ID: 1170892540

View in Genome Browser
Species Human (GRCh38)
Location 20:20388373-20388395
Sequence CCCTGGAGATGCCCCCGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170892540_1170892546 1 Left 1170892540 20:20388373-20388395 CCAGGGCGGGGGCATCTCCAGGG No data
Right 1170892546 20:20388397-20388419 GATTATCCAGGGAGTCCTGAGGG No data
1170892540_1170892545 0 Left 1170892540 20:20388373-20388395 CCAGGGCGGGGGCATCTCCAGGG No data
Right 1170892545 20:20388396-20388418 AGATTATCCAGGGAGTCCTGAGG No data
1170892540_1170892543 -10 Left 1170892540 20:20388373-20388395 CCAGGGCGGGGGCATCTCCAGGG No data
Right 1170892543 20:20388386-20388408 ATCTCCAGGGAGATTATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170892540 Original CRISPR CCCTGGAGATGCCCCCGCCC TGG (reversed) Intergenic
No off target data available for this crispr