ID: 1170897742

View in Genome Browser
Species Human (GRCh38)
Location 20:20431228-20431250
Sequence AAGTAGGACTGGAGAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 543}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170897729_1170897742 23 Left 1170897729 20:20431182-20431204 CCAAGAAGCCATGCCCAGAGAAC 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 543
1170897736_1170897742 9 Left 1170897736 20:20431196-20431218 CCAGAGAACTGGGGAACACAGGG 0: 1
1: 0
2: 3
3: 22
4: 372
Right 1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 543
1170897734_1170897742 10 Left 1170897734 20:20431195-20431217 CCCAGAGAACTGGGGAACACAGG 0: 1
1: 0
2: 1
3: 29
4: 309
Right 1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 543
1170897733_1170897742 15 Left 1170897733 20:20431190-20431212 CCATGCCCAGAGAACTGGGGAAC 0: 1
1: 0
2: 2
3: 30
4: 334
Right 1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 543
1170897728_1170897742 24 Left 1170897728 20:20431181-20431203 CCCAAGAAGCCATGCCCAGAGAA 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG 0: 1
1: 0
2: 4
3: 41
4: 543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170897742 Original CRISPR AAGTAGGACTGGAGAGAGGC CGG Intronic
901140355 1:7025326-7025348 AAGTTGTACTGCAGAGAGGAAGG + Intronic
901560450 1:10066108-10066130 AGGTAGGAAGGGAGAGAGGGAGG - Intronic
901661204 1:10798997-10799019 GAGAAGGAATGGAGAGAGGATGG - Intergenic
901662070 1:10804730-10804752 GAGTGGGAGTGGGGAGAGGCAGG - Intergenic
902132902 1:14279278-14279300 AATTAGGGGTGGAGAGAGGCTGG + Intergenic
902175660 1:14648560-14648582 AACTAGAGCTGCAGAGAGGCTGG + Intronic
902406050 1:16184265-16184287 TTGTGGAACTGGAGAGAGGCTGG + Intergenic
902527987 1:17071602-17071624 AGATGGGACTGGGGAGAGGCTGG + Intronic
903396176 1:23003417-23003439 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
904029908 1:27527640-27527662 AACCAGGACTGGAGAGACGCTGG + Intergenic
904299320 1:29543911-29543933 AAGTAGGCCTGGAGCAAGGTTGG - Intergenic
905266462 1:36757321-36757343 AAGTAGGATTGGGCAGAGGAAGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905535844 1:38721181-38721203 AATCAAGACTGGAGTGAGGCTGG - Intergenic
905662131 1:39735749-39735771 AGGTGGGAATGGAGAGGGGCTGG + Intronic
905885949 1:41492046-41492068 AAGTAGGAATGGAAAGAGGATGG - Intergenic
906081089 1:43088793-43088815 AAGTAAAAGTGAAGAGAGGCTGG - Intergenic
906151063 1:43588083-43588105 CAGGAGGACTGGGGAGGGGCAGG - Intronic
906515353 1:46435883-46435905 AAAGAGGAGGGGAGAGAGGCAGG - Intergenic
906744675 1:48213464-48213486 AAGGAGGACTGGAGGGTGGAAGG + Intergenic
907268316 1:53276021-53276043 GAGTGGCCCTGGAGAGAGGCAGG - Intronic
907305606 1:53511370-53511392 AAGCAGATTTGGAGAGAGGCTGG + Intronic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
