ID: 1170886087

View in Genome Browser
Species Human (GRCh38)
Location 20:20340800-20340822
Sequence ACTTGCCCGCGTTGCTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170886087_1170886096 28 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886096 20:20340851-20340873 CAGCGAGTGGGCGTGGGGTGAGG 0: 1
1: 0
2: 3
3: 56
4: 576
1170886087_1170886091 16 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886091 20:20340839-20340861 CATGTTCTGATCCAGCGAGTGGG 0: 1
1: 0
2: 1
3: 13
4: 142
1170886087_1170886093 22 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886093 20:20340845-20340867 CTGATCCAGCGAGTGGGCGTGGG No data
1170886087_1170886094 23 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886094 20:20340846-20340868 TGATCCAGCGAGTGGGCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 78
1170886087_1170886090 15 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886090 20:20340838-20340860 CCATGTTCTGATCCAGCGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 94
1170886087_1170886092 21 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886092 20:20340844-20340866 TCTGATCCAGCGAGTGGGCGTGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170886087 Original CRISPR ACTTGCCCGCGTTGCTGTTT AGG (reversed) Intronic
902334104 1:15744979-15745001 ACTTCCCCGCCTGGCTGTTGAGG - Intronic
907055018 1:51358407-51358429 ATTTGCCAAGGTTGCTGTTTGGG - Intronic
1063990552 10:11557320-11557342 ACTTGCCTCCTTTGCTGTATTGG - Intronic
1069900095 10:71702099-71702121 TCTTGCCCGTGGTGCTGTTGAGG - Intronic
1071953348 10:90729568-90729590 CTTTGCCCACGTTGGTGTTTAGG + Intergenic
1073715726 10:106104943-106104965 ACTTACCTGCCTTTCTGTTTGGG - Intergenic
1076235869 10:128863495-128863517 ACTTGCCAACCTTGCTCTTTGGG - Intergenic
1076369522 10:129942559-129942581 AGTTGTCTGCTTTGCTGTTTGGG - Intronic
1076453970 10:130576470-130576492 ACTTGCACGCGGGGCTGTATGGG + Intergenic
1090420786 11:126573476-126573498 ACTTTCCCTCCTTGCTGTGTGGG - Intronic
1100679146 12:96899894-96899916 GCTTGCCCTGGTTGCTCTTTGGG + Intergenic
1106382584 13:29254520-29254542 ACGTGGCCGTGTTGCTGTTCTGG + Intronic
1108650513 13:52474018-52474040 ACTTGTCCTCGTTTCTGTATTGG - Exonic
1114272499 14:21110585-21110607 ACTTGCCCTAGTTTCTGTATTGG + Intergenic
1116817701 14:49599058-49599080 ACTTGCCCGCCTTGGGGCTTAGG + Exonic
1121073160 14:91043576-91043598 ACTTCACTGGGTTGCTGTTTAGG + Intronic
1152319285 17:79599126-79599148 ACTTGCCCCCGTGGGTGTCTTGG - Intergenic
1161483490 19:4522569-4522591 ACTCGCTTGCTTTGCTGTTTGGG - Exonic
1165422173 19:35727681-35727703 ACTTCCCCGCTTTGCAGTGTGGG + Exonic
930774363 2:55158065-55158087 AATTTCCTGCTTTGCTGTTTGGG - Intergenic
949024272 2:241758280-241758302 ACTTGCCAGTGGAGCTGTTTGGG + Intronic
1168855976 20:1009312-1009334 AGTTGCCCACGGTGCTGTCTGGG + Intergenic
1170886087 20:20340800-20340822 ACTTGCCCGCGTTGCTGTTTAGG - Intronic
1178804274 21:35825413-35825435 ACTGACCCTCGTTTCTGTTTAGG - Intronic
1179079911 21:38161164-38161186 ACTTCCCCAAGCTGCTGTTTCGG - Intronic
951591278 3:24267781-24267803 ACTTGCCCACGCTGCTTTTGGGG + Intronic
967699202 3:192571722-192571744 AGTTGCTCGCGTTGCTGCTTTGG - Intronic
968279551 3:197465817-197465839 ACTTGCTTTGGTTGCTGTTTAGG + Intergenic
972330059 4:38056253-38056275 AATTGCCCTCGTCACTGTTTGGG + Intronic
973778139 4:54262501-54262523 TCTTGCCATCCTTGCTGTTTTGG + Intronic
985269680 4:188182120-188182142 TCTTGCCAGCATTGGTGTTTGGG - Intergenic
1004170849 6:13294518-13294540 CTTTGCCCACGTTGTTGTTTGGG - Intronic
1008557929 6:52693377-52693399 ATTTGCCCAATTTGCTGTTTTGG - Intergenic
1023305872 7:38826234-38826256 ACTTGCCCTTGTTACTGTTTTGG - Intronic
1029409702 7:100401020-100401042 ACTTCCCCGTGGCGCTGTTTGGG - Exonic
1053569495 9:39288993-39289015 ACTTGCAGGGGTTGCTCTTTTGG - Intergenic
1053835456 9:42130013-42130035 ACTTGCAGGGGTTGCTCTTTTGG - Intergenic
1054091126 9:60847978-60848000 ACTTGCAGGGGTTGCTCTTTTGG - Intergenic
1054112537 9:61123534-61123556 ACTTGCAGGGGTTGCTCTTTTGG - Intergenic
1054127651 9:61330016-61330038 ACTTGCAGGGGTTGCTCTTTTGG + Intergenic
1054595169 9:67058597-67058619 ACTTGCAGGGGTTGCTCTTTTGG + Intergenic
1055030874 9:71770149-71770171 ACTAGCTCGCGCTGCTGTTTTGG - Intronic
1057629517 9:96707865-96707887 AGTTGCCTGGGGTGCTGTTTGGG + Intergenic