG + Intergenic
1121444532 14:93970146-93970168 TGAGGGGCTGGGGTGGGAGGTGG + Intronic
1121557818 14:94851530-94851552 TAATTAGCTGGGTGTGGCGGAGG - Intergenic
1121563251 14:94889760-94889782 TGTGTGCATGGGGGTGGAGGTGG + Intergenic
1121612678 14:95292450-95292472 CAAGATGCAGGGGGTGGAGGTGG - Intronic
1121616510 14:95317335-95317357 GAAGAGGCTGGGAGTGGAGATGG - Intronic
1121711896 14:96044646-96044668 GAAGGTGCTGGGGGTGGGGGTGG + Intronic
1121831435 14:97055703-97055725 CTAGGGGCTGGGGGTGCAGGGGG - Intergenic
1121923068 14:97901218-97901240 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1121966107 14:98307126-98307148 GAATTGGCTGGGTGTGGTGGTGG + Intergenic
1122018864 14:98819983-98820005 TGAATAGCTGGGGGTGGGGGAGG - Intergenic
1122202391 14:100130510-100130532 AAAGTGGCAGGGGGTGGAGGTGG - Intronic
1122308715 14:100781259-100781281 TGTGAGGCTGGGGGCGGAGGGGG + Intergenic
1122484236 14:102067380-102067402 AAAATAGCTGGGGGTGGTGGCGG - Intergenic
1122759118 14:104007925-104007947 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1123043542 14:105500244-105500266 TCAGAGGCTGCAGGTGGAGGAGG - Intergenic
1123955470 15:25330036-25330058 TTTGAGGGTGGGGGTGGAGGTGG + Intergenic
1123956647 15:25342805-25342827 TGAGGGGCAGGTGGTGGAGGGGG - Intronic
1124287661 15:28418040-28418062 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1124288182 15:28423741-28423763 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1124399625 15:29336871-29336893 CTGGTGGCTGGGGATGGAGGGGG - Intronic
1124447116 15:29746226-29746248 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1124951830 15:34330222-34330244 TAATTGGGATGGGGTGGAGGAGG - Intronic
1125053164 15:35325565-35325587 AAATCAGCTGGGGGTGGAGGAGG + Intronic
1125136957 15:36354535-36354557 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1125144461 15:36450775-36450797 AAAGTGACTGGGGGTGGATTAGG - Intergenic
1125204537 15:37138508-37138530 AAACTGGCTGGGCGTGGTGGTGG - Intergenic
1125211155 15:37216746-37216768 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1125447867 15:39777074-39777096 TAATTAGCTGGGCGTGGTGGCGG - Intronic
1125565854 15:40677762-40677784 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1125595403 15:40882265-40882287 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1125669663 15:41461637-41461659 AAATTGGCTGGGTGTGGTGGCGG - Intronic
1125703811 15:41713089-41713111 TAAGTTGGTGGTGGTGTAGGGGG + Intronic
1125734554 15:41914933-41914955 AAATTAGCTGGGCGTGGAGGTGG - Intronic
1125739100 15:41949218-41949240 AAAGTAGCTGGGCATGGAGGTGG + Intronic
1125888654 15:43249187-43249209 TAACTGCCTGGGGTTGGAAGTGG - Intronic
1125891992 15:43273904-43273926 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1125906018 15:43393357-43393379 AAACTGGCTGGGCGTGGTGGCGG - Intronic
1125929490 15:43590124-43590146 GGAGTGGCTGGGGCTGGGGGCGG - Intronic
1125942657 15:43689956-43689978 GGAGTGGCTGGGGCTGGGGGCGG - Intergenic
1126077536 15:44926558-44926580 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1126081176 15:44963958-44963980 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1126603895 15:50456421-50456443 TAAGTAGCTGGCCGTGGTGGTGG + Intronic
1126620103 15:50630009-50630031 AAATTAGCTGGGGGTGGTGGTGG - Intronic
1126855463 15:52834659-52834681 GAAGTGGGTGGAGGAGGAGGAGG + Intergenic
1126914301 15:53448484-53448506 TAAGTGGCAGGGGGGAGACGGGG - Intergenic
1127329265 15:57922825-57922847 AAAGTGGGCGGGTGTGGAGGGGG + Intergenic
1127642746 15:60931047-60931069 TAAATGGCAGGGGGAAGAGGGGG + Intronic
1127859896 15:62985251-62985273 GAGGTGCCTGGGGGTGGGGGTGG - Intergenic
1127867609 15:63044367-63044389 TACCTCCCTGGGGGTGGAGGTGG + Intronic
1127879289 15:63142291-63142313 AAAGTGGCTGGGCATGGTGGTGG - Intronic
1127885937 15:63201005-63201027 GGAGTGGCTGGGGGTGGGTGAGG + Intronic
1128158067 15:65404262-65404284 TGAGAGGCTGGGGGCAGAGGTGG - Intronic
1128172689 15:65526798-65526820 ACATTGGCTGGGGGTGGGGGTGG + Intergenic
1128206435 15:65856690-65856712 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1128213256 15:65916795-65916817 TAAGTGGCTGGGAGGCCAGGAGG + Intronic
1128427047 15:67552582-67552604 TAATTAGCTAGGTGTGGAGGTGG - Intronic
1128520475 15:68371566-68371588 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1128740036 15:70077546-70077568 TTAGTGGCCAAGGGTGGAGGGGG - Intronic
1128892722 15:71345188-71345210 CAAGTGGCGGGGGGTTGGGGGGG + Intronic
1128984056 15:72206571-72206593 CAAGAGGGTGGGGGTGGAAGTGG - Intronic
1129208896 15:74054121-74054143 TAGTGGGGTGGGGGTGGAGGAGG + Intergenic
1129343065 15:74898685-74898707 AAATTGGCTGGGCGTGGTGGTGG - Exonic
1129448409 15:75634891-75634913 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1129811295 15:78512549-78512571 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1129946510 15:79543298-79543320 CAGGGGGCTGTGGGTGGAGGAGG - Intergenic
1130021864 15:80238632-80238654 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1130052220 15:80493344-80493366 CAAGTGGCGGGGGGTGGGGGTGG + Intronic
1130553103 15:84904530-84904552 TCTGTGGTTGGGGGTGGAGGTGG - Intronic
1130584767 15:85172494-85172516 TAAGTGGATGGGGGGAAAGGGGG + Intergenic
1130662967 15:85845149-85845171 GATGTGGCTGGGGGAGGTGGCGG + Intergenic
1130672127 15:85921969-85921991 TAAGTTATTGGGGGTAGAGGTGG - Intergenic
1130858054 15:87858943-87858965 TAGTAGGGTGGGGGTGGAGGAGG + Intergenic
1131044925 15:89306540-89306562 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1131296049 15:91150150-91150172 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1131433048 15:92401803-92401825 TAAGAAGCTGGAGGAGGAGGAGG - Intronic
1131540076 15:93268417-93268439 AAAGTGGCTGTGGCTGGATGTGG + Intergenic
1131738562 15:95361370-95361392 ATAGTGGCTGGGGGGAGAGGAGG - Intergenic
1132117936 15:99151236-99151258 TGGGTGGCCTGGGGTGGAGGTGG - Intronic
1132151044 15:99459311-99459333 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
1132328336 15:100991016-100991038 GAAGTGGCAGAGGGTGGAGGTGG + Intronic
1132452133 15:101974233-101974255 TCAGGAGCTGGGGGTGGTGGTGG - Intergenic
1132454760 16:16388-16410 TCAGGAGCTGGGGGTGGTGGTGG + Exonic
1132484297 16:182263-182285 AAAATAGCTGGGGGTGGTGGCGG + Intergenic
1132695695 16:1200851-1200873 TAGCTGGCTGGGGGTGGGGTGGG + Intronic
1132734104 16:1377170-1377192 AAATTAGCTGGGGGTGGTGGAGG - Intronic
1132938420 16:2494260-2494282 AAACTGGCTGGGTGTGGTGGCGG + Intronic
1133128142 16:3659897-3659919 AAACTAGCTGGGGGTGGTGGTGG - Exonic
1133157328 16:3884329-3884351 TAAATGGCTGGGCATGGTGGGGG + Intergenic
1133162829 16:3923155-3923177 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1133200498 16:4201424-4201446 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1133293982 16:4741082-4741104 TAATTAGCTGGGTGTGGTGGCGG + Intronic
1133298926 16:4769805-4769827 TGATTAGCTTGGGGTGGAGGAGG + Intergenic
1133466684 16:6034183-6034205 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1133736749 16:8621777-8621799 TAAGTGCCTGGGAGAGGCGGCGG + Intronic
1133754069 16:8749235-8749257 AAATTAGCTGGGTGTGGAGGCGG - Intronic
1133767462 16:8848058-8848080 TAGGGGGCTGGGGGTGGGTGGGG - Exonic
1133843818 16:9435978-9436000 TCAGTCACTGGGGGTGGAAGTGG + Intergenic
1133894449 16:9912503-9912525 TAAGTGGGTGGGGTGGGGGGAGG + Intronic
1133937177 16:10278654-10278676 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1133941456 16:10312524-10312546 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1134101569 16:11456286-11456308 TAGGAGGCTGGGTGTGGGGGCGG - Intronic
1134292459 16:12913344-12913366 TAATTAGCTGGGCGTGGTGGTGG - Intronic
1134509654 16:14835515-14835537 TATGAGGGTGAGGGTGGAGGGGG - Intronic
1134652566 16:15921975-15921997 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1134685046 16:16152705-16152727 TAAGTGGCAGGGCGGGGCGGGGG + Intronic
1134697359 16:16234331-16234353 TATGAGGGTGAGGGTGGAGGGGG - Intronic
1134814151 16:17192246-17192268 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1134814752 16:17196688-17196710 AAAGTGGATGGGGGTGAAGAGGG - Intronic
1134974488 16:18560345-18560367 TATGAGGGTGAGGGTGGAGGGGG + Intronic
1135294256 16:21265454-21265476 ATAGAGGCTGGTGGTGGAGGTGG - Intronic
1135361139 16:21815805-21815827 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1135468897 16:22711968-22711990 TAAGTGGGTGGGGATGGGGAGGG + Intergenic
1135532128 16:23263882-23263904 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1135631564 16:24039611-24039633 TAGGCTGCTGGGGATGGAGGTGG + Intronic
1136153526 16:28367505-28367527 TAATTAGCTGGGGATGGTGGTGG + Intergenic
1136163093 16:28433984-28434006 AAATTAGCTGGGCGTGGAGGCGG + Intergenic
1136199872 16:28681004-28681026 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1136209560 16:28747762-28747784 TAATTAGCTGGGGATGGTGGTGG - Intergenic
1136216220 16:28795179-28795201 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1136261392 16:29079591-29079613 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1136400440 16:30014483-30014505 AAATTAGCTGGGCGTGGAGGCGG + Intronic
1136484144 16:30560465-30560487 AAGGTAGCTGGGGGTGGTGGTGG + Intergenic
1136548702 16:30970115-30970137 AAATTAGCTGGGGGTGGTGGTGG - Intronic
1137049250 16:35694049-35694071 AAAATGGCTGGGGTTGGTGGGGG + Intergenic
1137485485 16:48887175-48887197 TCAGGGGTTGGGGGTGGGGGTGG - Intergenic
1137713765 16:50585274-50585296 TACGTGGCTGGGGCAGGAGCTGG + Intronic
1137807246 16:51319141-51319163 TAATTAGCTGGGAGTGGTGGCGG + Intergenic
1137989394 16:53138015-53138037 TAAGTTCCTGGGGAAGGAGGGGG + Intronic
1138236104 16:55384132-55384154 TATGTGGGTGGGGATGGTGGAGG - Intergenic
1138543847 16:57705001-57705023 GAAGCGGCTGAGGGAGGAGGAGG + Exonic
1138641924 16:58394494-58394516 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1138669840 16:58604984-58605006 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1138862885 16:60779822-60779844 TAAGTGTGTGTGGGTGGAGATGG + Intergenic
1138945237 16:61841526-61841548 TAAGGGGCTGGGGAGGGAGTGGG + Intronic
1139110842 16:63888527-63888549 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1139368456 16:66448671-66448693 AAAGTAGCTGGGTGTGGTGGCGG + Intronic
1139405287 16:66712939-66712961 TATCTGCCTGGGGGTGGAGTGGG - Intergenic
1139591707 16:67936610-67936632 TTCCTGGCTGGGGGTGGGGGAGG - Intronic
1139605195 16:68013249-68013271 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1139823433 16:69738793-69738815 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1139953414 16:70682447-70682469 GAAGTTGCTAGGGGTGGAGGGGG + Intronic
1139962173 16:70724324-70724346 GAAGTGGCTGGAGATGGAGTGGG - Intronic
1140664612 16:77215890-77215912 AAATTAGCTGGGTGTGGAGGTGG - Intergenic
1140744849 16:77972465-77972487 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1141068883 16:80935429-80935451 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1141173329 16:81704441-81704463 TAAGTGGGTAGGGGAGGGGGAGG - Intronic
1141202810 16:81910722-81910744 TACGTGTCTGAGGGTGGAGCAGG + Intronic
1141490717 16:84370802-84370824 AAAGTGGCTGGGGGAGGGGAGGG - Intronic
1141506194 16:84480159-84480181 TCAGTGGCTGGGTGGGTAGGAGG + Intronic
1141580807 16:84997416-84997438 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1141595252 16:85093248-85093270 ACAGGGGCTGGGGGTGGGGGTGG + Exonic
1141615800 16:85208751-85208773 TTAGCGGATGGGGGTGGGGGTGG + Intergenic
1141635241 16:85310896-85310918 TCAGGGGCTGGGGATGGAGGGGG + Intergenic
1141703629 16:85653309-85653331 TAAGTGGGAGGAGGAGGAGGAGG - Intronic
1141947689 16:87321872-87321894 TAAATAGCTGGGTGTGGTGGTGG - Intronic
1142211045 16:88808575-88808597 AGTGTGGCTGGGGGTGAAGGGGG + Exonic
1142291083 16:89193844-89193866 GGGGTGGCTGGGGGTGCAGGCGG - Exonic
1142519900 17:497515-497537 TCAGTGGTTGGAGGTGGGGGTGG - Intergenic
1142651086 17:1352673-1352695 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1142729134 17:1839473-1839495 AAATTGGCTGGGTGTGGTGGCGG - Intronic
1142783381 17:2200069-2200091 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1142828976 17:2533318-2533340 GAACTGGCTGGGCGTGGTGGTGG + Intergenic
1142928074 17:3258697-3258719 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1142956711 17:3527746-3527768 TGGGTGGATGGGGGTGGAAGAGG + Intronic
1143032350 17:3974688-3974710 TAAGGTGCTGGGAGTGGATGTGG - Intergenic
1143093992 17:4467005-4467027 CATGTGGGTGGGGGTGGAGCGGG + Intronic
1143150332 17:4803869-4803891 AATGTGGCTGGGGATGGTGGCGG - Intergenic
1143283858 17:5774650-5774672 GTGGAGGCTGGGGGTGGAGGTGG - Intronic
1143365047 17:6401960-6401982 TAAATGGCTGGAGCAGGAGGAGG + Intronic
1143384647 17:6521260-6521282 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1143480260 17:7224080-7224102 GAATTGGGTGGGGGTAGAGGTGG + Intronic
1143555325 17:7656250-7656272 TGTGTGGCGGGGGGTGTAGGTGG - Exonic
1143591013 17:7885715-7885737 TAAGTCTCCGCGGGTGGAGGGGG - Intronic
1143845925 17:9772642-9772664 TCTGGGGATGGGGGTGGAGGAGG - Intronic
1143906654 17:10214581-10214603 GAAGAGGCTGGGCGTGGAGGGGG + Intergenic
1143986507 17:10919291-10919313 AAAGTGGCTGGGCGTGGTGGTGG - Intergenic
1144343598 17:14331296-14331318 GAAGGGGCTGGGGGTGGGGGTGG - Intronic
