ID: 1170896876

View in Genome Browser
Species Human (GRCh38)
Location 20:20422959-20422981
Sequence GATTCCAAGTTGCCACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170896876_1170896880 8 Left 1170896876 20:20422959-20422981 CCAGCCTGTGGCAACTTGGAATC 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1170896880 20:20422990-20423012 TTTTAAAACAGATGAACAGCAGG 0: 1
1: 0
2: 3
3: 35
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170896876 Original CRISPR GATTCCAAGTTGCCACAGGC TGG (reversed) Intronic
905520866 1:38598705-38598727 GACTCCTGGTTGCCCCAGGCTGG + Intergenic
905744847 1:40406394-40406416 GATTCATAGTTGCCAGGGGCTGG + Intronic
905948713 1:41926853-41926875 GCTTCCAAGTTGCTACAGGAGGG + Intronic
906301801 1:44687887-44687909 GATTCCAGGACGCCAAAGGCAGG - Intronic
907516916 1:54998691-54998713 GATTCCAGGATCCCACAGGCTGG - Intergenic
910483303 1:87682448-87682470 GAGTCCAAGTTGACTCAGGCAGG + Intergenic
915835204 1:159171216-159171238 GATCCCCAGTTGCCAAAGGATGG + Intergenic
916557253 1:165903818-165903840 AATTCCTAGCTGCCACAGGAAGG - Intronic
917382890 1:174434153-174434175 GAACCCTAGTTGCCCCAGGCAGG - Intronic
922574684 1:226653946-226653968 GGGTCCAGGTTGCAACAGGCAGG - Intronic
1065071252 10:22026023-22026045 GATTAGCAGTTGCCTCAGGCTGG - Intergenic
1066690888 10:38026869-38026891 GATTAGAGGTTGCCACAGACTGG - Intronic
1067001858 10:42622668-42622690 GATTAGAGGTTACCACAGGCTGG + Intronic
1067921573 10:50464005-50464027 GGTTCGTAGTTGCCAGAGGCTGG + Intronic
1070206995 10:74273837-74273859 GAATCCAGCTTGCAACAGGCAGG + Intronic
1071313766 10:84371086-84371108 GGTTCCAAGTTGCCAAAGTATGG + Exonic
1073476621 10:103757822-103757844 CTTTGCAAGTTACCACAGGCCGG + Intronic
1074562024 10:114543330-114543352 GATTGGTAGTTGCCAAAGGCTGG - Intronic
1075189607 10:120294615-120294637 GATGCCAAGTTGACAAGGGCTGG + Intergenic
1075514031 10:123095055-123095077 GCTTCCAAGTCCCCACCGGCTGG + Intergenic
1079370210 11:19846151-19846173 GATTCCAAGTGGAGACAGCCAGG + Intronic
1084088621 11:66866093-66866115 AGTGCCAAGTTGCCACAGCCCGG - Intronic
1085422548 11:76376028-76376050 GATTCGAGGTTACCAAAGGCTGG + Intronic
1090627950 11:128622263-128622285 GTTTCCAAGAAGCCACACGCTGG + Intergenic
1091963410 12:4718425-4718447 GATTCCAAGTTGCTGGATGCTGG - Intronic
1092671664 12:10868475-10868497 GAATCCAAGGTGTCACATGCAGG - Intronic
1095235963 12:39796052-39796074 GATTAGTAGTTGCCAGAGGCTGG - Intronic
1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1101593034 12:106139632-106139654 GACTCGGAGTTGCCCCAGGCGGG - Exonic
1101664389 12:106797468-106797490 GATTCATAGTTGCCAGGGGCTGG + Intronic
1101817581 12:108157645-108157667 TATTCCAAGCAACCACAGGCTGG + Intronic
1102336810 12:112088272-112088294 GATTCCAAGATGGCAGAGGGAGG - Intronic
1103397162 12:120616899-120616921 GATTAGAGGTTGCCAGAGGCTGG - Intergenic
