ID: 1170894830

View in Genome Browser
Species Human (GRCh38)
Location 20:20403630-20403652
Sequence CTGCATGCCCAGATGTTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170894825_1170894830 6 Left 1170894825 20:20403601-20403623 CCTGGTCCGGAGCGCCCAGCCTC 0: 1
1: 0
2: 1
3: 16
4: 219
Right 1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1170894824_1170894830 7 Left 1170894824 20:20403600-20403622 CCCTGGTCCGGAGCGCCCAGCCT 0: 1
1: 0
2: 0
3: 4
4: 128
Right 1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1170894826_1170894830 0 Left 1170894826 20:20403607-20403629 CCGGAGCGCCCAGCCTCACGAAG 0: 1
1: 0
2: 2
3: 16
4: 224
Right 1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1170894827_1170894830 -8 Left 1170894827 20:20403615-20403637 CCCAGCCTCACGAAGCTGCATGC 0: 1
1: 0
2: 2
3: 13
4: 109
Right 1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG 0: 1
1: 0
2: 0
3: 13
4: 141
1170894828_1170894830 -9 Left 1170894828 20:20403616-20403638 CCAGCCTCACGAAGCTGCATGCC 0: 1
1: 0
2: 2
3: 6
4: 165
Right 1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG 0: 1
1: 0
2: 0
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170894830 Original CRISPR CTGCATGCCCAGATGTTACC TGG Intronic
901451705 1:9339999-9340021 CTGCATGCCCAGGTGGTTCAGGG - Intronic
904509552 1:30992480-30992502 CTCCATGCCCACATGTTCCATGG + Exonic
905105994 1:35563906-35563928 CTGGATCCCCAGTTCTTACCTGG - Exonic
905503370 1:38456697-38456719 CTGCATCTCCAGATGTTCTCTGG - Intergenic
912822387 1:112878531-112878553 CTGCATCCCCAGAGGTTTCAGGG - Intergenic
914439424 1:147690896-147690918 CTGCATTCCCAGAGTTTTCCTGG - Intergenic
915583171 1:156828352-156828374 CTGCATGCCAGCATTTTACCAGG - Intronic
917749129 1:178038323-178038345 CTACATGTGCAGATGTGACCTGG + Intergenic
918287352 1:183070436-183070458 GTGGATGCCCAGATGTTCCTGGG + Intronic
920020511 1:202952303-202952325 CTCCATGTGCAGTTGTTACCTGG - Intronic
921299980 1:213742768-213742790 CTGCATGCACAGAAAGTACCAGG + Intergenic
922064336 1:222122496-222122518 CTGTACGACCAAATGTTACCAGG + Intergenic
1063475852 10:6328330-6328352 AGGCCTGCCCAAATGTTACCCGG - Intergenic
1065002540 10:21350249-21350271 GTACATGCCCAGATGGGACCAGG + Intergenic
1065561864 10:26971795-26971817 CTTCCTGCCCAGCTTTTACCTGG + Intergenic
1067260427 10:44685078-44685100 CAGCATGCCCACATGGAACCAGG + Intergenic
1070767517 10:79065306-79065328 CTGCAGGCCCAGAAGTCACCTGG - Intergenic
1071306316 10:84302315-84302337 CTCCATGGCCAGATGTGACAGGG - Intergenic
1076031017 10:127158539-127158561 CTGAACGCCCAGAAGGTACCAGG - Intronic
1077274507 11:1697572-1697594 CTGCAAGCCCTGCTGTTCCCAGG + Exonic
1078823440 11:14905528-14905550 CTGCAGGCCCGAAGGTTACCAGG - Intronic
1079270728 11:18983286-18983308 CTGCATTTCCAGATGTTCCTGGG - Intergenic
1081337343 11:41882867-41882889 TTGCATGCCCAGATGCTTCAGGG + Intergenic
1090821447 11:130345975-130345997 CTGCATGTACAGTTGTTATCTGG + Intergenic
1090859270 11:130638659-130638681 GGGCATCCACAGATGTTACCTGG - Intergenic