1144383626 17:14728108-14728130 AAACTGGGTAGGGGTGGAGGTGG - Intergenic
1144385139 17:14742419-14742441 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
1144620400 17:16815063-16815085 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1144627771 17:16853635-16853657 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1144696991 17:17311186-17311208 TAATTAGCTGGGTGTGGTGGTGG + Intronic
1144932023 17:18867279-18867301 TAGGCGGCTAGGGGTGGAGATGG + Exonic
1145092203 17:19995274-19995296 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1145300382 17:21630597-21630619 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1145815241 17:27790382-27790404 CAAGTGGCTGGGGCTGGGCGCGG - Intronic
1145871239 17:28275164-28275186 ACAGGCGCTGGGGGTGGAGGTGG + Intergenic
1145954528 17:28845427-28845449 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1145968017 17:28934748-28934770 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1145970750 17:28955175-28955197 CAAGTGGCTGGAATTGGAGGAGG + Exonic
1146125291 17:30226548-30226570 AAAGTAGCTGGGTGTGGTGGCGG + Intronic
1146207756 17:30919894-30919916 AAAATGGCTGGGTGTGGTGGTGG - Intronic
1146233656 17:31136372-31136394 TAAGTGGTTGTGGGGGGAGCGGG - Intronic
1146323883 17:31868959-31868981 AAATTGGCTGGGTGTGGTGGTGG + Intronic
1146818111 17:35961034-35961056 TGGGAGGCTGGGGGTGGGGGCGG + Intergenic
1147160140 17:38564740-38564762 TCAGAGGGTGGGGGTGGGGGTGG + Intronic
1147160214 17:38565097-38565119 TATCTGGCTGGGGGTGGGGGAGG + Intronic
1147186989 17:38718223-38718245 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1147543744 17:41382276-41382298 TAAGCTGCTGGAGGTGGATGTGG + Exonic
1147753016 17:42748771-42748793 TAACTGCCTGGGGGTGGGGCCGG - Intergenic
1147917591 17:43898081-43898103 TGAGTGGCTGCAGGTAGAGGGGG - Intronic
1147940334 17:44042547-44042569 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1147947241 17:44086963-44086985 TAAGAGGCTGGGAGGGGTGGGGG + Intronic
1147966279 17:44195961-44195983 TCATTGCCGGGGGGTGGAGGTGG - Intronic
1147973486 17:44233845-44233867 TAATTGGCTGGGTGTGGTGGTGG + Intergenic
1147992582 17:44344113-44344135 TAACTGGCAGGTGGAGGAGGAGG - Intergenic
1148142455 17:45338405-45338427 TCAGTGGCTGGGGGAGGAGTGGG - Intergenic
1148174671 17:45553272-45553294 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1148203784 17:45766905-45766927 TAGGTGGCTGGGAGTGGGGAAGG + Intergenic
1148231401 17:45937439-45937461 TAATTAGCTGGGTGTGGTGGTGG + Intronic
1148239791 17:45992739-45992761 TAATTAGCTGGGCGTGGTGGCGG + Intronic
1148274594 17:46292180-46292202 AAATTGGCTGGGTGTGGTGGTGG + Intronic
1148296700 17:46509755-46509777 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1148349698 17:46931652-46931674 ACAGGCGCTGGGGGTGGAGGTGG - Intronic
1148610041 17:48959002-48959024 AAATTAGCTGGGCGTGGAGGCGG - Intronic
1148801906 17:50233154-50233176 TAACTAGCTGGGCGTGGTGGTGG + Intergenic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1148869852 17:50650913-50650935 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1148876783 17:50692396-50692418 TGAGTGGCTGTGGGTGATGGTGG + Intergenic
1149318192 17:55458562-55458584 TACGGGGCGGGGGGTGGGGGTGG - Intergenic
1149356997 17:55849471-55849493 TAAATGGCTGGGGGTGGTGGCGG + Intergenic
1149505283 17:57189099-57189121 TTACTGGCTGTGGCTGGAGGTGG - Intergenic
1149695440 17:58612583-58612605 AAATTGGCTGGGTGTGGTGGGGG + Intronic
1149715316 17:58783855-58783877 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1149764776 17:59266043-59266065 TGGGTGGCGGGGGGTGGGGGTGG + Intronic
1149776149 17:59358757-59358779 AAATTAGCTGGGCGTGGAGGCGG - Intronic
1149875326 17:60226892-60226914 AAATTAGCTGGGGGTGGTGGAGG + Intronic
1150238566 17:63613311-63613333 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1150240839 17:63631202-63631224 TTTGAGCCTGGGGGTGGAGGAGG + Intronic
1150257527 17:63759912-63759934 AAATTGGCTGGGAGTGGTGGCGG + Intronic
1150285720 17:63952756-63952778 AAAGTGGGTGGGGGTGCTGGGGG - Intronic
1150366382 17:64589858-64589880 GACCAGGCTGGGGGTGGAGGTGG - Intronic
1150405889 17:64900183-64900205 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1150414775 17:64977920-64977942 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1150587533 17:66532298-66532320 TCAGTGGGTGGGGGTGGGGGGGG - Intronic
1150654257 17:67029482-67029504 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1150693370 17:67383539-67383561 CGAGTGGCTGCGGGAGGAGGTGG - Intronic
1150757962 17:67933101-67933123 AAATTAGCTGGGTGTGGAGGTGG + Intronic
1150855018 17:68744275-68744297 AAAGTGGTGAGGGGTGGAGGTGG + Intergenic
1150914781 17:69425460-69425482 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1151312222 17:73300286-73300308 TTGGAGGCTGGGGGTGGTGGGGG - Intronic
1151313607 17:73309196-73309218 AAAATGGCTGGGCGTGGTGGTGG + Intronic
1151365437 17:73613593-73613615 GAGGGGGCTGGGGGTGGGGGTGG - Intronic
1151402319 17:73863898-73863920 TACCTGGCTGGGGGTGCAGGAGG - Intergenic
1151447334 17:74175869-74175891 TAAGTGTGTCTGGGTGGAGGTGG - Intergenic
1151448022 17:74179904-74179926 TAAGTGGTTGATGGTGGTGGTGG - Intergenic
1151512004 17:74566504-74566526 AAAGATGGTGGGGGTGGAGGTGG - Intergenic
1151562304 17:74877174-74877196 GAGGGGGCTGGGGCTGGAGGGGG - Intergenic
1151562519 17:74878226-74878248 TCAGTGGCTGGTGGTGGACCTGG - Exonic
1151580375 17:74974185-74974207 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1151629735 17:75302296-75302318 AAATTGGCTGGGCGTGGCGGTGG + Intergenic
1151655687 17:75494984-75495006 TGCGTGGCTGGGGCTGGAGGGGG - Exonic
1151704783 17:75761465-75761487 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1151722569 17:75865870-75865892 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1151797895 17:76358678-76358700 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1151877107 17:76873069-76873091 TAGGTGGATGTGAGTGGAGGGGG + Intronic
1151953905 17:77371201-77371223 GCAGTGGCTGGGGCTGGAGCCGG + Intronic
1152002720 17:77656365-77656387 CCAGGAGCTGGGGGTGGAGGTGG + Intergenic
1152024742 17:77801587-77801609 TATGTGGGTGGGGCTGGGGGTGG - Intergenic
1152028488 17:77826918-77826940 GAAGCGGCGGGGGGTGGGGGTGG - Intergenic
1152106404 17:78331859-78331881 TAATTAGCTGGGCGTGGTGGTGG + Intergenic
1152206834 17:78978690-78978712 GAAGTGGCTGGGGGCAGAAGTGG - Intronic
1152301163 17:79495817-79495839 AAGGTGGTTGGGGGTGTAGGCGG + Intronic
1152316663 17:79584913-79584935 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1152349018 17:79772926-79772948 AAGGTGGATGGTGGTGGAGGAGG + Intergenic
1152361796 17:79836271-79836293 TTAGGGGCTGGGGGCGGGGGCGG + Intronic
1152364966 17:79850206-79850228 CACGTGGCTGAGGGCGGAGGAGG + Intergenic
1152431675 17:80251793-80251815 AAAGTGGACTGGGGTGGAGGTGG - Intronic
1152437004 17:80282546-80282568 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1152444717 17:80335069-80335091 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1152447843 17:80356149-80356171 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1152460626 17:80440302-80440324 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
1152863995 17:82711479-82711501 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1152894200 17:82901343-82901365 TAGGTGCCTGTGGGTGGAGGTGG + Intronic
1153033691 18:738538-738560 AGATTGGCTGGGGGTGGTGGTGG + Intronic
1153361713 18:4205343-4205365 TAAGTGGATGGGATAGGAGGGGG + Intronic
1153675141 18:7450533-7450555 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1153679760 18:7489582-7489604 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
1153762031 18:8340815-8340837 GAACTGGGTTGGGGTGGAGGTGG - Intronic
1153801902 18:8678428-8678450 AAATTAGCTGGGCGTGGAGGTGG + Intergenic
1153996859 18:10450330-10450352 GAAGTGGCTTAGGGTGGTGGTGG + Intergenic
1154204673 18:12326776-12326798 AAGGTGGCTGCGGATGGAGGAGG - Intronic
1154336125 18:13466318-13466340 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1154488248 18:14896279-14896301 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1154945730 18:21159719-21159741 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1154957887 18:21277076-21277098 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1154994536 18:21627117-21627139 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1155003058 18:21704883-21704905 TGAGTGGCTGGCAGTGGGGGCGG - Intergenic
1155031801 18:21991349-21991371 CTTGTGGTTGGGGGTGGAGGTGG + Intergenic
1155039798 18:22055424-22055446 TAATTAGCTGGGTGTGGTGGCGG + Intergenic
1155041067 18:22066075-22066097 TAGGTGGGGTGGGGTGGAGGAGG - Intergenic
1155083751 18:22435112-22435134 TAAGTGGGTGGGGGTGAGGCGGG + Intergenic
1155170084 18:23260603-23260625 TAAGTGGGTGGGGTGGGGGGAGG + Intronic
1156045903 18:32877056-32877078 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1156100731 18:33591789-33591811 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1156169027 18:34459639-34459661 AAAGTGACTGGGATTGGAGGTGG + Intergenic
1156325534 18:36071507-36071529 CAAGGGGCTGGGGGCGGGGGGGG + Intergenic
1156398279 18:36718362-36718384 AAGGTGGGTGGGGGTGGGGGAGG - Exonic
1156460360 18:37318277-37318299 TAAGCGGCAGGAGGAGGAGGGGG - Intronic
1156480200 18:37431515-37431537 TAATTAGCTGGGCGTGGTGGCGG - Intronic
1156493695 18:37511926-37511948 TCAGCGGCTGGGGCTGGGGGTGG + Intronic
1156671065 18:39470306-39470328 TAATTAGCTGGGTGTGGTGGTGG - Intergenic
1156914900 18:42454237-42454259 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
1157007039 18:43595476-43595498 AAATTAGCTGGGCGTGGAGGTGG - Intergenic
1157331996 18:46710891-46710913 TCAGTGTCTGGGGGTGGGGATGG - Intronic
1157335334 18:46733619-46733641 TAAGGGGCTTGGGGTGGGGGAGG + Intronic
1157367494 18:47079107-47079129 GAAGTGGCAGGGGGTGGTGCTGG - Intronic
1157516693 18:48316352-48316374 CTAGGGGCTGGGGGTGGAGGAGG - Intronic
1157546755 18:48551945-48551967 TAATTAGCTGGGCGTGGTGGCGG - Intronic
1157553703 18:48598860-48598882 AAAAAGGCTGGGGTTGGAGGTGG - Intronic
1157754548 18:50206257-50206279 GAAATGGCTGGGGCTGGTGGAGG - Intergenic
1157760394 18:50259459-50259481 TGGGGGGTTGGGGGTGGAGGTGG + Intronic
1157793983 18:50559051-50559073 TTAGGGTCTGGGGGTAGAGGTGG + Intergenic
1157862681 18:51154876-51154898 AACGTGGCTGGGGGCAGAGGAGG - Intergenic
1157986917 18:52448596-52448618 TAGGTGGGTGGTGGTGGAAGAGG + Intronic
1158137911 18:54225976-54225998 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1158144905 18:54301127-54301149 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1158356174 18:56621848-56621870 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
1158455799 18:57606197-57606219 CAATTAGCTGGGGGTGGTGGTGG + Intronic
1158524240 18:58197922-58197944 CCAGTGGGTGGGGGTGGGGGTGG + Intronic
1158585766 18:58733058-58733080 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1158654872 18:59321544-59321566 AAAGTTGGTGGGGGTGGGGGTGG - Intergenic
1158922351 18:62207148-62207170 TTAGTGATTGGGGGTTGAGGGGG - Intronic
1159002268 18:62984875-62984897 AAAATGGCTTGGTGTGGAGGTGG + Intergenic
1159032664 18:63247346-63247368 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1159425867 18:68285410-68285432 TTATTAGCTGGGGGTGGTGGCGG - Intergenic
1159548484 18:69870422-69870444 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1159967061 18:74605209-74605231 TAAGTAGCTGGGGGTGAAGGAGG - Intronic
1160199165 18:76781901-76781923 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1160579060 18:79873424-79873446 GAGGTGGCTGGGGGGGGGGGAGG - Intronic
1160610730 18:80083038-80083060 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1160743881 19:701307-701329 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1160744057 19:702274-702296 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1160834601 19:1118720-1118742 AAATTAGCTGGGTGTGGAGGCGG + Intronic
1160849322 19:1182540-1182562 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1160971335 19:1769051-1769073 GGAGTTGCTGGAGGTGGAGGTGG + Intronic
1161033137 19:2068911-2068933 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1161227505 19:3153882-3153904 TGAGTGGATGGGGGTGTGGGTGG + Intronic
1161248092 19:3265954-3265976 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1161248481 19:3268146-3268168 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1161381038 19:3965007-3965029 GGAGTGAGTGGGGGTGGAGGAGG + Intronic
1161417641 19:4156649-4156671 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1161443934 19:4307515-4307537 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1161696480 19:5771396-5771418 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1161923757 19:7285801-7285823 TCTGTGGTTAGGGGTGGAGGTGG + Intronic
1161953313 19:7479332-7479354 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1162239218 19:9335312-9335334 TAATTGGCCGGGTGTGGTGGTGG + Intronic
1162240299 19:9347409-9347431 AAATTAGCTGGGGGTGGAGGCGG - Intronic
1162396013 19:10418499-10418521 TGAGTAGATGGGGGTGGGGGTGG - Intronic
1162464476 19:10831716-10831738 TATGTGGGTGGTGGTGGCGGGGG + Exonic
1162529468 19:11227596-11227618 TGAAGGGCTGTGGGTGGAGGAGG + Intronic