1103731115 12:123028363-123028385 TATTCCTAGCTGCCACTGGCTGG + Intronic
1103845185 12:123897017-123897039 GATTCGAGGTTGCCAGGGGCTGG - Intronic
1105612138 13:21977834-21977856 CAGTCCAAGTTCCCACAGCCTGG - Intergenic
1105669841 13:22600829-22600851 GATTCTAACAGGCCACAGGCTGG + Intergenic
1106009431 13:25804735-25804757 GGTGCCGAGCTGCCACAGGCTGG + Intronic
1112714290 13:102165840-102165862 GATTCCTGGTTGCCAGAGGCTGG + Intronic
1112741396 13:102477340-102477362 GAATCGAAGTTACCAGAGGCTGG + Intergenic
1116774923 14:49168011-49168033 GATTCCCAGTTTCCACCAGCAGG - Intergenic
1117243247 14:53856943-53856965 GATGCCAAGTTGACAAGGGCTGG - Intergenic
1118884614 14:69856007-69856029 GTTTCCAACTTTCCAAAGGCAGG - Intronic
1122387160 14:101357012-101357034 GATTTCTAGTTGCCAGGGGCTGG + Intergenic
1122578117 14:102754749-102754771 GTTTCCAAGTCTCCTCAGGCCGG - Intergenic
1127157911 15:56149128-56149150 GCTTCCAAGGTGCCACAGAGGGG - Intronic
1127949067 15:63786727-63786749 GATTAGTAGTTGCCAGAGGCTGG + Intronic
1128141313 15:65302659-65302681 GATTAGTAGTTGCCAGAGGCTGG + Intergenic
1133841087 16:9410054-9410076 GATTAGTAGTTGCCTCAGGCTGG - Intergenic
1137068114 16:35872257-35872279 GATCAGAAGTTACCACAGGCTGG + Intergenic
1139670224 16:68487812-68487834 GATTTCCTGATGCCACAGGCAGG - Intergenic
1139912314 16:70405656-70405678 GATTACCAGTTGCCAGGGGCTGG + Intronic
1141067084 16:80922838-80922860 GCTTCCCAGTTCCCACAGACTGG + Intergenic
1142384886 16:89757561-89757583 GATTCGTGGTTGCCGCAGGCAGG + Intronic
1144098103 17:11919980-11920002 GATTCCCAGTGGCCACACCCAGG - Intronic
1145838716 17:27975597-27975619 GAGTCCAAGTTCCTATAGGCAGG + Intergenic
1147466386 17:40614415-40614437 GATACCATGGTGCCTCAGGCTGG + Intergenic
1148522968 17:48299779-48299801 GCTTCCTAGTTGCCCCAGGTTGG - Intronic
1148540011 17:48472814-48472836 CATTCCAAATAGCCACAGGTGGG - Intergenic
1150441301 17:65193829-65193851 GATTCATAGTTGCCTAAGGCTGG - Intronic
1152738191 17:82007691-82007713 GATGCCAACCTGCCACAGGCTGG + Intronic
1152806351 17:82358461-82358483 GATTCCTGGTTGCCAGGGGCTGG + Intergenic
1155859652 18:30881084-30881106 GATACCAACATGCCATAGGCAGG - Intergenic
1160317005 18:77857735-77857757 GAGTGCAAGTTACCACAGGCAGG - Intergenic
1161046758 19:2139174-2139196 GATTCGTGGGTGCCACAGGCTGG + Intronic
1161940738 19:7402037-7402059 GATTAGTGGTTGCCACAGGCTGG + Intronic
1163083602 19:14962425-14962447 GATTCCCAGTTCCCACACCCTGG + Intronic
1166160818 19:40951514-40951536 GCTTCCCATTGGCCACAGGCTGG - Intergenic
1166169725 19:41019249-41019271 GCTTCCCACTGGCCACAGGCTGG - Intergenic
1166622710 19:44316843-44316865 GATTGCTGGTTGCCAGAGGCTGG - Intergenic
925202407 2:1979246-1979268 GATTACACGGTGCCGCAGGCAGG + Intronic
927508916 2:23632158-23632180 GATTCCAAGATCACACAGGGAGG - Intronic
928830368 2:35475461-35475483 GATTTCAAATGGCCACAGGAGGG + Intergenic
930247774 2:49002788-49002810 GCTTACAAGTTCTCACAGGCAGG + Intronic
