ID: 1170886086

View in Genome Browser
Species Human (GRCh38)
Location 20:20340797-20340819
Sequence TGCCCGCGTTGCTGTTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170886086_1170886090 18 Left 1170886086 20:20340797-20340819 CCACCTAAACAGCAACGCGGGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1170886090 20:20340838-20340860 CCATGTTCTGATCCAGCGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 94
1170886086_1170886093 25 Left 1170886086 20:20340797-20340819 CCACCTAAACAGCAACGCGGGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1170886093 20:20340845-20340867 CTGATCCAGCGAGTGGGCGTGGG No data
1170886086_1170886091 19 Left 1170886086 20:20340797-20340819 CCACCTAAACAGCAACGCGGGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1170886091 20:20340839-20340861 CATGTTCTGATCCAGCGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 142
1170886086_1170886092 24 Left 1170886086 20:20340797-20340819 CCACCTAAACAGCAACGCGGGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1170886092 20:20340844-20340866 TCTGATCCAGCGAGTGGGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 73
1170886086_1170886094 26 Left 1170886086 20:20340797-20340819 CCACCTAAACAGCAACGCGGGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1170886094 20:20340846-20340868 TGATCCAGCGAGTGGGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170886086 Original CRISPR TGCCCGCGTTGCTGTTTAGG TGG (reversed) Intronic
902961156 1:19963560-19963582 TGCACGCGTTTCTGGATAGGGGG + Intergenic
909383228 1:75025573-75025595 TGTTCACGTTGCTTTTTAGGAGG - Intergenic
913686203 1:121234416-121234438 AGCCGGCATTGCTGTTTAGATGG + Intronic
917911955 1:179657637-179657659 TGCCCGCTTTGCTGTTTTCTGGG + Intronic
919911406 1:202113197-202113219 TGCCACAGTTCCTGTTTAGGTGG - Intergenic
920473526 1:206252975-206252997 AGCCGGCATTGCTGTTTAGATGG + Intronic
920890970 1:209985449-209985471 TGCCCCTGTGGCTTTTTAGGGGG + Intronic
1070800287 10:79241331-79241353 TGCCTGCGGTGCTGCTTGGGAGG + Intronic
1074826725 10:117220178-117220200 GGCCCCCATTACTGTTTAGGAGG + Intergenic
1082184526 11:49163452-49163474 TGCCATCTTTGCTGTTTGGGTGG - Intronic
1088977932 11:114832350-114832372 TGCCAGCACTGCTGTTTAGGAGG + Intergenic
1105012707 12:132766374-132766396 TGCCCTCGTTACTGATGAGGTGG - Intergenic
1113542305 13:111118340-111118362 TTCCCGCTTTGCTTTTAAGGTGG + Intronic
1124861318 15:33444699-33444721 TGCCAGCTTTGCTGTGTGGGTGG - Intronic
1139634953 16:68252849-68252871 TGCCTGCCTAGCTGTTCAGGAGG + Intronic
1146667588 17:34715355-34715377 TGGCCGGGTAGATGTTTAGGAGG + Intergenic
1159209527 18:65298810-65298832 TTCCCCCTTTGCCGTTTAGGCGG + Intergenic
1163736270 19:18983042-18983064 TGCCCTCATTGCTGTCTATGAGG + Intergenic
1164237485 19:23349773-23349795 TGCCCACGTTAATGTTTTGGAGG - Intronic
926105997 2:10151593-10151615 TGGCCACATTGCTGTTGAGGAGG + Intronic
940022422 2:149169322-149169344 TGCCAGCTTTGCTTTTTAGTAGG - Intronic
946164652 2:217856603-217856625 TGCCCTCTTTGCTGTTTCAGAGG - Intronic
1170886086 20:20340797-20340819 TGCCCGCGTTGCTGTTTAGGTGG - Intronic
1178804271 21:35825410-35825432 GACCCTCGTTTCTGTTTAGGGGG - Intronic
1184724524 22:46335820-46335842 TGGCCGCGCTGCTGCTGAGGCGG + Exonic
1184987324 22:48144713-48144735 TGCAGGAGTTGCTGTTTGGGAGG - Intergenic
977461265 4:97328539-97328561 TTCCCTGGTTGCTGTTTGGGAGG + Intronic
992207021 5:74441026-74441048 AGCCCACTTTGCTGTTTTGGAGG + Intergenic
997226239 5:132211419-132211441 TGCCCAGGTTGCTGTTAATGGGG - Intronic
1002598999 5:180343338-180343360 TGCCCCCGCTGCTGTCCAGGAGG - Intronic
1004147219 6:13078927-13078949 TGCCCATTTTGCTGTTTGGGGGG + Intronic
1011600028 6:89051365-89051387 TGCCTACATTGCTATTTAGGAGG + Intergenic
1025703042 7:63837521-63837543 TATCCCCGTTGCTGTTTAGAGGG - Intergenic
1055030873 9:71770146-71770168 AGCTCGCGCTGCTGTTTTGGAGG - Intronic
1194360972 X:92950214-92950236 GTCCAGAGTTGCTGTTTAGGAGG + Intergenic
1200669171 Y:6066026-6066048 GTCCAGAGTTGCTGTTTAGGAGG + Intergenic