1162572459 19:11481055-11481077 TAAAGGGCTGGGGGCGGCGGCGG - Intronic
1162713486 19:12613429-12613451 AAATTAGCTGGGCGTGGAGGCGG + Intronic
1162767956 19:12931411-12931433 AAATTAGCTGGGGGTGGTGGTGG - Intronic
1162830014 19:13278551-13278573 TAAGTGGCCGGGGGTGTGGTGGG - Intronic
1162865630 19:13544094-13544116 GGAGTGGATGGGGGTGGAGGAGG + Intronic
1162930395 19:13954508-13954530 TATGTCTGTGGGGGTGGAGGGGG - Exonic
1162949438 19:14061916-14061938 TAAGTGTCTGGGGGGTCAGGGGG - Intergenic
1162967221 19:14161614-14161636 GAAGTGGCTGGGCCTGGAGAGGG + Exonic
1163036567 19:14572607-14572629 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1163213462 19:15858740-15858762 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
1163351945 19:16782486-16782508 AAAATGGGTGGGGGTGGAGAAGG + Intronic
1163398169 19:17076059-17076081 AAAGTGGATGGGGATGGAGCTGG + Intronic
1163528368 19:17835059-17835081 TAAGTTCCTGGAGGTGGAGGAGG - Intronic
1163683222 19:18695713-18695735 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1164051301 19:21587198-21587220 CATGGGGCTGGGGTTGGAGGCGG + Intergenic
1164084671 19:21890097-21890119 AAAGTGGTGGGGGGTGGGGGGGG - Intergenic
1164254738 19:23517506-23517528 CAAGTGGCCGGGGGTGGGGGGGG + Intergenic
1164733649 19:30524699-30524721 TGTTTGGGTGGGGGTGGAGGAGG - Intronic
1164774723 19:30844043-30844065 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1164851750 19:31489897-31489919 TCATTTGCTGGGGGTGGAGGGGG + Intergenic
1164944946 19:32285642-32285664 TGCGGGGCTGGGGGCGGAGGCGG + Intergenic
1165225389 19:34351293-34351315 GGAGGAGCTGGGGGTGGAGGTGG - Intronic
1165343658 19:35229514-35229536 TAAATAGCTGGGTGTGGTGGCGG + Intergenic
1165359237 19:35324608-35324630 TAATTAGCTGGGCGTGGTGGCGG + Intronic
1165362798 19:35347009-35347031 CAAGCAGCTGGGGGTGGAGATGG - Exonic
1165420835 19:35721202-35721224 GGAGGGGCTGGGGGAGGAGGGGG - Exonic
1165421478 19:35724114-35724136 AAGGTGGCTGAGGGCGGAGGAGG + Intronic
1165583160 19:36887011-36887033 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1165898334 19:39156432-39156454 TAGGTGCCAGGGGCTGGAGGGGG - Intronic
1166098059 19:40554110-40554132 TAAGGGGATGTGGGTGGAGAGGG - Intronic
1166113741 19:40640079-40640101 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1166318690 19:42003307-42003329 GAGGAGGCTGGGGGTGGGGGTGG - Intronic
1166517086 19:43455226-43455248 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1166732067 19:45064634-45064656 TGTGTGGCTGGGCGTGGAGGTGG + Intronic
1166771177 19:45283450-45283472 TTAGTAGCTGAGGGTGGAAGGGG - Intronic
1166789457 19:45389941-45389963 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1166790068 19:45393721-45393743 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1166839621 19:45688883-45688905 AAATTAGCTGGGCGTGGAGGTGG - Intronic
1166848909 19:45748225-45748247 TAATTGGCCGGGCGTGGTGGCGG - Intronic
1166855634 19:45781525-45781547 TTTGGGGCTGGGGGTGGGGGTGG + Intronic
1166943617 19:46383908-46383930 GCTGCGGCTGGGGGTGGAGGTGG - Intronic
1167025692 19:46916082-46916104 AAATTAGCTGGGTGTGGAGGTGG - Intergenic
1167045868 19:47048383-47048405 TCGGTGGCTAGGGGTGGGGGCGG - Intronic
1167072235 19:47227971-47227993 ACGGAGGCTGGGGGTGGAGGGGG - Intronic
1167140338 19:47646172-47646194 GATCTGGCAGGGGGTGGAGGAGG + Intronic
1167237433 19:48323342-48323364 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1167270143 19:48501848-48501870 GAGGTGGCTGGGAGAGGAGGGGG - Intronic
1167482266 19:49740220-49740242 GACTGGGCTGGGGGTGGAGGGGG + Intronic
1167624706 19:50579861-50579883 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1167646926 19:50710977-50710999 GGAGTGGCTGGGGGTGAAGGTGG - Intronic
1167698591 19:51029269-51029291 TTAAGGGGTGGGGGTGGAGGTGG + Intronic
1168070811 19:53950381-53950403 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1168101921 19:54145925-54145947 GCTGTGGCTGGGGGGGGAGGTGG - Exonic
1168141715 19:54392472-54392494 TGGGTGGTGGGGGGTGGAGGCGG + Intergenic
1168159039 19:54496399-54496421 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1168330026 19:55562762-55562784 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1168383755 19:55945729-55945751 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1168413463 19:56154587-56154609 TAGGTGGTTGGGGGTGGGGGTGG - Intronic
1168704904 19:58464872-58464894 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
925146594 2:1586937-1586959 TAAGGGGGTGGGGGAGGAGCTGG - Intergenic
925444363 2:3915206-3915228 TGGGTGACTTGGGGTGGAGGTGG + Intergenic
925610131 2:5695898-5695920 GAAGAGGCAGGGAGTGGAGGAGG - Exonic
925804087 2:7631325-7631347 TAAGAGGCTGGGCATGGATGGGG - Intergenic
925855064 2:8121477-8121499 CAAGGGGCTGTGGGTGGAGAGGG + Intergenic
925896852 2:8478866-8478888 GTATTGGCTGGGGGTGGAGGTGG - Intergenic
926060894 2:9804105-9804127 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
926076508 2:9947502-9947524 TTAGGGGCTGGGAATGGAGGAGG + Intergenic
926098819 2:10100375-10100397 TATGTGGGGGGGGGTTGAGGGGG - Intergenic
926153333 2:10436463-10436485 TCAGTGCCTGGGGGTGAGGGGGG - Intergenic
926163208 2:10502358-10502380 TCAGGTGTTGGGGGTGGAGGGGG - Intergenic
926196569 2:10767605-10767627 AAAGTGGCTGGGCTTGGTGGTGG - Intronic
926205619 2:10832918-10832940 TCAGTGGCTGGGGGGGCGGGGGG - Intronic
926206246 2:10835899-10835921 TAATTAGCTGGGCGTGGTGGCGG + Intronic
926240052 2:11078509-11078531 CCAGGGGCTGGGGGTGGAGGAGG + Intergenic
926282293 2:11459732-11459754 AAATTAGCTGGGGGTGGTGGTGG + Intronic
926661769 2:15474708-15474730 AAATTGGCTGGGCGTGGTGGCGG - Intronic
926718833 2:15943530-15943552 TGAAAGGCTGGGGGTGGTGGGGG + Intronic
926769364 2:16354865-16354887 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
927559653 2:24060993-24061015 TGAGTGGGTGAAGGTGGAGGTGG - Intronic
927667613 2:25042951-25042973 TGAGGGGATGGCGGTGGAGGCGG - Intronic
927698362 2:25252295-25252317 GATGGGGCTGGGGGCGGAGGGGG + Intronic
927721872 2:25388257-25388279 ACAGTGGGTGGGGGTGGAGCCGG + Exonic
927753676 2:25691838-25691860 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
927769639 2:25848471-25848493 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
927842798 2:26456133-26456155 CAAGAGGCTGGGGGAGGAAGAGG + Intronic
928005800 2:27560605-27560627 AAATTAGCTGGGTGTGGAGGCGG - Intronic
928518357 2:32064252-32064274 TAGGGGGCTGGGGGAGGGGGCGG + Intronic
928684612 2:33735730-33735752 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
928705060 2:33940775-33940797 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
929149847 2:38737764-38737786 TAGGAGGCTGAGGCTGGAGGGGG - Intronic
929394504 2:41507408-41507430 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
929479734 2:42293757-42293779 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
929544442 2:42846510-42846532 AAATTAGCTGGGCGTGGAGGTGG - Intergenic
929986791 2:46742342-46742364 TAAGAAGGTGGGGGTGGGGGTGG - Intronic
929992745 2:46803377-46803399 TGAGAGGGTGGGGGTGGGGGTGG + Intergenic
930046406 2:47176518-47176540 TGAGGCGCTGGGGGCGGAGGAGG - Exonic
930508696 2:52317461-52317483 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
930594211 2:53366091-53366113 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
930702049 2:54468155-54468177 AAATTGGCTGGGTGTGGTGGTGG + Intronic
930804210 2:55473912-55473934 TCAGAGGCTGTGGGTAGAGGAGG + Intergenic
930919197 2:56730817-56730839 TGAGAGGCTGGGGGTGGGGGCGG + Intergenic
930938838 2:56988820-56988842 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
930976776 2:57472378-57472400 TACGTTGCTGGGGTTGGGGGTGG - Intergenic
931311521 2:61085658-61085680 AAATTGGCTGGGTGTGGTGGTGG - Intronic
931447960 2:62342856-62342878 AAACTGGCTGGGGGTAGTGGTGG - Intergenic
931665646 2:64608267-64608289 TAAGTGGCAGAGGGTGGAGCGGG - Intergenic
931858368 2:66328006-66328028 AAAGAGGCTGTGGGTGCAGGCGG - Intergenic
932066926 2:68573521-68573543 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
932078319 2:68687689-68687711 AAATTGGCTGGGCGTGGTGGTGG - Intronic
932214567 2:69958558-69958580 TAAGTGGGTGGGTGGGGAGCTGG - Intergenic
932342784 2:70977089-70977111 GAGGTGGGTGGGGGTGGGGGCGG + Intronic
932441490 2:71739055-71739077 TCAGAGGGTGGGGGTGGAGTGGG - Intergenic
932476444 2:72009308-72009330 GTAGTGGCTGGGGTGGGAGGAGG - Intergenic
932493247 2:72134357-72134379 GAAAAGGCTGGGGGTGGGGGAGG + Intronic
932570389 2:72935467-72935489 TGAGGGGCAGGGGGTGGAGCAGG - Intronic
932650596 2:73551582-73551604 AAATTAGCTGGGTGTGGAGGCGG - Intronic
933005528 2:76988744-76988766 GGGGTGGGTGGGGGTGGAGGAGG - Intronic
933101707 2:78267962-78267984 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
933115816 2:78469964-78469986 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
933228249 2:79775792-79775814 TATTTAGCTGGTGGTGGAGGTGG - Intronic
933967343 2:87440775-87440797 TCAGGGGCTGGGGGGGGAGGTGG - Intergenic
934124530 2:88874100-88874122 TAATTGGATGAGGGGGGAGGCGG + Intergenic
934257875 2:91442944-91442966 AAAGCGGCTGCGGGGGGAGGGGG - Intergenic
934475170 2:94588665-94588687 TGAGTGGGTGGGTGGGGAGGAGG - Intronic
934525922 2:95051572-95051594 CAAGTGGCTGGGTGTAGATGTGG + Intronic
934544518 2:95203671-95203693 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
934688551 2:96339440-96339462 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
934781220 2:96970957-96970979 CAGGTGGCTGGGGGTGGGGATGG - Intronic
934853749 2:97716710-97716732 TGAGTGGCGGGGGGTGGTGATGG + Intronic
935228286 2:101073442-101073464 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
935272463 2:101446794-101446816 TAGGTGCCAGGGGGTGGGGGTGG + Intronic
935519955 2:104092421-104092443 AAAGTGGGTGGGGGTGGGCGGGG + Intergenic
935596224 2:104880184-104880206 TATGTGGTGGGGGGCGGAGGCGG - Intergenic
935726861 2:106031052-106031074 CAGCTGGCTGGGGGTGGAGTGGG - Intergenic
935804875 2:106735408-106735430 TAAGCGGCTGGAGGTGCAGAGGG - Intergenic
936096743 2:109536038-109536060 GCAGTGGGTGGGGGTGGGGGGGG + Intergenic
936278009 2:111117363-111117385 TAAGGGGGTGGGCGTGGACGTGG - Intronic
936568350 2:113596709-113596731 TCAGGAGCTGGGGGTGGTGGTGG - Intergenic
937077577 2:119118125-119118147 AAAGGGGCTGGGGGTGGGGCTGG - Intergenic
937132254 2:119522751-119522773 TCCGTGGCTGGGGGTGGGAGAGG - Intronic
937154705 2:119710756-119710778 AAAATAGCTGGGGGTGGTGGGGG - Intergenic
937194237 2:120136078-120136100 TAAAAAGCTGGGGGTGGGGGTGG + Intronic
937310796 2:120902187-120902209 CAAGGGGTTGGGGGTGGGGGGGG - Intronic
937446706 2:121964507-121964529 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
937675840 2:124589195-124589217 GCAGGGGCTGGGGGTGGTGGAGG - Intronic
938343698 2:130551459-130551481 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
938346135 2:130569263-130569285 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
938376459 2:130810308-130810330 TTATTGGCGGGGGGCGGAGGCGG - Intergenic
938407825 2:131042443-131042465 CAAGTGGGGGTGGGTGGAGGGGG - Intronic
938530551 2:132181322-132181344 AAATTGGCTGGGCGTGGTGGTGG + Intronic
938539768 2:132276184-132276206 TGGGAGGCTGGGGGTGGGGGTGG + Intergenic
938762956 2:134441917-134441939 TAAGTGCCCTGGGGTGGGGGTGG + Intronic
938820579 2:134954454-134954476 TATGTGACAGGGGGAGGAGGGGG - Exonic
938853922 2:135290667-135290689 CAATGGGGTGGGGGTGGAGGGGG - Intronic
939105323 2:137942188-137942210 CAGGAGGCTGGGGGTGGAGAGGG + Intergenic
939275547 2:139992655-139992677 TCAGTGGCTGGGGTTCCAGGTGG + Intergenic
939520154 2:143220289-143220311 TGGATGGATGGGGGTGGAGGAGG - Intronic
940144498 2:150532030-150532052 CTAGTGGCTGGGGTTGGTGGGGG + Intronic
940220060 2:151342520-151342542 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
940252389 2:151693418-151693440 TTGGAGGCTGGGGGTGGGGGAGG - Intronic
940328842 2:152453206-152453228 TCAGGGGGTGGGGGTGGGGGTGG + Intronic
940578883 2:155550591-155550613 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
941034015 2:160546669-160546691 TCAGAGGCTGAGGGTGGAGTAGG - Intergenic
941697991 2:168573745-168573767 TGGGTGGCTGGGGGTGGAGCAGG + Intronic
941954109 2:171186906-171186928 AAATTGGCTGGGCGTGGTGGCGG + Intronic
942081406 2:172402699-172402721 TAAGAGGCTCTGAGTGGAGGCGG - Intergenic
942174837 2:173323366-173323388 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
942304497 2:174592492-174592514 TTATTTGCTGGGGGTGGGGGAGG + Intronic
942546443 2:177069348-177069370 AAAATTGTTGGGGGTGGAGGAGG - Intergenic
942947586 2:181686348-181686370 TAAGTGTGTGGTGGGGGAGGGGG - Intergenic
943043426 2:182829829-182829851 TAAGTGTGTGGGGAGGGAGGTGG + Intergenic
943433549 2:187834258-187834280 AAATTAGCTGGGCGTGGAGGTGG - Intergenic
943489481 2:188532769-188532791 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
943575619 2:189627504-189627526 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
943607039 2:189987992-189988014 TAGGTGGATGGGGGTGGTGGCGG + Intronic
943653909 2:190487189-190487211 AAATTAGCTGGGGGTGGTGGCGG + Intronic
943745436 2:191457015-191457037 TTGGTGGGTGGGGGTGGGGGAGG - Intergenic
944003085 2:194865780-194865802 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
944274415 2:197819255-197819277 TTAGTGGCTAGGGCTGGGGGTGG - Intronic