907798546 1:57741801-57741823 AATTAGGACTGGAGAGACCCAGG + Intronic
908290996 1:62667150-62667172 AAGAATGACTAGAGAGAGGCAGG - Intronic
908321428 1:62982532-62982554 AAGTAGGAGTTGAGATAGGAGGG + Intergenic
909116753 1:71546978-71547000 AAGTAAAAGTAGAGAGAGGCTGG + Intronic
909694443 1:78450207-78450229 GAGAAGGAAAGGAGAGAGGCTGG - Intronic
909789061 1:79650538-79650560 AAGGAAGAATGGAGAGAGGTTGG + Intergenic
910356312 1:86360328-86360350 AAATAGAACTGAAGAGAGGTGGG - Intronic
912050793 1:105525890-105525912 ATGAAGGACTTGAAAGAGGCAGG - Intergenic
912308439 1:108595259-108595281 AAGGAGGGATGGAGAGAGGGAGG + Intronic
913280481 1:117180787-117180809 GAGCAGAAGTGGAGAGAGGCGGG - Intronic
915288367 1:154867146-154867168 AGGGAGGACTGGAGAGAGCCAGG + Intronic
915309097 1:154998392-154998414 GAGTAGGAATGGAGACAGGAGGG + Intergenic
915360968 1:155286072-155286094 GAGTAGGCCTGGGGAGGGGCTGG - Intronic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915739480 1:158107689-158107711 AAGTAAGAATGGAGAGAAGGTGG - Intergenic
915740907 1:158117822-158117844 GAGTAGGAGTGGAAAGAGTCTGG + Intergenic
915924272 1:160004286-160004308 AAAGAAGAATGGAGAGAGGCAGG - Intergenic
916508006 1:165445348-165445370 GTGTAGGTCAGGAGAGAGGCGGG + Intronic
916769932 1:167898302-167898324 AAGAATGATTGAAGAGAGGCTGG + Intronic
917633886 1:176916914-176916936 AAGTGAGGCTGGAGAGAGGCTGG - Intronic
917737603 1:177934817-177934839 AAGGAGGAATGGAGGGAGGGAGG + Intronic
917749835 1:178043268-178043290 AAGTAAAAGTGAAGAGAGGCTGG - Intergenic
918060117 1:181053719-181053741 AAATAAAACTGGAGAGATGCAGG - Intronic
918342943 1:183582206-183582228 AAGAAGGGCTAGAGGGAGGCGGG - Intronic
918487675 1:185046016-185046038 GAGTAGGGCTGCAGAGAGGCTGG - Intronic
919503219 1:198364825-198364847 AAATAAGACTTGAGAAAGGCTGG - Intergenic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
921023745 1:211259333-211259355 AGGGAGGAGGGGAGAGAGGCGGG + Intronic
921285061 1:213602201-213602223 AAGAAGGAATGGAGGGAGGGAGG - Intergenic
922098343 1:222461425-222461447 AAGGGGGACTGAAGAGAGGTTGG + Intergenic
922191550 1:223323224-223323246 AAGAAGGAAGGGAGAGAGGGAGG + Intronic
922443061 1:225672604-225672626 TATTAGAACTGGAAAGAGGCTGG - Intergenic
923093482 1:230756971-230756993 AAGAAGGAAGGGAGAGAGGGAGG + Intronic
923200331 1:231704799-231704821 AAGTAGGACTGGGGTGGGGTGGG + Intronic
923272660 1:232372044-232372066 AAACAGGACAGGACAGAGGCAGG + Intergenic
923353875 1:233134564-233134586 AAGCAGGAAGGCAGAGAGGCGGG + Intronic
923566137 1:235077281-235077303 AAGGAGGGCTGGAAAGAGGAAGG + Intergenic
923671157 1:236042405-236042427 AGCTAGGACTGGAGAGTGGAAGG + Intronic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063552519 10:7046421-7046443 AAGTAGGCCAGGAAAGAGGAAGG - Intergenic