1091492979 12:949152-949174 CGGCATGCCCCCATGTTCCCTGG - Intronic
1092533602 12:9365685-9365707 CTTCATGCACAGAAGTTACAGGG - Intergenic
1101363851 12:104053350-104053372 CTGTATGCACAGATTTTCCCTGG + Intronic
1101823250 12:108200528-108200550 CTACATGCCCAGATCTTTGCTGG + Intronic
1101823930 12:108206022-108206044 CTGGATGCCCAGCTGTCACCAGG + Intronic
1102651300 12:114444355-114444377 CTGGAGGCCCAGCTGTGACCAGG - Intergenic
1110273107 13:73613644-73613666 CTGCATACACAGGTGTCACCTGG - Intergenic
1110564079 13:76940509-76940531 CTGCATGCCCAGATTCTTCTTGG + Intergenic
1112356414 13:98677757-98677779 CTGAATCACCAGATGTTAGCAGG + Intergenic
1112760151 13:102686449-102686471 GTGACTGCCCAGATGTTTCCAGG - Intronic
1114256012 14:21001899-21001921 CTGGTTGCCTAGATGCTACCTGG + Intergenic
1114300228 14:21369476-21369498 CTGCATACCAATATATTACCTGG - Intronic
1117422138 14:55557343-55557365 CTGCATGCCAGGATGTTGCCTGG - Intergenic
1118389292 14:65282660-65282682 CAGCATGCCCAGAAGCTTCCGGG - Intergenic
1119032198 14:71201422-71201444 CTGCATCCCCAGCTGTTTCCAGG - Intergenic
1119643419 14:76330836-76330858 CTGCATTCCCAGATTCTCCCAGG - Intronic
1121660882 14:95634126-95634148 CTGAATTCCCAGATGGAACCTGG + Intergenic
1122261018 14:100523079-100523101 CTGCATGCCAGGATGTTGCTGGG + Intronic
1122832112 14:104403516-104403538 CTGCATGCCCACCTGGTACCAGG + Intergenic
1122969218 14:105145700-105145722 CTGCAAGCTCAGATGCCACCAGG + Intronic
1129518880 15:76173233-76173255 CTGCACCTCCAGATGTTTCCTGG - Intronic
1129533978 15:76295689-76295711 TTGCATGCTCAGCTATTACCAGG + Exonic
1130161313 15:81403467-81403489 CTGCATCCCCAAAAGTTCCCAGG - Intergenic
1131184583 15:90263912-90263934 CTGCAATCCCACATGTTCCCCGG + Exonic
1134506939 16:14815403-14815425 CTGCAGGCACAGATTCTACCTGG - Intronic
1134573623 16:15313418-15313440 CTGCAGGCACAGATTCTACCTGG + Intergenic
1134728803 16:16442898-16442920 CTGCAGGCACAGATTCTACCTGG - Intergenic
1134938640 16:18269026-18269048 CTGCAGGCACAGATTCTACCTGG + Intergenic
1135049810 16:19183738-19183760 CAGCATGCCCAGCTGGTACTTGG - Exonic
1137024357 16:35457716-35457738 CTGCCTGCCCAGGGGTTCCCAGG - Intergenic
1139284466 16:65798143-65798165 CTCCATGCCCACATGTGATCCGG + Intergenic
1139371880 16:66474020-66474042 CTGCATGCCCAGAAGTCCCCTGG + Intronic
1141262936 16:82470142-82470164 CAGCATCCCCAGATGTCACATGG + Intergenic
1141504385 16:84464985-84465007 CTGCATCCCCAGCTCTTCCCTGG - Intergenic
1142237116 16:88927574-88927596 CTGCATGCCAGGCTGGTACCTGG - Intronic
1144023744 17:11259739-11259761 CTCCATGCCCAAATATTAACTGG + Intronic
1144949936 17:18988683-18988705 CAGCATTCCCAGGTGTTACAAGG - Intronic
1148312917 17:46664054-46664076 CTGACTGCCCAGATGGTATCAGG + Intronic
1151033715 17:70772972-70772994 TTGCATGCCAAGACATTACCAGG + Intergenic
1152397124 17:80040237-80040259 CTGCTGGCCCAGAGGTGACCTGG - Exonic
1153748619 18:8206952-8206974 CTGGTGGCCCAGATGTTCCCTGG - Intronic
1154322555 18:13366982-13367004 CTGCCTGTCCAGAAGTCACCAGG - Intronic
1158672911 18:59492839-59492861 CTCCATGCACAGTTGTTACTGGG - Intronic