944576410 2:201095204-201095226 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
944679179 2:202061381-202061403 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
944770198 2:202906380-202906402 TTATTGGCTTGGGGTGGGGGAGG - Intronic
944845095 2:203660119-203660141 TAAATGGGTGGGGGTGGGGTGGG + Intergenic
944851421 2:203723335-203723357 AAATTAGCTGGGGGTGGTGGTGG + Intronic
945079279 2:206072423-206072445 AAATTGGCTGGGCGTGGTGGCGG - Intronic
945190631 2:207184090-207184112 AAAGTCGCTGGGTGTGGTGGTGG + Intergenic
945239083 2:207660099-207660121 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
945453201 2:210017409-210017431 TATGTTGGTGGGGGTGGGGGTGG - Intronic
945802567 2:214451294-214451316 TAAGTGGGTCGGTGTGGGGGGGG + Intronic
946192750 2:218016124-218016146 GGAGCGGCTGGGGGTGGGGGTGG - Intergenic
946265288 2:218535703-218535725 TAATTAGCTGGGCGTGGTGGCGG + Intronic
946345427 2:219106294-219106316 TAATTGACTTGGGGTGGGGGAGG + Intronic
946686688 2:222278284-222278306 GCTGTGGCTGGGGGTGGGGGAGG - Intronic
946827075 2:223690091-223690113 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
946939461 2:224755880-224755902 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
946954768 2:224917253-224917275 AAATTAGCTGGGGGTGGTGGTGG - Intronic
947015687 2:225617277-225617299 TAAAAAGCTGGGTGTGGAGGTGG + Intronic
947105525 2:226664247-226664269 GAAGTGGCTGGAGGAAGAGGTGG - Intergenic
947118339 2:226795116-226795138 TGAGGGGGTGGGGGTGGGGGAGG + Exonic
947150249 2:227108122-227108144 TGAGTGGCAGGGGGAGGAGACGG + Intronic
947380807 2:229543688-229543710 CCACTGGCAGGGGGTGGAGGAGG - Intronic
947619267 2:231578183-231578205 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
947626361 2:231621585-231621607 TCAGTGTCTGGGGGTGGGGCGGG - Intergenic
947631533 2:231656566-231656588 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
947920583 2:233867938-233867960 AAAGTGGTTGGGCGTGGTGGCGG - Intergenic
948129751 2:235591848-235591870 GAAGTGGTGGGGGGTGGGGGTGG - Intronic
948249222 2:236512150-236512172 TTAGGGGCGGGGGGTGCAGGTGG - Intergenic
948484789 2:238273643-238273665 TAATTAGCTGGGTGTGGTGGCGG - Intronic
948814838 2:240504855-240504877 AAATTGGCTGGGTGTGGTGGTGG + Intronic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
948941133 2:241197247-241197269 AAATTGGCTGGGCGTGGTGGTGG - Intronic
948958730 2:241315678-241315700 ATAGAGGCTGGGGGTGGGGGGGG - Intronic
949014064 2:241699673-241699695 GATGTGGCTGGGGGTGGGGCGGG + Intergenic
949047614 2:241879304-241879326 TAAGTGTCTGGGGGTGGGGTAGG + Intergenic
1168757198 20:325853-325875 TCCGCGGCTGGGGGTGGGGGAGG - Exonic
1168766638 20:386005-386027 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1168822015 20:780490-780512 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1168960435 20:1865466-1865488 AAAGGGGCTGGGGGTTGGGGTGG + Intergenic
1169025450 20:2366922-2366944 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
1169032585 20:2421980-2422002 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1169092451 20:2869816-2869838 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1169211012 20:3766439-3766461 TGAGGTGCTGGGGGTGGGGGTGG + Intronic
1169216048 20:3795546-3795568 TCCGCGGCTGGGGGTCGAGGAGG - Intronic
1169867676 20:10218426-10218448 AAAGGGGGTGGGGGTGGGGGTGG + Intergenic
1169998927 20:11593132-11593154 TGAGTGGGGTGGGGTGGAGGGGG - Intergenic
1170157567 20:13282543-13282565 TAGGAGGCTGGGGGTGAGGGTGG - Intronic
1170608405 20:17891297-17891319 CAATTGGCTGGGTGTGGTGGCGG + Intergenic
1170764822 20:19280834-19280856 AGAGTGGCTGGGGGTGCAGGCGG + Intronic
1170851084 20:20005041-20005063 GAGGTGGTTGGGGGTGGAGATGG + Intergenic
1170884226 20:20325137-20325159 TAAGTGGCTGGGGGTGGAGGAGG - Intronic
1171962152 20:31502652-31502674 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
1172017516 20:31886667-31886689 AAATTGGCTGGGTGTGGTGGTGG + Intronic
1172077235 20:32308558-32308580 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1172107848 20:32527431-32527453 CAAGGGGCTGGGGGTGGTGTCGG + Intronic
1172390373 20:34561273-34561295 GAAGTGGCTGTGGGAGGATGGGG - Intronic
1172493253 20:35358707-35358729 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1172496686 20:35391044-35391066 AAAGTAGCTGGGTGTGGTGGCGG + Intronic
1172554318 20:35827632-35827654 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1172561418 20:35892017-35892039 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1172639546 20:36432525-36432547 CAGGTGGCTGGGGGTGCGGGCGG - Exonic
1172655736 20:36536569-36536591 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1172738425 20:37146677-37146699 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1172827847 20:37805544-37805566 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1172925825 20:38533987-38534009 AAATTAGCTGGGGGTGGGGGTGG + Intronic
1172941826 20:38659445-38659467 AAAGTGGTTGGGGATGGGGGTGG - Intergenic
1172944227 20:38675050-38675072 AGGGAGGCTGGGGGTGGAGGTGG + Intergenic
1173238832 20:41275005-41275027 AAATTAGCTGGGCGTGGAGGCGG + Intronic
1173665259 20:44758418-44758440 TCAGCAGCTGGGGGTGGAGTGGG - Intronic
1173798425 20:45878910-45878932 TCAGGGGCTGGGGGAGGAAGAGG - Exonic
1173902615 20:46601884-46601906 GAAGTGGCAGGGGGTGGAGGTGG + Intronic
1174026207 20:47578333-47578355 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1174313592 20:49678997-49679019 AAAGGGGCTGGGGGTGGGGAGGG + Intronic
1174329353 20:49805705-49805727 AAAGCGGGTGAGGGTGGAGGAGG - Intergenic
1174329502 20:49806679-49806701 AAAGCGGGTGAGGGTGGAGGAGG + Intergenic
1174358709 20:50015062-50015084 TATGTGGCTGGGCCTGGAGCCGG - Intergenic
1174374754 20:50118767-50118789 TAATTAGCTGGGTGTGGTGGCGG - Intronic
1174658789 20:52192700-52192722 GGAGTGGTTGGGGGAGGAGGAGG - Intronic
1175039107 20:56028909-56028931 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
1175103839 20:56599939-56599961 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1175727811 20:61331639-61331661 CAGGTGGCTGGGGCGGGAGGTGG - Intronic
1175732141 20:61361291-61361313 TATGTGGGTGGGAGTGGGGGAGG + Intronic
1175893992 20:62328034-62328056 TGAGTGACCTGGGGTGGAGGGGG - Intronic
1175925296 20:62468492-62468514 GCTGTGGCTGGGGGTTGAGGGGG - Intronic
1176016479 20:62936403-62936425 TAAGTAGCCGGGCGTGGTGGCGG + Intronic
1176035398 20:63033884-63033906 CACGGGGCTGGGGGTGGGGGTGG + Intergenic
1176520238 21:7818807-7818829 CCAGTGGCTGGATGTGGAGGAGG - Exonic
1176871802 21:14089212-14089234 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1176973251 21:15290008-15290030 TGGGTGGGTCGGGGTGGAGGCGG + Intergenic
1177453718 21:21306824-21306846 TAGGGGGTTGGGGGAGGAGGTGG - Intronic
1177455461 21:21332050-21332072 TAATTAGCTGGGCGTGGTGGTGG - Intronic
1177644453 21:23884275-23884297 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1177739528 21:25136786-25136808 GAAGTGGCTGGGGGGTAAGGAGG - Intergenic
1178080109 21:29054760-29054782 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1178229970 21:30770970-30770992 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1178654264 21:34448819-34448841 CCAGTGGCTGGATGTGGAGGAGG - Intergenic
1178709392 21:34901358-34901380 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1178710598 21:34913080-34913102 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1178771027 21:35504215-35504237 TTGGCGGCTGAGGGTGGAGGTGG - Intronic
1179404694 21:41115661-41115683 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1179474080 21:41632184-41632206 GAAGAGGCAGGGGGTGGGGGAGG + Intergenic
1179534955 21:42045376-42045398 TGTGTGGGTGGGGGTGGATGGGG + Intergenic
1179653734 21:42832303-42832325 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1179991381 21:44949841-44949863 CAGGTGCCTGGGGGTGGAGTGGG - Intronic
1180222538 21:46368296-46368318 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1180746238 22:18090855-18090877 ATAGTGCCTGGGGGTGGGGGCGG + Exonic
1180785351 22:18543976-18543998 TGTGTGGCTGGGGGTGGTGGGGG + Intergenic
1180923115 22:19532572-19532594 AAATTAGCTGGGGGTGGTGGAGG + Intergenic
1180962190 22:19767022-19767044 CAAGGGGCTGGGGGTGGCGAGGG - Exonic
1181128933 22:20718017-20718039 TGTGTGGCTGGGGGTGGTGGGGG + Intronic
1181183898 22:21087866-21087888 GAATTGGCTGGGTGTGGTGGCGG - Intergenic
1181242255 22:21483329-21483351 TGTGTGGCTGGGGGTGGTGGGGG + Intergenic
1181528143 22:23501835-23501857 GAGGTGGCGGGTGGTGGAGGCGG - Intergenic
1181554013 22:23657155-23657177 AAATTGGCTGGGGGTGGTGGTGG - Intergenic
1181768919 22:25111755-25111777 GATGGGGGTGGGGGTGGAGGGGG - Intronic
1181830809 22:25558866-25558888 TAAGTGTCTGGGGGTGCTGGTGG + Intergenic
1181988200 22:26816444-26816466 CAAGTGGGTGGCCGTGGAGGGGG + Intergenic
1182112409 22:27732878-27732900 TAGGGGGCTTGGGGTGGGGGTGG + Intergenic
1182132003 22:27861181-27861203 AAATTTGCTGGGGGTGGTGGTGG + Intronic
1182224660 22:28787287-28787309 AAATTAGCTGGGCGTGGAGGTGG - Exonic
1182483444 22:30625066-30625088 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1182696742 22:32203575-32203597 CCAGTGGCTGGGTGGGGAGGCGG - Intergenic
1182772186 22:32803618-32803640 AATGTGGGTGGAGGTGGAGGAGG - Intronic
1183003947 22:34884600-34884622 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1183433107 22:37777794-37777816 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1183651283 22:39155287-39155309 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1183926318 22:41208890-41208912 AAATTGGCTGGGTGTGGTGGCGG - Intronic
1184023959 22:41840106-41840128 AAATTAGCTGGGTGTGGAGGTGG - Intronic
1184163369 22:42712757-42712779 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1184233881 22:43172845-43172867 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1184359923 22:44009954-44009976 AAATTAGCTGGGCGTGGAGGTGG - Intronic
1184403784 22:44288489-44288511 AAAGTTGCTGGGTGTGGTGGCGG + Intronic
1184462014 22:44643660-44643682 GAATTAGCTGGGGGTGGTGGCGG + Intergenic
1184511648 22:44937012-44937034 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1184589355 22:45471208-45471230 AAAGCAGCTGGGGGTGGCGGTGG - Intergenic
1184609406 22:45593157-45593179 TCAGTGGCGGGGGGTGGGGGGGG - Intronic
1184617873 22:45650351-45650373 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1184671463 22:46014093-46014115 AAGGTGGCCGCGGGTGGAGGTGG - Intergenic
1184791651 22:46703858-46703880 AGTGTGGCTGGGGGTGGGGGTGG - Intronic
1184805631 22:46793292-46793314 TCAGTGGCAGGAGGGGGAGGGGG - Intronic
1184915908 22:47568864-47568886 TACGTGGCTGGAGCAGGAGGAGG + Intergenic
1184957271 22:47898150-47898172 GAAGTGGATGGAGGTGGTGGTGG + Intergenic
1185154767 22:49186731-49186753 TCCCTGGCTGTGGGTGGAGGAGG + Intergenic
1185201382 22:49507742-49507764 CAAATGGGTGCGGGTGGAGGGGG + Intronic
1185325726 22:50225065-50225087 TGAGAGCCTGGGGGTGGGGGAGG - Intronic
1203225382 22_KI270731v1_random:75157-75179 AAATTAGCTGGGTGTGGAGGCGG - Intergenic
949235255 3:1801476-1801498 AAGGTGGCAGGGGGTGGGGGAGG - Intergenic
949552998 3:5127721-5127743 TAATTAGCTGGGTGTGGTGGTGG + Intronic
949856205 3:8463730-8463752 GAATTGGCTGGGTGTGGTGGCGG - Intergenic
950000274 3:9650936-9650958 TAATTAGCTGGGCGTGGTGGTGG - Intronic
950000913 3:9655608-9655630 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
950217945 3:11172849-11172871 AAATTAGCTGGGCGTGGAGGCGG - Intronic
950272248 3:11626943-11626965 AGGGTGGCTGGGGGTGGGGGTGG + Intronic
950390113 3:12689941-12689963 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
950484122 3:13262877-13262899 GAAGTGGCTGGGGGAGGGGAGGG + Intergenic
950484568 3:13265388-13265410 TGAGGGAGTGGGGGTGGAGGTGG - Intergenic
950486708 3:13278250-13278272 AAGGAGGCTGGGGGTGGGGGGGG - Intergenic
950954030 3:17031536-17031558 AAAGTGGCTGGGAGAGGATGGGG + Intronic
951706865 3:25552389-25552411 AAAATGGCTGGGGTTGGGGGAGG + Intronic
951885820 3:27523080-27523102 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
951891879 3:27575215-27575237 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
951931175 3:27968764-27968786 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
952132194 3:30377608-30377630 TGGGTAGCTGGGGGTTGAGGGGG - Intergenic
952205801 3:31180933-31180955 CAAGTAGCTGGGACTGGAGGTGG - Intergenic
952386695 3:32846671-32846693 TCAGAGGCTGGGGTTGGAGCGGG - Intronic
952460622 3:33521884-33521906 CAAGGGGCTGGGGCTGGTGGAGG - Intronic
953013112 3:39047050-39047072 AAAGGGGGTGGGGGTGGGGGTGG - Intergenic
953305008 3:41821089-41821111 TAAGTGGCTGGGAGTGAAGTAGG - Intronic
953346763 3:42182440-42182462 AAATTGGCTGGGTGTGGTGGCGG - Intronic
953499195 3:43416769-43416791 TAAGAGGCTGGGAATGGATGGGG - Intronic
953999865 3:47547516-47547538 TGAGTAGCTGGATGTGGAGGCGG - Intergenic
954248976 3:49353800-49353822 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
954380795 3:50218004-50218026 TCTGTGGCTGGGAGTGGGGGTGG + Intronic
954425454 3:50440701-50440723 TAAGGAGGTGGGGGTGGGGGAGG - Intronic
954434894 3:50490774-50490796 TATGTGGCTGGGAGGGGTGGGGG - Intronic
954542202 3:51400980-51401002 AAATTAGCTGGGGGTGGTGGCGG + Intronic
955068790 3:55555024-55555046 AAGGTGGCTGGGCGTGGTGGTGG - Intronic