1063698004 10:8356441-8356463 AAGAAGGAAGGGAGGGAGGCAGG - Intergenic
1065117486 10:22496877-22496899 TATTAGGAGTGGGGAGAGGCAGG + Intergenic
1065455714 10:25904754-25904776 AAGTAGGATTGGATAGAGGCAGG - Intergenic
1069133871 10:64739955-64739977 AAGTAGGACTGGGCAGTGGCAGG - Intergenic
1069601356 10:69710195-69710217 AAGGGGCACTTGAGAGAGGCTGG + Intergenic
1071337206 10:84610511-84610533 AAAGAGGACAGGAGAGAGGAAGG + Intergenic
1072130342 10:92488089-92488111 AAGAAGTACTGAAGTGAGGCCGG - Intronic
1073566051 10:104536593-104536615 AAGGAGGAGAGGAGAGAGGGAGG + Intergenic
1073608084 10:104915604-104915626 AAGTAGGTCCTGAGAAAGGCTGG + Intronic
1074067061 10:110025727-110025749 AAAAAGCACTGGACAGAGGCAGG - Intronic
1074322924 10:112420288-112420310 AATCTTGACTGGAGAGAGGCTGG - Intronic
1074780362 10:116798040-116798062 AACTATTTCTGGAGAGAGGCAGG + Intergenic
1075188669 10:120286207-120286229 AGGTAGGACTGCAGAGAAACTGG + Intergenic
1075403385 10:122177298-122177320 AAGGAGCAGTGGAGGGAGGCTGG + Intronic
1075449537 10:122540171-122540193 AAGAAAGTCTGCAGAGAGGCAGG + Intergenic
1075597648 10:123743799-123743821 AGACAGGACTGGAGAGAAGCAGG + Intronic
1076538571 10:131198935-131198957 AAGTGGGCCAGGTGAGAGGCTGG - Intronic
1077838241 11:5944208-5944230 AAGTAAGATTGGAGGGTGGCAGG + Intergenic
1077850932 11:6074288-6074310 AAGGAGGAATGGAGAGTGGAAGG + Intergenic
1078134637 11:8641611-8641633 AAGTAGGACGGAAGAGAGTGGGG + Intronic
1078872082 11:15357232-15357254 AAGGAGGGCAGGAGAGAGTCAGG - Intergenic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1080782298 11:35440886-35440908 CAGTAGGACTGGAGCCAGTCTGG - Intronic
1080846403 11:36030830-36030852 CAGTAGGAGAGGAGAGAGCCAGG + Intronic
1081218912 11:40436538-40436560 AAGCAGGACAGGAGAGAGGCTGG - Intronic
1081413281 11:42784857-42784879 AAGAAGGAAGGAAGAGAGGCAGG + Intergenic
1081852882 11:46285848-46285870 AAGTAGCGATGGAGTGAGGCAGG + Intronic
1083406846 11:62463482-62463504 AAGCAAGACGGGAGGGAGGCTGG - Intronic
1084201229 11:67559911-67559933 AGGGAAGACTGGAGATAGGCTGG + Intergenic
1085082365 11:73645746-73645768 AGGGAGAGCTGGAGAGAGGCTGG + Intergenic
1085294409 11:75422877-75422899 AATCTGGACTGTAGAGAGGCAGG + Intronic
1085720879 11:78911484-78911506 AGGTAGGAAGAGAGAGAGGCTGG + Intronic
1086669194 11:89526833-89526855 AATTGGGACTGGAGAGAGTGGGG + Intergenic
1087278689 11:96185971-96185993 CAGTAGGTCTGGGGAGGGGCTGG - Intronic
1087405377 11:97723046-97723068 CAGTAGGACAGGAATGAGGCTGG + Intergenic
1087681693 11:101225070-101225092 CAGTGGCACTGGAGAGTGGCGGG + Intergenic
1088017515 11:105078578-105078600 AAGTAGGAGTGATCAGAGGCAGG + Intronic
1088551690 11:111019780-111019802 CACTTGAACTGGAGAGAGGCTGG - Intergenic
1089314732 11:117583682-117583704 GATTAGGCCTGGAGAGAGCCTGG + Intronic