1160425065 18:78773725-78773747 CTGCCTGCCCAGGGGTTCCCTGG - Intergenic
1161705176 19:5816999-5817021 ATGCATACTCAGATGTTTCCAGG - Intergenic
1162183627 19:8888043-8888065 CTGGAGTCCCAGATGTTCCCAGG + Exonic
1163633298 19:18427662-18427684 CTCCCTGCCCAGATGTTCTCTGG + Intronic
1164726573 19:30469477-30469499 CTGCTTGCCCATTAGTTACCAGG + Intronic
1165421554 19:35724560-35724582 CTACAACCCCAAATGTTACCTGG - Intronic
1166047235 19:40236590-40236612 CTCCCTGCCCAGCTGTTCCCAGG - Intronic
1166728005 19:45040373-45040395 TTCCAAGCCCAGATTTTACCAGG - Intronic
925526221 2:4805265-4805287 CAGCATTCCCATATGTTATCAGG - Intergenic
926212434 2:10880666-10880688 GTGCGGGCCCAGATGTGACCAGG - Intergenic
926345347 2:11939909-11939931 CAGGAAGCTCAGATGTTACCAGG + Intergenic
928435027 2:31249348-31249370 CTGCATGGGCAGAGGTAACCTGG - Intronic
929932373 2:46268881-46268903 CTCCAGGCTCAGATGTAACCTGG + Intergenic
931250709 2:60528582-60528604 CTTCCTGCCCAGTTGTTGCCTGG + Intronic
934066366 2:88345655-88345677 ATCAATGCCCAGATGTTCCCAGG - Intergenic
934232628 2:90199186-90199208 ATGCCTCCCCAGATGTTCCCAGG + Intergenic
934732793 2:96669937-96669959 CTCAATGCCCAGAGGTTTCCCGG + Intergenic
937885411 2:126896353-126896375 ATTCATGCCCAAATGTTAACGGG + Intergenic
940369239 2:152881683-152881705 CTGCATGTGCAGGTGTTCCCTGG + Intergenic
941306991 2:163882249-163882271 TTGCATGTGCAGGTGTTACCTGG + Intergenic
944912921 2:204327934-204327956 TTGCATTTCCAGATGTTCCCAGG - Intergenic
947648181 2:231760589-231760611 CTGCATACCCAGTTTGTACCAGG + Intronic
948919206 2:241053419-241053441 CTGGATGCCCAGCTCTGACCTGG + Intronic
1169274845 20:4226780-4226802 CTGCATGCAGACATGTTGCCTGG + Intronic
1170894830 20:20403630-20403652 CTGCATGCCCAGATGTTACCTGG + Intronic
1171148300 20:22804810-22804832 CTGCATGCCCATGTGGTACTTGG + Intergenic
1171218764 20:23374280-23374302 CTGCATCAACAGAAGTTACCAGG + Intergenic
1172407976 20:34703747-34703769 CTACATTCCCAGATGCTCCCCGG + Intronic
1174067794 20:47878352-47878374 CTGCAAGCCCAGAGGTGCCCAGG + Intergenic
1175043091 20:56074698-56074720 CTGCATGTGCAGATGTTATCTGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1184846162 22:47088769-47088791 CGGCAGGTCCAGGTGTTACCAGG - Intronic
1185110533 22:48897853-48897875 CTGGAGGCCCACATGTCACCAGG - Intergenic
949313703 3:2728661-2728683 ATGCATGCACAGAAGTAACCTGG - Intronic
949512270 3:4776784-4776806 CTGCAAACGGAGATGTTACCTGG + Intronic
951604278 3:24415187-24415209 CTGCATGTACAGGTGTTCCCTGG + Intronic
952269301 3:31816636-31816658 CTGCAGCCACAGATGTTTCCAGG - Intronic
953817393 3:46170583-46170605 CAGCATGCCCAGCTGGTGCCAGG - Intronic
961380096 3:126491478-126491500 CTGGAAGCCCAGGTGTTCCCGGG - Intronic
962737054 3:138335132-138335154 CTGCATGTGCAGGTGTCACCTGG + Intergenic
965406233 3:168273069-168273091 CTGAATCCACAGATATTACCTGG - Intergenic
966285765 3:178293700-178293722 CTTCAAGCCCAGATGTGATCCGG - Intergenic
968835603 4:2962554-2962576 ATGCATGCCCAGCCCTTACCAGG + Intronic
969446968 4:7250716-7250738 CTGCCTGCCCAGCTGTTCCTCGG - Intronic