955127881 3:56132451-56132473 TAAGGTGCTGGTGGAGGAGGAGG - Intronic
955386425 3:58484778-58484800 TTAATGGCTGGATGTGGAGGAGG + Intergenic
955680686 3:61498167-61498189 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
955754827 3:62216542-62216564 TATCTGGCTGGTGGGGGAGGGGG - Intronic
955942262 3:64157750-64157772 GGAGTGGCTGGGGAGGGAGGTGG + Intronic
956160799 3:66350232-66350254 TAAGGGGCTGGAGGTGGTGGTGG + Intronic
956600032 3:71010829-71010851 TCACTGGGTGGGGGGGGAGGGGG - Intronic
956732349 3:72208180-72208202 GAATTTGGTGGGGGTGGAGGGGG - Intergenic
958095143 3:88934717-88934739 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
958570686 3:95877886-95877908 TAAGTGGGTGGGGGTAGGGGAGG + Intergenic
958620532 3:96552502-96552524 GAAGGGGCTGAGGGTTGAGGAGG - Intergenic
958797033 3:98717007-98717029 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
959361805 3:105403094-105403116 AAATTGGCTGGGCGTGGTGGCGG - Intronic
959538553 3:107514435-107514457 TAAATGTCTTGGGGTTGAGGGGG + Intergenic
959652541 3:108765078-108765100 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
959711142 3:109386897-109386919 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
960133218 3:114079390-114079412 AAATTGGCTGGGCGTGGTGGCGG + Intronic
960194565 3:114749401-114749423 AAAGTAGCTGGGTGTGGCGGTGG + Intronic
960223557 3:115145679-115145701 TATGTGACCGGGAGTGGAGGGGG + Intronic
960256144 3:115513230-115513252 CAAGAGGCTGGGGGAGGAGTAGG + Intergenic
960756879 3:121023903-121023925 AAATTAGCTGGGGGTGGTGGTGG - Intronic
960982557 3:123244276-123244298 GAAGTGGGTGGGGGCGGAAGTGG + Intronic
961089774 3:124100819-124100841 TAATTGGCTGGAGGTGGAAGTGG - Intronic
961143111 3:124572207-124572229 CCAGCTGCTGGGGGTGGAGGTGG + Intronic
961548061 3:127649785-127649807 AAATTGGCTGGGTGTGGTGGTGG + Intronic
961585461 3:127918560-127918582 AAATTAGCTGGGGGTGGTGGCGG + Intronic
961622611 3:128236409-128236431 TAAATGGCGGGGGGCGGGGGTGG + Intronic
961849372 3:129799660-129799682 AAATTGGCTGGGCGTGGTGGTGG + Intronic
962967669 3:140369700-140369722 CAACAAGCTGGGGGTGGAGGAGG - Intronic
962969182 3:140382940-140382962 GAATTGGGTGGGGGTGGGGGTGG + Intronic
962985633 3:140533384-140533406 TGAGGGGCTGGGGATAGAGGTGG + Intronic
963125322 3:141810664-141810686 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
963155797 3:142095138-142095160 TAATTAGCTGGGCGTGGTGGTGG - Intronic
963257605 3:143161344-143161366 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
963784909 3:149524531-149524553 AAGGTGGCAGGGGGTGGTGGTGG + Intronic
963789092 3:149565036-149565058 AAATTGGCTGGGTGTGGTGGTGG + Intronic
963910299 3:150811614-150811636 TAAGTGGGTGGAGGTGAGGGAGG + Intergenic
964182201 3:153902594-153902616 AAAGTAGCCGGGCGTGGAGGCGG - Intergenic
964187451 3:153963941-153963963 TAATTGGCTGGGGCTGGGTGTGG - Intergenic
964749314 3:160039864-160039886 TGGGGGGGTGGGGGTGGAGGTGG - Intergenic
965773597 3:172206507-172206529 AAATTAGCTGGGGGTGGTGGCGG + Intronic
966548741 3:181181495-181181517 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
966670870 3:182524360-182524382 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
966681012 3:182642315-182642337 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
966921679 3:184615933-184615955 AAATTAGCTGGGGGTGGTGGCGG - Intronic
967275088 3:187766572-187766594 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
967723369 3:192838576-192838598 AAAGTAGCTGGGTGTGGCGGTGG - Intronic
967766232 3:193282523-193282545 AAATTAGCTGGGGGTGGTGGTGG - Intronic
967820603 3:193835700-193835722 TAAGCAGATGGGGGTGGAAGAGG - Intergenic
968004255 3:195228636-195228658 AAATTAGCTGGGGGTGGTGGCGG - Intronic
968037242 3:195558067-195558089 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
968131206 3:196193962-196193984 CAGGTGGCTGAGGGTGGAGCAGG - Intergenic
968181149 3:196596260-196596282 TCTGTGGCTGGGGGATGAGGGGG + Intergenic
968288342 3:197521098-197521120 TCAGTGGCTGGGGAAGGAGGCGG - Intronic
968531530 4:1094395-1094417 TCAGAAGCTGGGGGTGGGGGAGG + Intronic
968545797 4:1197369-1197391 TAAGTTTCTGGGGGAAGAGGTGG - Intronic
968658733 4:1789925-1789947 GAGGTGGGTGGGGGTGCAGGGGG + Intergenic
968766355 4:2472580-2472602 TAAGAGACTGGCAGTGGAGGGGG - Intronic
969409540 4:7019169-7019191 AAATTAGCTGGGGGTGGTGGCGG - Intronic
969423114 4:7108682-7108704 TAAGGATCTGGGGGTGGGGGAGG - Intergenic
969527649 4:7712115-7712137 TAGGTGGGTGGGGGAAGAGGCGG - Intronic
969659448 4:8517971-8517993 TGAGGGGCTGGAGGTGGAGCAGG - Intergenic
970058506 4:12002336-12002358 CAAGAGGCTGGGGGTGGGGGTGG + Intergenic
970069418 4:12140123-12140145 TCAGGGGCTGGAGGTGGGGGTGG + Intergenic
970108341 4:12609870-12609892 TAAGGGGCGGGGGGAGGTGGGGG - Intergenic
970347454 4:15167170-15167192 TAAGTAGCTGGGACTGCAGGTGG - Intergenic
970429640 4:15976944-15976966 GCAGTGACTGGGGGAGGAGGGGG + Intronic
970602308 4:17650160-17650182 CAAGTGGATGGGGGTGTGGGTGG - Intronic
970637646 4:18026111-18026133 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
971016458 4:22494053-22494075 AAATTAGCTGGGCGTGGAGGCGG + Intronic
971126904 4:23764225-23764247 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
971905319 4:32717142-32717164 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
972548347 4:40104100-40104122 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
972676843 4:41268206-41268228 TAAGTGCCTGGGTGTGGCTGAGG - Exonic
972776448 4:42245875-42245897 AAAATAGCTGGGTGTGGAGGCGG - Intergenic
972797348 4:42435274-42435296 AAATTGGCTGGGCGTGGTGGCGG + Intronic
973058244 4:45687240-45687262 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
973236000 4:47905744-47905766 TGAGTGAGTGGGGGTGGGGGTGG + Intronic
973821292 4:54663952-54663974 TTACAGGCTGGGGGTGGAGGAGG + Intronic
974461521 4:62195171-62195193 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
974931349 4:68364772-68364794 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
975072332 4:70157666-70157688 AAATTGGCTGGGCGTGGTGGCGG - Intronic
975263261 4:72330574-72330596 TAAGCTGCTTGGTGTGGAGGTGG - Intronic
975545320 4:75554984-75555006 TTAGAGGCTAGGGGTGGGGGAGG + Intergenic
975558355 4:75686557-75686579 TGGGTGGCGGGGGGTGGGGGTGG + Intronic
975564021 4:75734876-75734898 AAATTGGCTGGGTGTGGTGGTGG - Intronic
975574756 4:75851578-75851600 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
975593758 4:76027101-76027123 AAATTGGCTGGGCGTGGTGGTGG + Intronic
975779906 4:77827403-77827425 TAAATGGCTGCAGGTGGTGGTGG - Intergenic
976168079 4:82276154-82276176 GCAGTGGCTCTGGGTGGAGGAGG - Intergenic
976241668 4:82964336-82964358 TAAGTGGCTGGGGGGCATGGTGG - Intronic
976310530 4:83607467-83607489 GGATAGGCTGGGGGTGGAGGTGG + Intergenic
976678533 4:87730143-87730165 TATATGGCTGAGGGTGGAGAAGG + Intergenic
976718920 4:88151586-88151608 AAAGTAGCTGGGCGTGGTGGAGG + Intronic
976747690 4:88420926-88420948 TAAGGGGATGGGAGTTGAGGGGG - Intronic
976763067 4:88570901-88570923 AAATTAGCTGGGGGTGGTGGTGG - Intronic
976763795 4:88578430-88578452 AAATTAGCTGGGTGTGGAGGGGG + Intronic
976990992 4:91366167-91366189 AAATTAGCTGGGCGTGGAGGTGG - Intronic
977221008 4:94337523-94337545 AAATTAGCTGGGGGTGGTGGCGG + Intronic
977255422 4:94735101-94735123 AAATTAGCTGGGTGTGGAGGCGG - Intergenic
977433013 4:96956436-96956458 TATGGGGCTGGAGGTGGGGGAGG - Intergenic
977886425 4:102257298-102257320 AAATTAGCTGGGGGTGGTGGCGG - Intronic
978163809 4:105582013-105582035 AAATTGGCTGGGTGTGGTGGCGG + Intronic
978237337 4:106474834-106474856 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
978311704 4:107391419-107391441 TAGATCCCTGGGGGTGGAGGAGG - Intergenic
978354629 4:107858391-107858413 TAGTTTTCTGGGGGTGGAGGTGG - Intronic
978424869 4:108571717-108571739 TGAGTGGCTGAGGCTGGACGGGG - Intergenic
978449997 4:108822191-108822213 AAATTAGCTGGGGGTGGTGGTGG - Intronic
978742540 4:112153658-112153680 TAAATGGCTGGGGGCGGTGCCGG - Intronic
979306243 4:119147589-119147611 AAATTGGCTGGGTGTGGTGGTGG + Intronic
979406280 4:120314334-120314356 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
979518133 4:121635174-121635196 TTAGTAGCTGGGTGTGGTGGTGG - Intergenic
979605960 4:122639319-122639341 GAAGTGGCGGCGGGGGGAGGGGG - Intergenic
979619623 4:122784225-122784247 TAAAGGGCTAGGTGTGGAGGAGG - Intergenic
979632856 4:122922781-122922803 TAAGTGAGTGGCGGTGGGGGAGG - Intronic
979886257 4:126031253-126031275 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
980115054 4:128671480-128671502 AAAGAGGCTGGGGGTGGTGAAGG + Intergenic
980230022 4:130037110-130037132 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
980380021 4:132001312-132001334 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
980430686 4:132689856-132689878 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
980836459 4:138199585-138199607 TCAGAGGCAGGGAGTGGAGGAGG + Intronic
981316058 4:143340658-143340680 AAATTAGCTGGGTGTGGAGGGGG - Intronic
981390329 4:144182469-144182491 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
981586064 4:146303525-146303547 AAATTGGCTGGGTGTGGTGGTGG - Intronic
981825764 4:148939378-148939400 TAATTGGCAGGGGTTGGAGGTGG + Intergenic
982039119 4:151377523-151377545 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
982062783 4:151621542-151621564 TGTGTGGCAGGGGGTGGTGGGGG + Intronic
982315544 4:154027587-154027609 TCTGTGGCTGAGGGAGGAGGTGG - Intergenic
982388168 4:154835597-154835619 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
982468048 4:155755609-155755631 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
982670802 4:158318247-158318269 AAATTGGCTGGGTGTGGTGGTGG + Intronic
982854165 4:160360921-160360943 GAATTAGCTGGGGGTGGTGGAGG - Intergenic
982913538 4:161175904-161175926 TAAGTGGATGAAGGGGGAGGAGG + Intergenic
982979658 4:162116569-162116591 TAATTGGCTGGAGGTTGGGGAGG + Intronic
983112307 4:163767481-163767503 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
983548602 4:168990902-168990924 AAATTAGCTGGGGGTGGTGGTGG + Intronic
984284902 4:177716701-177716723 TAATTAGCTGGGTGTGGTGGCGG - Intergenic
984487652 4:180392530-180392552 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
984702571 4:182827601-182827623 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
984919527 4:184751320-184751342 TAAGTGGCAGTGGCTGGAGAAGG - Intergenic
985121197 4:186643790-186643812 CAAGTGGGTGGGGGTGGGGGGGG - Intronic
985314860 4:188646429-188646451 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
985549597 5:526254-526276 CAAGAGGCTGGGAGTGGAGTGGG - Intergenic
985625478 5:983086-983108 TGGATGGCTGGGGGTGGAGTGGG + Intergenic
985649711 5:1101781-1101803 TTAGTGTCGGGGGGTGGAGGGGG - Intronic
985658882 5:1145773-1145795 GAAGGGGCTGGGGGTGCGGGAGG + Intergenic
985672758 5:1214710-1214732 GAAGGGGCTGGGGGTGAGGGAGG + Intronic
985835990 5:2272258-2272280 AAGGTGGCTGGGGTTGGAGGGGG + Intergenic
985897129 5:2755312-2755334 TAAGCCGCCGGGGGAGGAGGTGG - Exonic
986417861 5:7546529-7546551 TCATTGGCTGTGGGTGCAGGAGG - Intronic
986791618 5:11166638-11166660 TGAATGGGTGTGGGTGGAGGAGG - Intronic
987089423 5:14498024-14498046 CATGTGGGTGGGTGTGGAGGAGG + Intronic
987102334 5:14602987-14603009 TCAGGGGCTGGGGTAGGAGGAGG - Intronic
987145095 5:14984074-14984096 TAAGTTGCTGTGGGCGGAGAGGG - Intergenic
987345784 5:16977628-16977650 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
987532978 5:19144891-19144913 TAATTAGCTGGGTGTGGTGGCGG - Intergenic
987792992 5:22592671-22592693 GAGGTGGTGGGGGGTGGAGGGGG - Intronic
987920584 5:24274884-24274906 TAGGGGGCTGGGGGGGCAGGTGG + Intergenic
987992931 5:25238742-25238764 AAATTAGCTGGGTGTGGAGGTGG + Intergenic
988062175 5:26185552-26185574 TAAGTGGCTGGTAGAGGAGAGGG + Intergenic
988318257 5:29659662-29659684 AAACTAGCTGGGGGTGGTGGCGG + Intergenic
988481498 5:31635282-31635304 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
988515266 5:31898975-31898997 AAAATAGCTGGGGGTGGTGGCGG - Intronic
988575540 5:32419834-32419856 GTAGTAGCTGGGGGTGGTGGTGG + Exonic
988686312 5:33528893-33528915 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
988700106 5:33665225-33665247 TCAGGGGCTGGGGGAGGAGCTGG + Intronic
988757599 5:34275289-34275311 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
988895536 5:35669075-35669097 TCAGTGGCTGGGGATTGAAGGGG - Intronic
989492809 5:42077222-42077244 AAAGTGCCTGGGGGTGGGGCAGG + Intergenic
990085436 5:51970718-51970740 AAATTGGCTGGGTGTGGTGGGGG - Intergenic
990455315 5:55980398-55980420 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
990496030 5:56348859-56348881 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
990680540 5:58238872-58238894 TAAGTGGCTTGGGATGGTGGTGG - Intergenic
990985386 5:61636760-61636782 CAGGAGGCTTGGGGTGGAGGGGG + Intergenic
991023805 5:62008438-62008460 GAAATAGCTGGGGGTGGCGGTGG + Intergenic
991417568 5:66407939-66407961 TATGTGGGTGGGGTGGGAGGAGG + Intergenic
991585599 5:68198620-68198642 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
991699871 5:69307530-69307552 AAATTGGCTGGGCGTGGTGGCGG + Intronic
991712978 5:69426482-69426504 AAATTGGCTGGGTGTGGTGGCGG - Intronic
991777584 5:70100105-70100127 TAGGTGGGTGGGGGCTGAGGTGG - Intergenic