1089464755 11:118677877-118677899 AATGAGGACTTCAGAGAGGCTGG - Intronic
1089500313 11:118928164-118928186 CAGGAGGAAAGGAGAGAGGCAGG + Intronic
1089685631 11:120144963-120144985 GAGAAGGACTGGAGACAGCCTGG + Intronic
1089966684 11:122659334-122659356 GAGCAGGCCTGGAGAGAGGGAGG + Intronic
1091021391 11:132103177-132103199 ACATAAGCCTGGAGAGAGGCCGG - Intronic
1091176228 11:133560600-133560622 ACGTCTGACTGGAGAGAAGCTGG - Intergenic
1091187940 11:133663311-133663333 ATGTGGGTCTGCAGAGAGGCTGG - Intergenic
1091388334 12:109398-109420 CAGTAAGGCTGCAGAGAGGCCGG - Intronic
1091661281 12:2385602-2385624 AACTAAGAATGGAGGGAGGCAGG - Intronic
1091949591 12:4581745-4581767 GGGAAGGACAGGAGAGAGGCAGG - Intronic
1092917495 12:13201981-13202003 AACTAGGACAGGAGGGAGGGAGG + Intronic
1094151184 12:27285614-27285636 AAGGATGAGTGGTGAGAGGCAGG - Intronic
1094703527 12:32893828-32893850 CAGTAGGACTGGACATAGGGAGG - Intronic
1095433304 12:42157914-42157936 AAGTAAGAGTGAAGATAGGCCGG - Exonic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1096241893 12:49964077-49964099 AAGTAGATCTGGATAGAGACAGG - Exonic
1098979921 12:76945096-76945118 AAGGAGGAAGGGAGAGAGGGAGG - Intergenic
1100494467 12:95111575-95111597 AAGTAGGACTGGAGATGAGTGGG - Intronic
1101900014 12:108784937-108784959 AAGTGGCACAGGAAAGAGGCAGG - Exonic
1102425276 12:112839010-112839032 AATCATGACTGGAGAGAGGATGG - Intronic
1102623143 12:114212911-114212933 AAGCAGAATTGGAGAGAGGAAGG + Intergenic
1102736032 12:115160481-115160503 AAGGAGGAATGGAGAGATGCTGG - Intergenic
1103366797 12:120389661-120389683 AGGTAGGAAGGGAGAGAGGAAGG + Intergenic
1103481070 12:121249920-121249942 AACTCGGACAGGAGAGATGCGGG + Intronic
1103638302 12:122327505-122327527 AATCAGGACTAGAGAGAGCCTGG - Intronic
1104517705 12:129443134-129443156 AAGCCGGATTGGAAAGAGGCAGG - Intronic
1104705844 12:130946805-130946827 AAGAAGGACTGGGGGCAGGCAGG - Intergenic
1105595448 13:21833621-21833643 AAACGGGACTGGAGAGAGTCAGG + Intergenic
1106367249 13:29093003-29093025 AAGTGGGACAGGAGTGAGGGTGG - Intronic
1106770109 13:32953558-32953580 ATGTTGGACAGGAGGGAGGCCGG - Intergenic
1107302406 13:38979385-38979407 AAGTGGGACTGAGGAGAGGATGG - Intronic
1107837578 13:44423966-44423988 AGGTAGGAGTGGGGAGAGGGAGG - Intergenic
1110092565 13:71471285-71471307 AAGGAACACTGGAGAAAGGCAGG + Intronic
1110696378 13:78496030-78496052 AGGTATGACTGGAGAGATGAAGG - Intergenic
1111682977 13:91466722-91466744 GAGTGGGACTGGGGAGAGGGAGG + Intronic
1112168080 13:96941290-96941312 AAACAGGAGTGGAGAGAGACAGG - Intergenic
1113587106 13:111473012-111473034 AAGCAGGGCTGGGGACAGGCAGG + Intergenic
1113665241 13:112136655-112136677 AAGAAGGAAGGGAGAGAGGGAGG - Intergenic
1114593393 14:23890752-23890774 AAGAAGGAAGGGAGAGAGGAAGG + Intergenic
