ID: 1170886093

View in Genome Browser
Species Human (GRCh38)
Location 20:20340845-20340867
Sequence CTGATCCAGCGAGTGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170886086_1170886093 25 Left 1170886086 20:20340797-20340819 CCACCTAAACAGCAACGCGGGCA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1170886093 20:20340845-20340867 CTGATCCAGCGAGTGGGCGTGGG No data
1170886087_1170886093 22 Left 1170886087 20:20340800-20340822 CCTAAACAGCAACGCGGGCAAGT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1170886093 20:20340845-20340867 CTGATCCAGCGAGTGGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170886093 Original CRISPR CTGATCCAGCGAGTGGGCGT GGG Intronic
No off target data available for this crispr