991856872 5:70975549-70975571 TAGGTGGGTGGGGGCTGAGGTGG - Intronic
991952165 5:71956764-71956786 GCAGAGGCTTGGGGTGGAGGTGG + Intergenic
992223238 5:74593260-74593282 AAACTGGCTGGGAGTGGTGGTGG - Intergenic
992267665 5:75034333-75034355 CAAGTTGCAGGGGGTGGAGGTGG + Intergenic
992349138 5:75911422-75911444 GGAGTGGCTCTGGGTGGAGGAGG - Intergenic
992370152 5:76135418-76135440 TATGGGGCTGGTGGTGGAGGAGG + Intronic
992435217 5:76749566-76749588 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
992547908 5:77833104-77833126 TAATTGTCTGGTGGTGGTGGTGG + Intronic
992587858 5:78259818-78259840 AAATTGGCTGGGTGTGGTGGTGG + Intronic
992622150 5:78604325-78604347 AAATTGGCTGGGCGTGGTGGTGG + Intronic
993315739 5:86403707-86403729 TATTTGGTAGGGGGTGGAGGGGG + Intergenic
993417487 5:87653102-87653124 TAAGTGGCTGGGCCTGGTAGTGG - Intergenic
993593528 5:89825301-89825323 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
993966960 5:94370757-94370779 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
994036394 5:95206685-95206707 AAATTGGCTGGGTGTGGTGGTGG - Intronic
994058370 5:95445878-95445900 TATGTGGCTGGGAGAGGAGCAGG - Intronic
994136946 5:96299093-96299115 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
994494960 5:100500011-100500033 AAATTGGCGGGGCGTGGAGGCGG + Intergenic
994568111 5:101480053-101480075 TGAATGGCTGGGGGTGAGGGGGG - Intergenic
994686963 5:102967870-102967892 AAATTAGCTGGGGGTGGTGGCGG - Intronic
994754755 5:103779945-103779967 TAATTAGCTGGGTGTGGTGGCGG + Intergenic
995146606 5:108794365-108794387 AAATTAGCTGGGCGTGGAGGCGG - Intronic
995477250 5:112560712-112560734 TACATGGGTTGGGGTGGAGGTGG - Intergenic
995552335 5:113293918-113293940 TAATTTGGTGGGGGTGGTGGTGG - Intronic
995564204 5:113416436-113416458 AAAGTGGCAGGGGGAGCAGGTGG + Intronic
995872909 5:116761233-116761255 TTTGTGGCGGGGGGTGGGGGGGG + Intergenic
996470125 5:123851121-123851143 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
996531967 5:124535855-124535877 TTATTGGCTGGGTGTGGTGGTGG - Intergenic
996730040 5:126707961-126707983 TAAGTAGCTGGGCATGGTGGCGG + Intergenic
997351649 5:133235347-133235369 AAATTAGCTGGGCGTGGAGGCGG + Intronic
997466382 5:134090672-134090694 TCAGTGGCAGGGGGTGGGGCTGG - Intergenic
997889250 5:137660395-137660417 AAGCTGGCTGGAGGTGGAGGAGG - Intronic
997959578 5:138309405-138309427 AAATTAGCTGGGGGTGGTGGTGG + Intronic
997972079 5:138411847-138411869 AAATTGGCTGGGGGTGGTGGCGG - Intronic
998005662 5:138655224-138655246 AAATTAGCTGGGGGTGGTGGCGG + Intronic
998015914 5:138732113-138732135 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
998141357 5:139701385-139701407 GAAGTGTGTGAGGGTGGAGGGGG - Intergenic
998632832 5:143919112-143919134 GGAAAGGCTGGGGGTGGAGGGGG + Intergenic
998811634 5:145972464-145972486 CAAGTGGGTGGTGGTGGTGGTGG - Intronic
999143796 5:149379608-149379630 CAAGGGGTTGAGGGTGGAGGAGG + Intronic
999249313 5:150172652-150172674 TAAGAGGCTGGGGGAGGAGGGGG + Intronic
999652667 5:153782961-153782983 TAAGGGGCTGGAGGTGGTAGTGG + Intronic
999733155 5:154491700-154491722 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
999948758 5:156626027-156626049 CAATTTGGTGGGGGTGGAGGTGG + Intronic
999972654 5:156880283-156880305 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
999992151 5:157059523-157059545 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1000004101 5:157166999-157167021 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1000130219 5:158289971-158289993 TGGGTGGGTGGGAGTGGAGGAGG + Intergenic
1000214076 5:159138284-159138306 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1000408300 5:160912097-160912119 GAAGTGGCTGTGGGTGGAAAGGG + Intergenic
1000839375 5:166197503-166197525 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1001048162 5:168391507-168391529 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1001217739 5:169871697-169871719 TAGGGTGGTGGGGGTGGAGGTGG + Intronic
1001357734 5:171047164-171047186 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1001474039 5:172036716-172036738 TAATTAGCTGGGTGTGGTGGTGG - Intergenic
1001540533 5:172534662-172534684 GCAGGGGCAGGGGGTGGAGGTGG - Intergenic
1001733063 5:173974198-173974220 CAAGAGGCTGGTGGTGGTGGTGG + Intronic
1001876663 5:175207446-175207468 TGAGTGGATGGGTGTGGAGGAGG + Intergenic
1002045966 5:176542026-176542048 TAAGTGGCTGTGCGTGCAGATGG + Intergenic
1002080545 5:176734717-176734739 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1002179114 5:177420865-177420887 TAAATGGCTGGGGATGGGGGTGG - Intronic
1002199896 5:177521771-177521793 TGAGTGGCTGCGGGAGGAGATGG + Intronic
1002212438 5:177606945-177606967 GATCTTGCTGGGGGTGGAGGTGG - Intronic
1002325037 5:178399063-178399085 TCAGTTGCTGGGGCTGGAAGGGG + Intronic
1002415099 5:179116263-179116285 CAAGTGGCGGGGGGTGGGGGGGG - Intronic
1002419711 5:179139275-179139297 AAAGTGGCTGCGGGCTGAGGAGG + Intronic
1002420038 5:179140947-179140969 AAATTAGCTGGGGGTGGTGGTGG - Intronic
1002540632 5:179904372-179904394 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1002548754 5:179971517-179971539 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1002884000 6:1277673-1277695 TCAGTAGCTTAGGGTGGAGGAGG + Intergenic
1002948355 6:1784240-1784262 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1003200900 6:3959536-3959558 TCAGAGGCTGGTGGGGGAGGCGG + Intergenic
1003562010 6:7188398-7188420 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1003678219 6:8226762-8226784 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1003908975 6:10726538-10726560 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1003977212 6:11355645-11355667 TATGTGGCAGGAGGAGGAGGTGG + Intronic
1004058760 6:12169969-12169991 AAAGTAGCCGGGGGTGGTGGTGG + Intergenic
1004070572 6:12293434-12293456 CCAGTGGTTGGGGGAGGAGGAGG - Intronic
1004225940 6:13784381-13784403 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1004295646 6:14407422-14407444 TTTGTGGCTGGTGCTGGAGGTGG - Intergenic
1004514491 6:16310636-16310658 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1004563745 6:16776044-16776066 TAATGGAATGGGGGTGGAGGAGG + Intergenic
1004632859 6:17438214-17438236 AAATTAGCTGGGCGTGGAGGTGG + Intronic
1004919064 6:20359136-20359158 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1004924296 6:20403192-20403214 AAAGGGGCTGGGGGAGGTGGAGG + Intronic
1005026379 6:21466573-21466595 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1005081663 6:21962439-21962461 TAAATTGCTGGGCGTGGTGGCGG - Intergenic
1005147454 6:22707662-22707684 TTAGGGGTTGGGGGTGGTGGTGG - Intergenic
1005343186 6:24862807-24862829 TCAGTGGCTGTGGGTGGTGGGGG - Intronic
1005759146 6:28951709-28951731 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1006013962 6:31065975-31065997 TAAGTGGCAGGGAGGGGTGGGGG + Intergenic
1006171351 6:32095237-32095259 AAAGGGGCTGTGGGTGGGGGTGG - Intronic
1006330330 6:33385679-33385701 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1006340697 6:33444961-33444983 AAATTGGATGGGGATGGAGGGGG + Intronic
1006388306 6:33744640-33744662 CCAGTGGCTGGGTGAGGAGGTGG - Intronic
1006461593 6:34162293-34162315 CAGGTGGCAGGGGGTGGAGAAGG + Intergenic
1006771611 6:36558158-36558180 TCAGTGGCTGGGGATCAAGGTGG - Intergenic
1006895397 6:37465643-37465665 AAATTAGCTGGGGGTGGTGGTGG - Intronic
1007084994 6:39137319-39137341 TAAGTTTTGGGGGGTGGAGGTGG - Intergenic
1007115914 6:39343138-39343160 GACGGGGCTGGGGGTGGAGGGGG + Intronic
1007117198 6:39351070-39351092 GAAGGGGCTTGGGGTGGGGGTGG + Intronic
1007231711 6:40352817-40352839 GAAGAGGGTGGGGGTGGTGGGGG - Intergenic
1007341213 6:41192566-41192588 AAAGGGGCTGGGGCTGGTGGAGG - Intronic
1007366726 6:41399335-41399357 TTAGGGGCTGGGGGTGGGGTGGG - Intergenic
1007399545 6:41596045-41596067 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1007411946 6:41669358-41669380 TAGTTGCCTGGGGTTGGAGGTGG + Intergenic
1007498021 6:42274957-42274979 TGGGTGGCTGGGGATGGGGGTGG - Intronic
1007573320 6:42908920-42908942 TAATTAGCTGGGCGTGGTGGCGG - Intergenic
1007763311 6:44146929-44146951 TAAGGGACTGGGGGCAGAGGAGG + Intronic
1007902179 6:45422534-45422556 GAAGTGGCCGGGGGAGGGGGAGG - Intronic
1007906609 6:45467605-45467627 TGAGTGGCTGGGGGCGGTGGGGG - Intronic
1007966327 6:46006800-46006822 TAAGTAGCTGGGGCTATAGGTGG + Intronic
1008210370 6:48715822-48715844 TAAGTGGCTGGTGGTTGTGATGG + Intergenic
1008667581 6:53731447-53731469 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1008977076 6:57439563-57439585 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1008999154 6:57693078-57693100 TAAATGGTTGGGGGGGGGGGTGG + Intergenic
1009036371 6:58121475-58121497 TAGGTGGCTGGGGGTGGTAGGGG - Intergenic
1009212182 6:60875086-60875108 TAGGTGGCTAGGGGTGGCAGGGG - Intergenic
1009337862 6:62515926-62515948 TAAGTATTTGGGGTTGGAGGAGG + Intergenic
1009425951 6:63513759-63513781 AAATTAGCTGGGTGTGGAGGCGG + Intergenic
1009769670 6:68129167-68129189 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1010196014 6:73241078-73241100 TTTGTGGGTGGGGGTGGGGGTGG - Intronic
1010693631 6:78942331-78942353 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1011071744 6:83392863-83392885 TAAGCAGCTGGTGGTGCAGGAGG - Intronic
1011132374 6:84064635-84064657 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1011221736 6:85061822-85061844 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1011726066 6:90211917-90211939 TAAGCTGCTGGGCGTGGTGGTGG - Intronic
1012130235 6:95481763-95481785 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1012398375 6:98824942-98824964 TGCGGGGCGGGGGGTGGAGGAGG - Intergenic
1013106606 6:107031228-107031250 AAAGTGGCCGGGTGTGGTGGTGG + Intronic
1013435571 6:110102025-110102047 GCAGTGGCTGGAGGTGGAGGTGG + Exonic
1013524604 6:110962750-110962772 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1014124249 6:117759024-117759046 AAGCTGGCTGGGGGTGGAAGTGG + Intergenic
1014983375 6:127972846-127972868 TAAGTGTCTGTGGGTAGAGGGGG + Intronic
1015391345 6:132685939-132685961 GGTGTGGGTGGGGGTGGAGGGGG - Intronic
1015706058 6:136088882-136088904 AATTTGGCAGGGGGTGGAGGGGG + Intronic
1015717412 6:136206699-136206721 GAGTTGGCTGGGGGTGGTGGAGG + Intergenic
1015978609 6:138816632-138816654 AAAGTAGCTGGGCGTGGTGGTGG - Intronic
1016028993 6:139318118-139318140 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1016075326 6:139788726-139788748 TCAGTGGGAGGGGGTGGTGGGGG + Intergenic
1016229522 6:141785856-141785878 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1016440929 6:144082620-144082642 TAAGTGGGTGTGGGGGGAGGGGG + Intergenic
1016917920 6:149262381-149262403 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1017002549 6:150006112-150006134 TGAGTGGCCGGGGGTAGAGTGGG - Intergenic
1017017435 6:150113197-150113219 AAGGAGGCTGGGGGTGGAGTAGG - Intergenic
1017448315 6:154529587-154529609 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1017450706 6:154552093-154552115 TAAGTCTCTGGTGGTGGAGTGGG - Intergenic
1017463597 6:154674224-154674246 ATATTGGCTGGGGCTGGAGGAGG - Intergenic
1017575746 6:155800828-155800850 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
1017809427 6:157974353-157974375 CAGGTGGCTGGGGGTGGAGCGGG - Intergenic
1017824202 6:158069745-158069767 GAAGGGGATGGGGGAGGAGGGGG - Intronic
1018204249 6:161422346-161422368 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1018332061 6:162740458-162740480 AAATTAGCTGGGGGTGGTGGTGG - Intronic
1018396512 6:163381975-163381997 GATGTGACTGGGGGTGGAGGAGG + Intergenic
1018602873 6:165563983-165564005 TCAGTGGGAGAGGGTGGAGGGGG - Intronic
1018690443 6:166339990-166340012 TAAGTGACTGTGGGAGGAGCAGG - Intronic
1018696699 6:166396573-166396595 CCAGTGGCTGGGGGCGGGGGTGG + Intergenic
1018747705 6:166775252-166775274 GAAGGGGCCGGGGGTGGGGGGGG - Intronic
1019061952 6:169263172-169263194 GTAGTGGCTGCGGGTGCAGGAGG - Intergenic
1019070318 6:169340356-169340378 AAAGTGCCTGGGGCTGGTGGAGG + Intergenic
1019341668 7:511415-511437 CCAGTGGCTGGGGGAGGAGGGGG + Intronic
1019342643 7:515853-515875 ATAATGGGTGGGGGTGGAGGAGG + Intronic
1019374072 7:679796-679818 GAGGTGGCTGGGGTTGGATGGGG + Intronic
1019566272 7:1680687-1680709 TCAGTGCCTGGGGGTGGGGTAGG - Intergenic
1019585852 7:1803011-1803033 TCCCTGGCTGGGGGTGGAGATGG + Intergenic
1019795385 7:3044344-3044366 AAAGAGGCTTGGGGTGTAGGAGG - Intergenic
1019839621 7:3427367-3427389 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1019875441 7:3806781-3806803 TAACTGGCAGGTGGTGGAGACGG + Intronic
1019957362 7:4425893-4425915 AAATTAGCTGGGCGTGGAGGTGG - Intergenic
1020063403 7:5169315-5169337 TAATTAGCTGGGCGTGGTGGTGG + Intergenic
1020104461 7:5415525-5415547 AAATTGGCTGGGTGTGGTGGCGG - Intronic
1020214124 7:6176409-6176431 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1020275884 7:6624117-6624139 GAAGTGACTGGGGGCAGAGGTGG - Exonic
1020353345 7:7248870-7248892 TAGATGGGTGGGGGTGGAAGAGG + Intergenic
1020914487 7:14175435-14175457 TGAGTTCCTGGGGGTGCAGGAGG - Intronic
1021104454 7:16621174-16621196 GAAGTGACTGAGTGTGGAGGTGG + Intronic
1021249164 7:18303354-18303376 AAATTGGCTGGGCGTGGCGGTGG - Intronic