1115054675 14:29108838-29108860 AAGTAGGAAAGGAGGGAGGGAGG + Intergenic
1115698921 14:35929711-35929733 AAGTAGGGCTGGGGAGAGACAGG + Intronic
1116777984 14:49203438-49203460 AACTAGCACTGGGGATAGGCTGG + Intergenic
1117291994 14:54343431-54343453 AGGTAGGAATAGAGAGAGGAGGG + Intergenic
1117756148 14:58976120-58976142 AAGTAGGAGTGAGGAGAAGCTGG + Intergenic
1119420042 14:74503059-74503081 AAGTAGGGCAGGGGAGAGGTGGG - Intronic
1119694709 14:76704041-76704063 AAGAAAGAGTGGAGAGAGCCTGG - Intergenic
1122088451 14:99322677-99322699 AAGAAGGTCTGGGAAGAGGCTGG + Intergenic
1122103126 14:99429398-99429420 AAGGAGCACTGGTGAGACGCAGG + Intronic
1123982781 15:25619259-25619281 AAGCTGGAGTGGAGAGAAGCAGG - Intergenic
1125213366 15:37240666-37240688 AAGGAGGAATGGAGGGAGGGTGG + Intergenic
1126638299 15:50800833-50800855 ATCTAGGATGGGAGAGAGGCAGG + Intergenic
1126775155 15:52094155-52094177 AAATAGGTCAGGAGGGAGGCTGG + Intergenic
1126846032 15:52761236-52761258 AAGTAAGACTGGACAGAAGGAGG - Intronic
1127730101 15:61792466-61792488 AAGAAGGACTGGGGAGACGTTGG - Intergenic
1128539009 15:68511991-68512013 AATGAGGAATGGAGGGAGGCTGG + Intergenic
1128877200 15:71212054-71212076 AGGAAGGAGTGGAGGGAGGCTGG + Intronic
1129607987 15:77034129-77034151 AGGCAGGACTGGGAAGAGGCGGG + Intronic
1129808970 15:78490897-78490919 AAGCAAGAATGGAGAGTGGCGGG + Intronic
1129848504 15:78778932-78778954 AGGCAGGTGTGGAGAGAGGCTGG + Intronic
1129914999 15:79260974-79260996 AGGGAGGACTAGGGAGAGGCTGG + Intergenic
1130090333 15:80815536-80815558 AGGTAGGAAGGGAGAGAGGAAGG - Intronic
1130323858 15:82863042-82863064 AAGAAGCAGTGGAGAGAGGAGGG - Intronic
1131058784 15:89391825-89391847 AGGTAGGAATGGGGAGGGGCAGG - Intergenic
1131108078 15:89747972-89747994 ACTCAGGACTGGAGATAGGCAGG - Intergenic
1131223766 15:90607353-90607375 AAGGAGGGGAGGAGAGAGGCTGG - Intronic
1131488924 15:92845037-92845059 AGGTACTACTGGAGAAAGGCTGG - Intergenic
1131855596 15:96590313-96590335 GATTAGGACTGGAGTGAGGGAGG + Intergenic
1132340263 15:101073802-101073824 AAGGAGGAATGGAGAGTGGAAGG - Intronic
1132378754 15:101350680-101350702 GGGGAGGACTGGAGAGTGGCTGG + Intronic
1132841047 16:1978691-1978713 AGGATGGACTGGAGAGAGGCCGG - Exonic
1133000853 16:2850700-2850722 AAGGAGGGCTGGAGAGGGGAGGG + Intergenic
1134242004 16:12513217-12513239 AAGCAGGGCAGGAGAAAGGCAGG - Intronic
1134267732 16:12706447-12706469 AGGAAGGAAGGGAGAGAGGCAGG - Intronic
1134411157 16:14004063-14004085 ATGGAGGACTGGTGGGAGGCAGG + Intergenic
1134528075 16:14959994-14960016 AAATGAGAATGGAGAGAGGCTGG + Intergenic
1135619888 16:23946743-23946765 CAGTAGGTCTGGGGAGGGGCCGG + Intronic
1135728191 16:24873224-24873246 AGGAAGGAATGGAGAGAGGGAGG + Intronic
1135734839 16:24922535-24922557 ATGTAGGAATAGAGAGGGGCTGG - Intronic
1137505502 16:49050807-49050829 AAGAAGCACTGGAAAGAGGGTGG + Intergenic