934897187 2:98129026-98129048 CATAACAAATTGCCACAGGCTGG + Intronic
937326848 2:120994625-120994647 GTTCCCAACTTCCCACAGGCAGG - Intergenic
938316795 2:130335155-130335177 GCTTCCAAAATTCCACAGGCAGG + Intergenic
942532582 2:176927690-176927712 TATTCCCATTTGGCACAGGCAGG - Intergenic
944143028 2:196477673-196477695 CATTCCAAGCTCCCACTGGCAGG + Intronic
947364187 2:229377104-229377126 GATTACAAGCTCCCAAAGGCAGG + Intronic
1169529486 20:6469062-6469084 GATTCGAAGTTGCCTAGGGCTGG - Intergenic
1170896876 20:20422959-20422981 GATTCCAAGTTGCCACAGGCTGG - Intronic
1171410528 20:24943962-24943984 TGTTCCAAGTGGCCCCAGGCAGG - Intergenic
1171440177 20:25154236-25154258 GATTCGTGGTTGCCAGAGGCTGG - Intergenic
1171797355 20:29577003-29577025 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1172066644 20:32225683-32225705 GTTGCCATGTTGCCCCAGGCTGG + Intronic
1174565104 20:51458836-51458858 GATTACAAGAGGCCACAGCCAGG + Intronic
1178124236 21:29499868-29499890 AATTCCCAGCTGCCACAGGAGGG - Intronic
1178455091 21:32741752-32741774 GAATCCCTGTTGCCCCAGGCGGG - Intronic
1181910707 22:26236046-26236068 GATTTCAAGTTGCCCGAGACAGG - Intronic
1182129251 22:27838952-27838974 ACTTCCAAGTTGCCACAGGCTGG + Intergenic
1182267357 22:29128054-29128076 GATTCCGGGTTGCCAAGGGCTGG + Intronic
1184452901 22:44593401-44593423 GCTTCAGAATTGCCACAGGCTGG - Intergenic
950366289 3:12486734-12486756 GATTACCAGTTGCCAGAGACAGG - Intronic
953212621 3:40889606-40889628 GATTCCAATTTGACAGTGGCAGG + Intergenic
954689269 3:52387163-52387185 CATTCCAAGTCTCCACAGCCTGG + Intronic
956942400 3:74178806-74178828 GAATACAAGTTGCCACAGATAGG + Intergenic
958883628 3:99701141-99701163 GTTTCCCAGTTGCCTCAGCCGGG - Intronic
961239720 3:125400167-125400189 GGTTGCAAGTTGTCACAGGGAGG - Intergenic
964474524 3:157086575-157086597 GATGCCAACTTGCCACAGCTTGG + Intergenic
965827456 3:172745267-172745289 TTCTCCATGTTGCCACAGGCTGG + Intergenic
970505604 4:16726696-16726718 GATTGGAAATGGCCACAGGCTGG - Intronic
972963403 4:44481128-44481150 GATTAATAGTTGCCACAAGCTGG + Intergenic
973539546 4:51922417-51922439 GGTTCCAAGTTGACAAAGGGTGG - Intergenic
973975715 4:56260460-56260482 GATGCCAAGTTGACAAAGGGTGG + Intronic
974361049 4:60879907-60879929 GATTAGCAGTTGCCAGAGGCTGG + Intergenic
976213603 4:82694627-82694649 GATTCAAAGTTGCCACATGGTGG - Intronic
976447654 4:85150414-85150436 GATTCCAAGTTTACTCTGGCTGG - Intergenic
977761560 4:100744043-100744065 GCTTTCAAGTTGCCCAAGGCAGG - Intronic
981559532 4:146032253-146032275 GATTACAACATACCACAGGCAGG - Intergenic
981866857 4:149431901-149431923 TATTCAAAGTTGCCAAAAGCTGG - Intergenic
986215999 5:5719805-5719827 GATAACAAAGTGCCACAGGCCGG + Intergenic
986309339 5:6540352-6540374 TTTTCCAGGCTGCCACAGGCTGG - Intergenic
993842686 5:92900337-92900359 GATTCCGAGATTCCACAGCCAGG - Intergenic