1021511875 7:21442186-21442208 AAATTGGCTGGGCGTGGTGGCGG - Intronic
1021699527 7:23303954-23303976 TAATTAGCTGGGTGTGGTGGAGG + Intronic
1021863907 7:24935717-24935739 TATGTGCCTGGGGGTGGGGTGGG + Intronic
1022086712 7:27075448-27075470 AAATTGGCTGGGCGTGGTGGGGG + Intergenic
1022405915 7:30089662-30089684 AAAGGGGATGGGGGTGGAGTGGG + Intronic
1022437160 7:30399309-30399331 TCAGAGGCTGGAGGAGGAGGAGG + Intronic
1022515794 7:30974337-30974359 TACGTGGCTGATGGTGGTGGTGG + Intronic
1023193575 7:37609985-37610007 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1023550544 7:41365830-41365852 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1023555981 7:41423387-41423409 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1023712000 7:43005097-43005119 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1023772741 7:43573281-43573303 TAATTAGCTGGGCGTGGTGGTGG - Intergenic
1023947673 7:44816571-44816593 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1024185515 7:46944692-46944714 TAATTAGCTGGGTGTGGTGGTGG - Intergenic
1024381540 7:48702606-48702628 ACAGTGGGTGGGGGTGGGGGTGG + Intergenic
1024384536 7:48736740-48736762 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1024481891 7:49872215-49872237 GACATCGCTGGGGGTGGAGGTGG + Intronic
1024580012 7:50793538-50793560 AAAGTAGCCGGGGGAGGAGGCGG - Intergenic
1024636157 7:51292009-51292031 AAATTGGCTGGGTGTGGTGGAGG + Intronic
1025191206 7:56897329-56897351 TACGGTGCTAGGGGTGGAGGTGG - Intergenic
1025243545 7:57298014-57298036 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1025603602 7:63023051-63023073 TATGTGGCGGGGTGTGGAGGTGG + Intergenic
1025680742 7:63679601-63679623 TACGGTGCTAGGGGTGGAGGTGG + Intergenic
1025801795 7:64793885-64793907 AAAGTAGCCGGGCGTGGAGGCGG + Intergenic
1025850110 7:65238047-65238069 AAAGTGGGTGGGGGAGGGGGTGG + Intergenic
1025865698 7:65378590-65378612 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1025946947 7:66111987-66112009 AAAGTAGCTGGGTGTGGTGGGGG - Intronic
1025974396 7:66358094-66358116 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1026014633 7:66663426-66663448 TAATTGGCTGGGCGTGGTGGTGG + Intronic
1026032278 7:66804583-66804605 AAAGTAGCTGGGTGTGGTGGCGG + Intronic
1026183534 7:68063040-68063062 TAATTAGCTGGGTGTGGTGGCGG + Intergenic
1026194680 7:68162834-68162856 TGGGAGGCGGGGGGTGGAGGCGG - Intergenic
1026309129 7:69168520-69168542 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1026529858 7:71187571-71187593 AAAGTGGATGAGGGGGGAGGTGG - Intronic
1026596367 7:71737066-71737088 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1026707703 7:72709516-72709538 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1026796419 7:73368873-73368895 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1026839581 7:73662343-73662365 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
1027027576 7:74865075-74865097 TAATTAGCTGGGCGTGGCGGTGG - Intergenic
1027060177 7:75079020-75079042 TAATTAGCTGGGCGTGGCGGTGG + Intergenic
1027299959 7:76821831-76821853 TAGGTGGGTGGGGGTGAGGGTGG + Intergenic
1027305630 7:76893275-76893297 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1027510176 7:79070639-79070661 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1027793829 7:82666940-82666962 TAAGTAACTGGGGGTAAAGGAGG + Intergenic
1027862711 7:83605578-83605600 AAAATAGCTGGGGGTGGTGGTGG - Intronic
1027906170 7:84185379-84185401 TAAGGGGCTGGGTGTGGGTGTGG + Intronic
1028089577 7:86681562-86681584 TTGGTGGCTGGGGGGTGAGGCGG + Intronic
1028699882 7:93765111-93765133 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1028902398 7:96116125-96116147 TAAGTAGCTAGGGATGGTGGAGG + Intergenic
1028995625 7:97096636-97096658 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1029131462 7:98334693-98334715 AAAGTAGCTGGGCGTGGTGGGGG - Intronic
1029368296 7:100130612-100130634 CAAGTAGCTGGGGCTGCAGGTGG - Intergenic
1029379926 7:100206619-100206641 AAATTGGCTGGGGGTGGTGGTGG - Intronic
1029501816 7:100935729-100935751 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1029568823 7:101357953-101357975 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1029571954 7:101375834-101375856 AAATTGGCTGGGTGTGGTGGCGG + Intronic
1029713343 7:102311925-102311947 AAATTAGCTGGAGGTGGAGGCGG + Intronic
1029839041 7:103343147-103343169 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1029985288 7:104917271-104917293 AAAGTGGCTGTGTGTGGTGGTGG + Intergenic
1030059318 7:105610505-105610527 TAAGTTACTGAGGGTGGGGGTGG - Intronic
1030156561 7:106461244-106461266 TAAGTGACTCGGAATGGAGGTGG - Intergenic
1030295487 7:107921846-107921868 CAAGGGGATGGGGGTGGGGGAGG - Intronic
1030348445 7:108457467-108457489 TTGGAGGCTGGGGGTGGAGGAGG - Intergenic
1030641210 7:112008842-112008864 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1030671234 7:112339466-112339488 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1030994069 7:116336357-116336379 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1031341991 7:120614160-120614182 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1032036873 7:128528030-128528052 TAATTAGCTGGGCGTGGCGGCGG - Intergenic
1032049129 7:128635721-128635743 AAATTGGCTGGGTGTGGTGGCGG - Intergenic
1032257303 7:130307480-130307502 AAATTGGCTGGGTGTGGTGGTGG + Intronic
1032303363 7:130709979-130710001 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1032443452 7:131960237-131960259 TGAGAAGATGGGGGTGGAGGTGG - Intergenic
1032525534 7:132576538-132576560 TTCGGGGCTGGGGCTGGAGGAGG - Exonic
1032533671 7:132643024-132643046 TAGGTGGCTGGGGATGGGGTGGG + Intronic
1032534096 7:132646295-132646317 GAAGAGACTGAGGGTGGAGGAGG - Intronic
1032557943 7:132857555-132857577 AAATTAGCTGGGGGTGGTGGCGG - Intronic
1032740186 7:134730816-134730838 AATGTGCCTGGGGGTTGAGGGGG + Intergenic
1032804739 7:135342503-135342525 AAAGTGGCTGGATGTGGGGGAGG + Intergenic
1033123926 7:138690613-138690635 TGAGTGGTTGCGGGGGGAGGAGG + Intronic
1033183104 7:139199918-139199940 TAATTAGCTGGGGATGGTGGTGG + Intergenic
1033358274 7:140618946-140618968 AAATTAGCTGGGCGTGGAGGCGG - Intronic
1033521831 7:142168417-142168439 AAATTAGCTGGGCGTGGAGGCGG - Intronic
1034095255 7:148401746-148401768 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1034277768 7:149831096-149831118 TGAGTGGCAGGAGGTGGGGGTGG - Intergenic
1034412180 7:150947411-150947433 GAGGAGGCTGGGGGTGGGGGCGG + Exonic
1034490820 7:151392299-151392321 TGAGAGGCTGGGGGTGCAGGGGG - Intronic
1034512737 7:151549593-151549615 AAATTAGCTGGGGGTGGTGGTGG + Intergenic
1034572759 7:151970200-151970222 GAAGGGGCGGGGGGTGGGGGTGG + Intronic
1035035781 7:155892914-155892936 GAAGGTGCTGGAGGTGGAGGTGG + Intergenic
1035086258 7:156261091-156261113 TTAGAGGCTGGGGGTGGGGGCGG + Intergenic
1035163102 7:156965764-156965786 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1035170531 7:157015042-157015064 GAAGGGGCTGGGGTTGGTGGGGG - Intergenic
1035192741 7:157186272-157186294 AAATTAGCTGGGTGTGGAGGCGG + Intronic
1035311898 7:157974865-157974887 TGAGGGGCTGGGGATGGACGTGG - Intronic
1035630189 8:1101517-1101539 GCCGGGGCTGGGGGTGGAGGGGG + Intergenic
1035725196 8:1820256-1820278 TAAGTAGCTGGGACTGGAGGTGG + Intergenic
1035790106 8:2296818-2296840 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1035802699 8:2424887-2424909 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1036202879 8:6784109-6784131 TGAGTGGCTGAGTGGGGAGGGGG - Intergenic
1036434755 8:8723265-8723287 CCAGTGGCTGGGAGGGGAGGTGG - Intergenic
1036447650 8:8836526-8836548 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1036505860 8:9355219-9355241 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1036552273 8:9826145-9826167 TAATTAGCTGGGTGTGGTGGCGG + Intergenic
1036781606 8:11651651-11651673 CACGTGGCGGGGTGTGGAGGCGG - Intergenic
1036797090 8:11764105-11764127 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1036798414 8:11772051-11772073 AAATTGGCTGGGTGTGGTGGTGG + Intronic
1037172765 8:15913168-15913190 CAAGTGGCTAGGGCTGGAGCAGG + Intergenic
1037533727 8:19805518-19805540 TAATTAGCTGGGTGTGGTGGTGG + Intergenic
1037628978 8:20635156-20635178 TTAGGGACTGTGGGTGGAGGAGG + Intergenic
1037716714 8:21407343-21407365 TTAGTGGCTGGGCGTGAGGGTGG - Intergenic
1037723956 8:21467809-21467831 CATGTGGCGGGGGCTGGAGGTGG + Intergenic
1037837399 8:22222210-22222232 TAAGTGGATGGGGTGGCAGGAGG - Intronic
1037843368 8:22261508-22261530 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1037864102 8:22429120-22429142 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1038442163 8:27578879-27578901 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1038795020 8:30702168-30702190 TAATTAGCTGGGCGTGGTGGCGG + Intronic
1038922465 8:32099909-32099931 TCAGTGGATGAAGGTGGAGGGGG + Intronic
1039169599 8:34727928-34727950 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1039297589 8:36173314-36173336 AAAGAGGCTTGGGATGGAGGAGG + Intergenic
1039403691 8:37294683-37294705 CAAGAGGCTGCGGGTGGTGGTGG - Intergenic
1039570011 8:38579241-38579263 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1039838526 8:41277199-41277221 TGGGGGGCTGGGGGTGGAAGAGG - Intronic
1040012900 8:42677073-42677095 AAAGTGTGTGGGGGTGGAGAGGG + Intergenic
1040071154 8:43189743-43189765 AAATTAGCTGGGCGTGGAGGAGG - Intronic
1040855736 8:51946613-51946635 ACAGTGGCTGGGGGGGTAGGGGG - Intergenic
1041105325 8:54437467-54437489 AAATTAGCTGGGCGTGGAGGCGG + Intergenic
1041199006 8:55432157-55432179 TGGGTGGCTGGGGCAGGAGGAGG + Intronic
1041237802 8:55822217-55822239 AAATTTGCTGGGGGTGGTGGCGG - Intronic
1041277859 8:56181564-56181586 TCATTGGCAGGGGGTGGGGGTGG + Intronic
1041512069 8:58663336-58663358 AAAGTGGCCGGGCGTGGTGGCGG + Intergenic
1041540986 8:58984631-58984653 TAATTAGCTGGGTGTGGTGGCGG + Intronic
1041873946 8:62666062-62666084 AAAGTAGCTGGGCGTGGTGGTGG + Intronic
1042554366 8:70021809-70021831 TGAGGGACTGGGAGTGGAGGTGG - Intergenic
1042644383 8:70969892-70969914 TGAATGGTTGGGGGTGGAGAGGG - Intergenic
1042778694 8:72465987-72466009 TAAGTGGTTGAAGGTGGAAGAGG + Intergenic
1042805144 8:72763339-72763361 TAATTGCCTTGGGGAGGAGGGGG - Intronic
1043284775 8:78515574-78515596 TATGTGGCAGGGAGGGGAGGGGG + Intergenic
1043565838 8:81546511-81546533 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1043736046 8:83745268-83745290 AAAGTAGCTGGGTGTGGTGGTGG - Intergenic
1044007115 8:86951428-86951450 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
1044561658 8:93618210-93618232 AAACTGGCTGGGTGTGGTGGTGG - Intergenic
1044761153 8:95519039-95519061 AAAGTGGCGGGGGGCGGCGGTGG + Intergenic
1044983732 8:97740274-97740296 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1045153224 8:99433953-99433975 TAATTAGCTGGGCGTGGTGGTGG - Intronic
1045329744 8:101145268-101145290 TATGTGCATGGTGGTGGAGGTGG - Intergenic
1045420394 8:102008896-102008918 TAGGGGGGCGGGGGTGGAGGTGG - Intronic
1045622968 8:104004315-104004337 TAAGTGGCAGAGGGAGGAAGAGG + Intronic
1045776962 8:105815979-105816001 TGGGTGGCTGGGGGTGGGGTGGG - Intergenic
1046429563 8:114107405-114107427 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1046620881 8:116528474-116528496 AAAGCTGCTGGGGGTGGGGGAGG - Intergenic
1046807650 8:118497716-118497738 TAAGTTGCGGGGGGGGGTGGGGG + Intronic
1046884996 8:119356541-119356563 CATGTGACTGTGGGTGGAGGGGG + Intergenic
1047032911 8:120902760-120902782 TAAGAGGCTGGGGGATGAGGAGG + Intergenic
1047076728 8:121412411-121412433 TAATTAGCTGGGTGTGGTGGCGG - Intergenic
1047272529 8:123375954-123375976 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1047278041 8:123420717-123420739 TAAGTAGCTGGGAGTACAGGTGG + Intronic
1047373764 8:124277164-124277186 CAAGAGGCTTGGGGTGGTGGAGG + Intergenic
1047442076 8:124887357-124887379 AAAGTAGCTGGGTGTGGTGGCGG - Intergenic
1047468889 8:125147729-125147751 AAAGTTGCTGGGGGTTGGGGTGG - Intronic
1047561836 8:125994350-125994372 GAAGGGGGTGGGGGGGGAGGTGG - Intergenic
1047940668 8:129825041-129825063 TCAGTGGCCGGGGGAGGAAGCGG + Intergenic
1048004004 8:130403700-130403722 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1048071878 8:131029851-131029873 TGTGTGGGTGGGGGTGGAGTAGG + Intronic
1048259565 8:132934183-132934205 TAATTAGCTGGGTGTGGTGGTGG + Intronic
1048497497 8:134947289-134947311 TGAGTGGCTGGGGGAAGAGGTGG - Intergenic
1048557438 8:135494426-135494448 AAAGTAGCTGGGCGTGGTGGCGG - Intronic
1048709514 8:137193256-137193278 AAATTGGCTGGGCGTGGCGGCGG + Intergenic
1048881679 8:138877110-138877132 ATTGTGGCTGGGGGTGGGGGAGG - Intronic
1049021056 8:139957943-139957965 TCAGGGGCTGTGGGTGGAGCTGG - Intronic
1049304614 8:141894401-141894423 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1049415796 8:142494482-142494504 TATGTGGCTGGAAGAGGAGGTGG - Intronic
1049846691 8:144805763-144805785 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1049884180 9:16816-16838 TCAGGAGCTGGGGGTGGTGGTGG + Intergenic
1049958665 9:716979-717001 TCTGTGGGTGGGGGTGGTGGGGG + Intronic
1050069129 9:1792018-1792040 TAGGAGACTGGGGGTGGAGTGGG - Intergenic
1050150807 9:2617895-2617917 TCAGCTACTGGGGGTGGAGGGGG - Intergenic