1137555740 16:49469248-49469270 ATGAAGGCCTGGAGAGAGGAGGG - Intergenic
1138195120 16:55046247-55046269 TAGTTGGACTGGAAAGGGGCCGG + Intergenic
1139225740 16:65232253-65232275 AAGTGAAAGTGGAGAGAGGCTGG + Intergenic
1140176751 16:72668432-72668454 AAGTAGGCCTGGAGAGGTGGTGG + Intergenic
1141410784 16:83831573-83831595 AGGGAGGAGTGGAGAGAGGAGGG - Intergenic
1141652760 16:85402351-85402373 AAGGGGGACTCGAGAGAGCCTGG + Intergenic
1141775816 16:86121936-86121958 AGGGAGGACGGGAGAGAGGTGGG - Intergenic
1142154737 16:88527827-88527849 AAGGAGGCCTGGAGGCAGGCAGG + Intronic
1142433589 16:90043568-90043590 GAGTAGGCCTGGACACAGGCTGG - Exonic
1142864044 17:2779687-2779709 AAGGAGGAGTGGAGGGAGGGTGG + Intronic
1142864443 17:2782147-2782169 AAGGAAGCCTGGAGAGAGGGCGG - Intronic
1143031551 17:3970757-3970779 AAGTAAGTCTGGAGACAGGAAGG - Intergenic
1143332876 17:6150340-6150362 AAGTGGGTGTGGAGAGAGGGAGG + Intergenic
1143435178 17:6919243-6919265 AAGCAGGAATGGAGACGGGCAGG - Intronic
1143529457 17:7493759-7493781 TAGAAGGATTGGAGAGAGACAGG + Intronic
1143628476 17:8123957-8123979 CCGTCGGTCTGGAGAGAGGCTGG - Intronic
1144375873 17:14640751-14640773 AAGAGGGAGAGGAGAGAGGCAGG - Intergenic
1144833801 17:18146110-18146132 GAGTGGGACTGGATAGGGGCTGG + Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1146286052 17:31574831-31574853 AAGATGGGCTGGAGAGAGTCGGG + Intronic
1146526351 17:33570238-33570260 TACTAGGACTGAAGAAAGGCAGG - Intronic
1146986197 17:37220915-37220937 AAGAAGAAATGGAGAGGGGCAGG + Intronic
1147325906 17:39669523-39669545 AGGAAGAACTAGAGAGAGGCAGG + Intronic
1147780249 17:42935764-42935786 AAGTAGGAGTGTGGAGAGGAAGG - Intergenic
1148109657 17:45137324-45137346 AGGTGGGCCTGGGGAGAGGCTGG - Intronic
1148211697 17:45812775-45812797 AAGTGGGCCAGGAGAGAGGTGGG - Intronic
1148545921 17:48518982-48519004 GAGTAGGGCAGGAGAGACGCTGG - Intergenic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1149644414 17:58229362-58229384 GGGTAGGACTGCAGAGAGGAAGG - Intronic
1150125159 17:62630464-62630486 AAGGCTGTCTGGAGAGAGGCAGG + Intronic
1150560028 17:66286484-66286506 AAGGAGGAATGGGGAGAGGAGGG + Intergenic
1151113423 17:71705469-71705491 AAGTATAACTTGGGAGAGGCAGG - Intergenic
1151655674 17:75494909-75494931 AAATGGGCCTGGAGACAGGCTGG + Exonic
1151938558 17:77279342-77279364 AAGAAGGACAAGAGAGAGGGAGG - Intergenic
1152327789 17:79651665-79651687 AAGGAGGGAGGGAGAGAGGCGGG - Intergenic
1153810841 18:8750390-8750412 AAATATGCCTGGAGAGAGCCCGG + Intronic
1153995855 18:10440865-10440887 AAAGAGGACTGGACAGAGTCAGG - Intergenic
1154052728 18:10976819-10976841 AGGAAGGCCTGGAAAGAGGCAGG + Intronic
1156367390 18:36441458-36441480 AAGTGTGACTGGAGACAGGGAGG + Intronic
1156443962 18:37220704-37220726 AAGCAGCAGTGGTGAGAGGCTGG - Intronic