970292322 4:14586778-14586800 CTGCATGGCCAGATTGTACACGG + Intergenic
974233552 4:59149465-59149487 CTGCAGGCCCAGGTGTTAATTGG + Intergenic
974620008 4:64341786-64341808 CTGCTTCCCCAGCTGTCACCAGG - Intronic
975822951 4:78290352-78290374 CTGCAGGCGCAGATGTTATGGGG + Intronic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
983354628 4:166639787-166639809 CTGCATGCCCAGGAGTCACCTGG - Intergenic
985915869 5:2918804-2918826 CTTCCTGCCCACATCTTACCAGG + Intergenic
990515202 5:56524758-56524780 CTGCAAGCCCAAATGCTTCCAGG - Intronic
993804707 5:92391040-92391062 GTGGATGCCAAGAAGTTACCAGG + Intergenic
994294193 5:98069294-98069316 CTGCAGGACCAGATGCTACTAGG + Intergenic
994946111 5:106394149-106394171 TTCCATGACTAGATGTTACCTGG - Intergenic
1000838931 5:166191674-166191696 CTGCATCCCAAGTTGTCACCTGG + Intergenic
1001087105 5:168708211-168708233 CTCCATGCCCAGATGGCAGCTGG + Intronic
1001749078 5:174114981-174115003 ATGGATGCCCAGATGTTCTCAGG + Intronic
1002799270 6:505603-505625 CTGCATTCCCAGGTGCTGCCTGG + Intronic
1011627622 6:89296406-89296428 CTGGATGCCCAGATGTCACTTGG - Intronic
1013234245 6:108183082-108183104 CTGCATGGCCAGAAGTAACCTGG - Intronic
1020963174 7:14831542-14831564 CTGCTTGTGCAGATGTGACCTGG + Intronic
1021534392 7:21687149-21687171 CTGCTGGCCCAGCTGGTACCGGG + Exonic
1023851010 7:44150384-44150406 CTGCATGCACAGGTGCCACCTGG + Intronic
1030616289 7:111741557-111741579 CTGTGAGCCCAGATGGTACCAGG - Exonic
1032301325 7:130690030-130690052 CTCCCTGCCCAGCTGTTACCTGG - Intergenic
1033447287 7:141434330-141434352 CTGGAGGCCCAGCTGTCACCTGG - Intronic
1034335671 7:150322137-150322159 ATGCAGGCCCAGATGTTCTCTGG + Intronic
1034421920 7:150995133-150995155 CAGCCTTCCCAGATGTCACCCGG - Intronic
1034677634 7:152903072-152903094 CTACATGCCCACACGTTTCCGGG + Intergenic
1036718742 8:11152327-11152349 CAACATGCCCAGATGTTTTCTGG - Intronic
1039397238 8:37236830-37236852 CTGTATCCCCAGATGTTTCCTGG - Intergenic
1039730745 8:40274081-40274103 CTTCAGGCCCAGATATTAACAGG - Intergenic
1040988042 8:53317832-53317854 CTGCATGCTCAGAAGTGGCCTGG - Intergenic
1047625042 8:126647726-126647748 CTTCATGCCCAGAGGATACATGG - Intergenic
1052877081 9:33575377-33575399 CTGCAGCCCCAGATGGCACCTGG + Intergenic
1053289872 9:36872860-36872882 CCTCATGCCCAGAGGTTTCCAGG + Intronic
1053498924 9:38569017-38569039 CTGCAGCCCCAGATGGCACCTGG - Intronic
1057678371 9:97153509-97153531 CTGCAGCCCCAGATGGCACCTGG - Intergenic
1059654164 9:116342105-116342127 CTGCACGCTCAGAAGGTACCTGG - Intronic
1060676201 9:125517363-125517385 CTGCTTGCCCTGATTTTTCCAGG + Intronic
1062235838 9:135507153-135507175 CCTCCTGCCCAGATGTCACCAGG + Intergenic
1188117064 X:26257437-26257459 GTGCATGGCCAGATCTAACCGGG + Intergenic
1189418345 X:40833908-40833930 CTGCACGTGCAGGTGTTACCTGG - Intergenic
1189755095 X:44262778-44262800 CTGCATGTACAAATGTTACCTGG - Intronic
1191594692 X:62930017-62930039 CTGGATGCCCAAATCTTAGCAGG - Intergenic
1200066639 X:153507182-153507204 GTGCATGCCCAGCTCTCACCTGG - Exonic