ID: 1170891393

View in Genome Browser
Species Human (GRCh38)
Location 20:20379011-20379033
Sequence GACTTAGGAGGCCCGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170891393_1170891397 6 Left 1170891393 20:20379011-20379033 CCATGCTTCGGGCCTCCTAAGTC No data
Right 1170891397 20:20379040-20379062 TGTATTTTAACAGGATCCCCAGG No data
1170891393_1170891396 -3 Left 1170891393 20:20379011-20379033 CCATGCTTCGGGCCTCCTAAGTC No data
Right 1170891396 20:20379031-20379053 GTCAGAATCTGTATTTTAACAGG No data
1170891393_1170891398 7 Left 1170891393 20:20379011-20379033 CCATGCTTCGGGCCTCCTAAGTC No data
Right 1170891398 20:20379041-20379063 GTATTTTAACAGGATCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170891393 Original CRISPR GACTTAGGAGGCCCGAAGCA TGG (reversed) Intergenic
No off target data available for this crispr