1157452420 18:47798818-47798840 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1157825615 18:50809349-50809371 AAGTAGGGATGGAAAGGGGCTGG + Intronic
1157977410 18:52341850-52341872 AAGAAGGAGAGGAGAGCGGCTGG + Intronic
1159424094 18:68261380-68261402 AAGGAGGCCTGGAGAGCAGCCGG - Intergenic
1160347885 18:78149847-78149869 AAGGAGGACTGAGGAGAGGGAGG + Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1161611912 19:5247914-5247936 AAGTCGCACTGGAGACAGGATGG + Intronic
1161621170 19:5298088-5298110 AAGAAAGACTGGAAGGAGGCCGG - Intronic
1161637180 19:5396273-5396295 AAAGAGGACTGGAAAGGGGCTGG + Intergenic
1161845254 19:6708500-6708522 AAGGAGGAATGGAGGGAGGAAGG - Intronic
1162182277 19:8878295-8878317 AAGGAGGAAGGGAGAGAGGATGG - Intronic
1162338970 19:10080020-10080042 AAGAAGGAATGGAGGGAGGGAGG + Intergenic
1162343773 19:10107941-10107963 CTGTAGGACAGGAGAGAGGAGGG - Intronic
1163026266 19:14514491-14514513 AAGTAGCGGTGGGGAGAGGCAGG - Intergenic
1163291928 19:16384617-16384639 AAGGAGGACAGCAGCGAGGCTGG - Intronic
1164645781 19:29858104-29858126 AGGTGGGAATGGGGAGAGGCTGG + Intergenic
1164794476 19:31014930-31014952 AAGGAAGAATGGAGAGAGGAAGG + Intergenic
1165184315 19:34003841-34003863 GAGTAGGACTGCAGAGAAACAGG - Intergenic
1165934995 19:39383785-39383807 AGGAAGGAAAGGAGAGAGGCAGG - Exonic
1166154911 19:40903706-40903728 AAGGAGGATTGGACAGAGACAGG + Intergenic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1166513284 19:43425669-43425691 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1166692740 19:44833508-44833530 AAGGAGGAAGGGAGAGAGGGAGG + Intergenic
1166758355 19:45208949-45208971 AAGGAGGACTGGGGAGACGGTGG + Intronic
1167146177 19:47681741-47681763 AGGTGGGGCAGGAGAGAGGCAGG + Intronic
1168061552 19:53895662-53895684 GAGTAGGTCTGCAGAAAGGCTGG - Intronic
1168350320 19:55671773-55671795 AAGAAGGAATGGAGAGACCCTGG + Intronic
1168434228 19:56304600-56304622 AGGTGGGAGTGGTGAGAGGCGGG + Intronic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
925986814 2:9223066-9223088 AAGTGTGACTTGAGAGATGCAGG - Intronic
926105119 2:10145091-10145113 AAGGAGGCCTGGAGAGAGGAGGG + Intronic
926293532 2:11550561-11550583 AAGTAGGGCTGAAGAGTGGGAGG - Intronic
927472777 2:23387266-23387288 TTGCTGGACTGGAGAGAGGCTGG - Intronic
927716903 2:25358994-25359016 AATGAGGAATGGAGAGAAGCAGG - Intergenic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
927858504 2:26542767-26542789 AAGCAAGACTGGAGAGGGGCTGG + Intronic
928660550 2:33497970-33497992 AAGAAGGGCTGGAGAAAGGGAGG - Intronic
928710777 2:34002909-34002931 AAGGATGACTGGAGAGAGAATGG - Intergenic
928806463 2:35162516-35162538 CAGTAGGACTGGAGTGGGCCTGG + Intergenic
928913740 2:36449364-36449386 AGGCAGGACTGGAGAGGGCCTGG - Intronic