995490930 5:112691118-112691140 AATTTCAAGTTGACTCAGGCTGG - Intergenic
996199163 5:120649567-120649589 GCTTCCAAATGGCCATAGGCTGG - Intronic
998778444 5:145629467-145629489 ACTTCCAAATTCCCACAGGCAGG - Intronic
1002259535 5:177984060-177984082 GATTCCATCTTGCCAAGGGCAGG + Intergenic
1003747865 6:9023526-9023548 GATTCCCTATTGCCACAGACTGG + Intergenic
1004145373 6:13061048-13061070 GATTGCCAGTGGCCACTGGCAGG - Intronic
1006004334 6:30990476-30990498 GATTCCAAGTTTTCACATCCCGG - Intergenic
1007176864 6:39903096-39903118 GGTTCCAAGTGGCCACCTGCAGG - Exonic
1009734021 6:67651702-67651724 GATTCCAATTTGCCACTGTGTGG - Intergenic
1010719595 6:79267828-79267850 GATTCCTTGTTGCCAGGGGCTGG + Intergenic
1013378465 6:109542284-109542306 GAATGAAAGTTACCACAGGCAGG + Intronic
1018804223 6:167246388-167246410 GGTTCCATGTAGCCACAGGTTGG + Intergenic
1023770914 7:43556031-43556053 GATTGCAGGTTCCCACGGGCAGG - Intronic
1024014904 7:45304881-45304903 GATTAGAGGTTGCCACGGGCTGG + Intergenic
1025809565 7:64866930-64866952 GATTCCAGGATCCCACAGTCTGG + Intergenic
1028126390 7:87117614-87117636 AATTCCAAGATGCCAGAGGTTGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1031171687 7:118299672-118299694 TATTCTAAGTGACCACAGGCTGG + Intergenic
1032307547 7:130750507-130750529 GATCCGTCGTTGCCACAGGCTGG + Intergenic
1033175979 7:139124111-139124133 GATTAGTAGTTGCCAGAGGCTGG + Intergenic
1034065142 7:148129051-148129073 GATTCCAAGTAACCAAGGGCAGG + Intronic
1035181116 7:157090416-157090438 GATTCCATGCTGCCAGGGGCTGG + Intergenic
1036604844 8:10295692-10295714 GGTGCCAAGTGACCACAGGCTGG - Intronic
1037975968 8:23212389-23212411 GAATGGTAGTTGCCACAGGCTGG - Intronic
1042404526 8:68388581-68388603 GATGCCATATTGCCTCAGGCTGG - Intronic
1047417367 8:124675669-124675691 GTTTCCAGGTTGCCAGAGGTTGG - Intronic
1050349824 9:4730148-4730170 GATTAGTAGTTGCCAAAGGCTGG + Intronic
1053312018 9:37026336-37026358 GATTCCCAGGTGCCTCAGCCCGG + Intronic
1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1054156462 9:61644318-61644340 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1054476233 9:65575327-65575349 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054660573 9:67699017-67699039 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1058071246 9:100602519-100602541 TATTCCAATTTGCCACAAGATGG + Intergenic
1058862445 9:109129108-109129130 CTTTCCTAGTTGCCCCAGGCTGG + Intergenic
1060100418 9:120835759-120835781 GATTCCTGGTTGCCAGAGGCTGG + Intronic
1060692755 9:125678707-125678729 TGTTCCTAGTTACCACAGGCAGG - Intronic
1186756995 X:12681972-12681994 GATTAGTAGTTGCCACGGGCTGG - Intronic
1193280538 X:79643412-79643434 GGTCCCAAGTTGACAAAGGCTGG + Intergenic
1195545051 X:106104800-106104822 GATGCCAAGTTGACAAGGGCTGG + Intergenic
1198241018 X:134786115-134786137 TATTCCAGGTTGCCATATGCTGG - Intronic
1199418442 X:147614633-147614655 CATTCCAAGTATCCACAGTCTGG - Intergenic