1050281350 9:4053389-4053411 AAAGTGCCTGGGGTGGGAGGAGG - Intronic
1050308959 9:4333737-4333759 GAAGTTGCGGGGGGTGGGGGGGG - Intronic
1050530856 9:6588116-6588138 AAAGGGGGTGGGGGTGGGGGAGG + Intronic
1051336510 9:16070753-16070775 TAAGAAGCCGAGGGTGGAGGTGG - Intergenic
1051356380 9:16243276-16243298 ACAGTGGCTGGCAGTGGAGGGGG - Intronic
1051504080 9:17808836-17808858 GAGGAGGCTGGAGGTGGAGGGGG + Intergenic
1051767481 9:20540569-20540591 GAAGTGGGTGGGGCTGGAGATGG + Intronic
1052295099 9:26889266-26889288 AAATTAGCTGGGTGTGGAGGCGG + Intronic
1052323442 9:27192720-27192742 TGGGTGGGTGGGGATGGAGGTGG + Intronic
1052347699 9:27426835-27426857 TAAGCACATGGGGGTGGAGGTGG - Intronic
1052477159 9:28974254-28974276 AAAGTAGCTGGGCGTGGTGGCGG + Intergenic
1052659269 9:31407240-31407262 TATGGGGCGGGGGGTGGGGGGGG - Intergenic
1052799630 9:32955924-32955946 CAGATGGCTGGGGATGGAGGAGG - Intergenic
1052913409 9:33904801-33904823 TAAATTGGTGGGGCTGGAGGTGG + Intronic
1053298097 9:36929487-36929509 TTAGGGGCTGGGGTTGGCGGGGG - Intronic
1053425836 9:38009293-38009315 GAGGTGGCTGGGGGTGGGGCAGG + Intronic
1053510839 9:38686705-38686727 TATGGGGGTGGGGGTGGGGGTGG + Intergenic
1053603050 9:39630376-39630398 TATGTAGCTGGGCGTGGTGGTGG + Intergenic
1053905884 9:42844395-42844417 AAATTGGCTGGGTGTGGTGGCGG + Intergenic
1054250488 9:62712060-62712082 TATGTAGCTGGGCGTGGTGGTGG - Intergenic
1054296002 9:63332926-63332948 TGAGTGGGTGGGTGGGGAGGAGG + Intergenic
1054469920 9:65527501-65527523 AAATTGGCTGGGCGTGGTGGTGG - Intergenic
1054564596 9:66746572-66746594 TATGTAGCTGGGCGTGGTGGTGG - Intergenic
1054773108 9:69101394-69101416 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1054799074 9:69328877-69328899 TGGGTGGCTAGGGGTGGGGGTGG - Intronic
1054817750 9:69491912-69491934 AAATTGGCTGGGTGTGGTGGTGG - Intronic
1055024484 9:71704941-71704963 TAAGTGGCTGAGGATGTAGTTGG - Intronic
1055091718 9:72370098-72370120 AAACTAGCTGGGGGTGGTGGCGG - Intergenic
1055496090 9:76857209-76857231 TTGATGGATGGGGGTGGAGGGGG - Intronic
1055541507 9:77311072-77311094 AAAGTAGCTGGGTGTGGTGGTGG - Intronic
1055544833 9:77358930-77358952 GAAGTGGTGTGGGGTGGAGGTGG - Intronic
1056188736 9:84164267-84164289 AAATTGGCTGGGCGTGGTGGCGG - Intergenic
1056816917 9:89808598-89808620 GAAGTGGCAGGGGCTGGAGCCGG - Intergenic
1056836081 9:89956632-89956654 AAGGTGGCTGAGAGTGGAGGAGG - Intergenic
1056979092 9:91291308-91291330 TGGGGGGGTGGGGGTGGAGGCGG + Intronic
1057135058 9:92681714-92681736 GAAGGGGCAGGTGGTGGAGGGGG + Intergenic
1057338584 9:94178368-94178390 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1057339370 9:94185766-94185788 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1057420004 9:94903749-94903771 TAATTAGCTGGGTGTGGTGGTGG + Intronic
1057438541 9:95064438-95064460 AAATTGGCTGGGCGTGGTGGTGG - Intronic
1057909477 9:99006521-99006543 AGTGTGGCTGGGGGTGGAGGTGG + Intronic
1058789617 9:108429721-108429743 TATGTGTGTGGGGGTGGGGGTGG - Intergenic
1058860813 9:109116391-109116413 TAAAAGACTGGGGGTGGGGGAGG + Intronic
1058872777 9:109216902-109216924 CAAGTGAGTAGGGGTGGAGGGGG - Exonic
1058979526 9:110156339-110156361 TCAGTGGTGGGGGATGGAGGAGG - Exonic
1058979967 9:110160065-110160087 TAAGTGGGTAGGGGTGGGGATGG - Intronic
1059164207 9:112063275-112063297 GAAGTTGCTGGGGGTGGAGGGGG + Intronic
1059503419 9:114776398-114776420 TAAGTGGCTGCAGGGGGAAGTGG + Intergenic
1059639489 9:116202717-116202739 TAAGGGGAGGGGTGTGGAGGAGG + Intronic
1059657614 9:116370252-116370274 TGTGTGGTAGGGGGTGGAGGTGG - Intronic
1059693538 9:116709233-116709255 CAAGGGGCTGAGGGTGGTGGTGG - Intronic
1059694714 9:116720124-116720146 TCAGGGGTTGTGGGTGGAGGAGG - Intronic
1059791523 9:117645940-117645962 TGTGTGGCTGGGGGTGGTGGGGG + Intergenic
1059808926 9:117834634-117834656 TAATTAGCTGGGCGTGGTGGCGG + Intergenic
1059857163 9:118412728-118412750 AAATTAGCTGGGGGTGGTGGTGG - Intergenic
1060207882 9:121693308-121693330 AAAAGGGCTGGGGGTGGTGGGGG - Intronic
1060239317 9:121889270-121889292 TAAGAGGCTGGAGGTGCACGAGG + Intronic
1060405616 9:123371580-123371602 TAAGTGTCTGGTGGCGGTGGTGG + Intronic
1060513758 9:124252893-124252915 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1060663993 9:125422094-125422116 TATTTGGCTGGGAGTGGTGGTGG + Intergenic
1060878687 9:127102343-127102365 TGTGGGGGTGGGGGTGGAGGGGG + Intronic
1061017446 9:127990112-127990134 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1061087741 9:128409179-128409201 TGGGTGGCTGGGGGTGGGGATGG + Intergenic
1061255880 9:129454044-129454066 CAGGTGGTTGGTGGTGGAGGTGG + Intergenic
1061323294 9:129846072-129846094 AAATTGGCTGGGTGTGGTGGCGG - Intronic
1061388705 9:130305405-130305427 TGACTAGATGGGGGTGGAGGAGG + Intronic
1061620330 9:131807556-131807578 TGACTAGCTGGGGGTGGGGGCGG + Intergenic
1061621199 9:131812384-131812406 TTAGTGGCCGGTGGTGGGGGAGG + Intergenic
1061743903 9:132726029-132726051 TAAATGGCTGGTGATGGTGGTGG - Intronic
1061770233 9:132914046-132914068 AAATTGGCTGGGGATGGTGGCGG - Intronic
1061788417 9:133044890-133044912 TGGGTGGCAGGGGGTGGCGGTGG - Intronic
1061823119 9:133239473-133239495 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1061826592 9:133261805-133261827 TGCGTGGCTGGGGGTGGGGAAGG - Intronic
1062286476 9:135775196-135775218 AACGTGGCTGTGGGTGGAGTGGG + Intronic
1062297938 9:135843722-135843744 AAATTGGCTGGGCGTGGTGGCGG + Intronic
1062311667 9:135941254-135941276 AAAGTAGCTGGGCGTGGTGGCGG + Intronic
1062404541 9:136389020-136389042 TAAGGGGTATGGGGTGGAGGAGG + Intronic
1062413150 9:136434716-136434738 TGAGTGGCTGTGGGTGGTGCTGG - Intronic
1062470586 9:136701884-136701906 GAGGTGCCTGGGGGTGGATGAGG - Intergenic
1062482231 9:136757855-136757877 TGAGGGGTTGGGGGTGTAGGAGG + Intronic
1062494294 9:136824477-136824499 TAATTAGCTGGGTGTGGTGGCGG - Intronic
1185569171 X:1120047-1120069 TAATTAGCTGGGTGTGGTGGTGG - Intergenic
1185644479 X:1607624-1607646 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1185674200 X:1835633-1835655 AAATTAGCTGGGGGTGGTGGCGG - Intergenic
1185746345 X:2576544-2576566 AAAGTAGCTGGGTGTGGTGGTGG + Intergenic
1186097492 X:6117713-6117735 ACAGTGGCTGGGGATTGAGGGGG - Intronic
1186364324 X:8875380-8875402 TAAGAGGCTGAGAGTGGAGAGGG + Intergenic
1186389821 X:9147938-9147960 GCTGTGGCTGGGGGTGGGGGAGG - Intronic
1186641083 X:11456578-11456600 CCAGTGGCAAGGGGTGGAGGTGG + Intronic
1186771410 X:12821437-12821459 TCAGGGTCTGGGGGTGGGGGGGG + Intronic
1186880576 X:13862058-13862080 TGCGTGGGTGGGGGTGCAGGGGG + Intronic
1187252555 X:17612042-17612064 TAACATGCTGGGGGTGTAGGGGG - Intronic
1187343557 X:18442641-18442663 AAAGTAGCCGGGCGTGGAGGCGG - Intronic
1187408054 X:19022112-19022134 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
1187417380 X:19104765-19104787 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1187444258 X:19346466-19346488 TAATTGGCTGGGTGTGGTGGTGG - Intronic
1187481262 X:19657905-19657927 CCAGGGGCTGGGGGTGGGGGCGG + Intronic
1187868229 X:23743101-23743123 TAGGTGGCGGGGCGTGGAAGGGG - Intronic
1187886312 X:23892233-23892255 TAATTAGCTGGGTGTGGTGGTGG - Intronic
1188176865 X:27001739-27001761 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1188364932 X:29304031-29304053 TAAGTGTGTGCCGGTGGAGGAGG - Intronic
1188464253 X:30460934-30460956 GTAGTGGCTGGGGCTGGGGGAGG - Intergenic
1189111227 X:38291987-38292009 AGTGTAGCTGGGGGTGGAGGGGG - Intronic
1189171674 X:38915436-38915458 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1189287135 X:39859659-39859681 AAATTGGCTGGGTGTGGTGGTGG + Intergenic
1189566399 X:42246104-42246126 TATGTTGCTGAGGGTGGAAGTGG - Intergenic
1189627588 X:42915755-42915777 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1189664520 X:43339680-43339702 AAAGTAGCTGGGTGTGGTGGCGG + Intergenic
1189732190 X:44033240-44033262 TTAGTGGCTAGAGGAGGAGGAGG + Intergenic
1189973461 X:46440243-46440265 TAAGTAGTTGGTGGTGCAGGAGG + Intergenic
1190080433 X:47352983-47353005 CTAGGGGCTGGGGGTGAAGGGGG - Intergenic
1190109478 X:47580781-47580803 AAATTAGCTGGGGGTGGTGGTGG + Intronic
1190323720 X:49193677-49193699 TATGTGGCTGTGGGTGTTGGGGG + Intronic
1190715625 X:53100646-53100668 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1190854377 X:54278916-54278938 AAATTAGCTGGGGGTGGTGGCGG + Intronic
1191743099 X:64456601-64456623 GAAGTTGCTGAGGGTGGAGCTGG + Intergenic
1191756719 X:64601201-64601223 TCAGGGGGTGGGGGTGCAGGCGG - Intergenic
1192215763 X:69156996-69157018 TCAGAGGCTGGGGGTGGGAGTGG + Intergenic
1192461011 X:71317589-71317611 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1192474442 X:71427787-71427809 AAATTAGCTGGGCGTGGAGGCGG + Intronic
1192574229 X:72230023-72230045 AAATTGGCTGGGCGTGGTGGTGG + Intronic
1192754227 X:74029573-74029595 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1193129949 X:77909232-77909254 TATGTGGATGAGTGTGGAGGGGG + Intergenic
1193194241 X:78611151-78611173 TCAGGGGGTGGGGGTGGAGGTGG - Intergenic
1193247669 X:79248836-79248858 TAGGTGCCTGTGGGTGGTGGTGG + Intergenic
1193299078 X:79867800-79867822 CAGTTGGCGGGGGGTGGAGGGGG - Intergenic
1193424498 X:81325946-81325968 TAACTAGCTTGGAGTGGAGGTGG + Intergenic
1193649870 X:84117939-84117961 TGTGTGGCAGGGGGTGGTGGTGG - Intronic
1193669277 X:84364650-84364672 AAATTAGCTGGGCGTGGAGGCGG - Intronic
1193693333 X:84675142-84675164 GAAGGGGCTGGGGAGGGAGGTGG + Intergenic
1193848086 X:86499858-86499880 CAACTGGCTGAGGGTGGAGCGGG + Intronic
1193850297 X:86529620-86529642 AAATTAGCTGGGTGTGGAGGCGG - Intronic
1193867789 X:86757727-86757749 TACGTGGCTGGAGCAGGAGGAGG - Intronic
1193990445 X:88300224-88300246 AAAGTAGCTGGGCGTGGTGGCGG - Intergenic
1194321268 X:92448533-92448555 TACATGGCAGGGGGTGGAGGGGG - Intronic
1194378364 X:93163953-93163975 AAAGTAGCTGGGCGTGGTGGTGG - Intergenic
1194592561 X:95817256-95817278 AAAGTAGCAGGGCGTGGAGGTGG - Intergenic
1194786227 X:98087320-98087342 CAAATGGTTGGGGGTGGTGGTGG + Intergenic
1194894370 X:99421466-99421488 TATTTAGCTGGAGGTGGAGGAGG + Intergenic
1195032959 X:100944510-100944532 TAATTAGCTGGGTGTGGTGGCGG - Intergenic
1195037401 X:100982340-100982362 AAATTGGCTGGGTGTGGTGGTGG + Intronic
1195212192 X:102660652-102660674 AAACTGGCGGAGGGTGGAGGAGG + Intergenic
1195218231 X:102721398-102721420 AAACTGGCGGAGGGTGGAGGAGG + Intronic
1195696980 X:107674544-107674566 AAATTGGTTGGGGGTGGAGGAGG - Intergenic
1195741869 X:108072941-108072963 TCAGTGGTGGCGGGTGGAGGGGG + Intronic
1196031899 X:111100796-111100818 AAGGTGGCTGGGGGTGGAGTTGG + Intronic
1196363288 X:114893060-114893082 AAAGTAGCTGGGTGTGGTGGCGG - Intronic
1196667399 X:118330970-118330992 AAACTGGCTGGGCGTGGTGGCGG + Intergenic
1196762856 X:119215415-119215437 CCAGAGGCTGGGGGTGGCGGTGG + Intergenic
1196916855 X:120545855-120545877 TTATTGGCAGGGGGTGGGGGTGG + Intronic
1197308198 X:124869835-124869857 TAGGGGGCTGTGGGGGGAGGTGG + Intronic
1197645945 X:129016670-129016692 GAAGGGGGTAGGGGTGGAGGGGG - Intergenic
1197765508 X:130057189-130057211 TGAGGGGCTGAGGGAGGAGGTGG - Exonic
1197767570 X:130069072-130069094 AAAGTAGCTGGGTGTGGTGGTGG + Intronic
1197809430 X:130428222-130428244 AAATTGGCTGGGCGTGGTGGTGG + Intergenic
1197869390 X:131050986-131051008 TCAGTTGCTGTGGGTGGAGGTGG - Intergenic
1197873398 X:131081580-131081602 TATGGGGGTGGGGGTAGAGGGGG - Exonic
1197936810 X:131747858-131747880 AAATTAGCTGGGGGTGGTGGCGG + Intergenic
1198001544 X:132443992-132444014 TAAGTAGGTGGGGGGGGGGGGGG - Intronic
1198002065 X:132449979-132450001 GAAGTGGCGGGGGGGGGGGGGGG - Intronic
1198014932 X:132600914-132600936 TATGTGGCTGGGCTTGGAGTAGG + Intergenic
1198079301 X:133223885-133223907 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1198082636 X:133253474-133253496 AAAGTAGCTGGGCGTGGTGGTGG + Intergenic
1198187859 X:134271830-134271852 AAATTGGCTGGGTGTGGTGGTGG - Intergenic
1198205204 X:134459496-134459518 AAATTAGCTGGGCGTGGAGGCGG - Intergenic
1198211983 X:134524865-134524887 TAAGTGGCTGGGATTACAGGTGG + Intergenic
1198278627 X:135120680-135120702 GAAGTTGCTGGGAGAGGAGGTGG + Intergenic
1198292334 X:135251836-135251858 GAAGTTGCTGGGAGAGGAGGTGG - Intronic
1198516078 X:137408622-137408644 AAATTGGCTGGGCGTGGTGGCGG + Intergenic
1198551457 X:137749542-137749564 GATTTGGGTGGGGGTGGAGGTGG + Intergenic
1198755653 X:139979433-139979455 TGGGAGGCTGGGGGTGGGGGTGG + Intergenic
1198823353 X:140673072-140673094 TGTGTGGTTGGGGGTGGTGGTGG + Intergenic
1199148000 X:144394371-144394393 AAAATAGCTGGGGGTGGTGGTGG + Intergenic
1199259167 X:145750635-145750657 TTAGTGGCGGGGGGAGGAGGTGG + Intergenic
1199544675 X:148995470-148995492 AAAGGGGGTGGGGGTGGGGGCGG + Exonic
1199682594 X:150237327-150237349 TATGTGTGTGTGGGTGGAGGAGG - Intergenic
1199758841 X:150890001-150890023 AAATTAGCTGGGCGTGGAGGTGG + Intronic
1200036549 X:153334857-153334879 TGAGTGGGTGGGAGTGGGGGGGG + Intronic
1200041993 X:153377575-153377597 TGAGGGGCTGGAGGGGGAGGTGG + Intergenic
1200064310 X:153497302-153497324 CGAGGGGCTGGGGGTGGCGGTGG + Intronic
1200097982 X:153673142-153673164 TGCCTGGCAGGGGGTGGAGGAGG - Intronic
1200126184 X:153816119-153816141 CGAGGGGCTGGGGGTGGCGGTGG - Intronic
1200401623 X:156023340-156023362 TCAGGAGCTGGGGGTGGTGGTGG - Intergenic
1200629385 Y:5561680-5561702 TACATGGCAGGGGGTGGAGGGGG - Intronic