928921898 2:36535162-36535184 AAGGAGGACAGGAGGGAGGGAGG + Intronic
929502841 2:42504920-42504942 CAGCATGACTGGAGTGAGGCTGG - Intronic
931544309 2:63364529-63364551 AGGTAGGACAGGTGACAGGCAGG - Intronic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
933273355 2:80257566-80257588 ATGCAGTGCTGGAGAGAGGCTGG + Intronic
933645320 2:84807922-84807944 AAGGAGGACTGGAAAAAGGAAGG - Intronic
933690157 2:85173375-85173397 AGGGAGCACTGGAGACAGGCAGG + Intronic
934116516 2:88802172-88802194 GAGTAGGAATGGAGTGAGTCAGG + Intergenic
934934643 2:98455960-98455982 AAGGAGTGATGGAGAGAGGCTGG - Intronic
935151631 2:100442078-100442100 AGATTGGACTGGAGAGAGGGTGG - Intergenic
935216873 2:100981675-100981697 AAGTAAGGCTGGAGAGGGGAGGG + Intronic
936233643 2:110725220-110725242 AAGGAGGAATGGAGGGAGGAAGG + Intergenic
936397022 2:112138797-112138819 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397066 2:112138944-112138966 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397074 2:112138971-112138993 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397089 2:112139025-112139047 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397148 2:112139245-112139267 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397163 2:112139299-112139321 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397213 2:112139488-112139510 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397228 2:112139542-112139564 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397250 2:112139623-112139645 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397265 2:112139677-112139699 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397345 2:112139969-112139991 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397360 2:112140023-112140045 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397396 2:112140158-112140180 ACGCTGGCCTGGAGAGAGGCGGG - Intronic
936397439 2:112140315-112140337 ATGCTGGCCTGGAGAGAGGCAGG - Intronic
937028539 2:118719092-118719114 TACCAGGGCTGGAGAGAGGCAGG + Intergenic
938018707 2:127888322-127888344 AAGGAGAACTGCAGAGACGCTGG + Intergenic
938292001 2:130155424-130155446 AGGGAGGACAGGACAGAGGCAGG + Intronic
939476511 2:142694357-142694379 CACTAGGACAGGAGCGAGGCTGG + Intergenic
939728215 2:145750232-145750254 CAGTATGACTGGAAAGAAGCTGG - Intergenic
941203617 2:162544786-162544808 ATGTGGGGCTGGAGACAGGCTGG - Intronic
941600382 2:167536301-167536323 AAGAAGGAAAGGAGAGAGGCAGG + Intergenic
942875929 2:180797530-180797552 AGGTAGGGGTGGAGAGAGGCAGG + Intergenic
944678484 2:202054306-202054328 AAGAAGGAAGGGAGAGATGCAGG + Intergenic
944972511 2:205010138-205010160 GAGAAGGAGTGGAGAGAGTCGGG + Intronic
945884013 2:215355504-215355526 AAGGTGGCCTGGAGAGAAGCAGG - Intergenic
946040073 2:216775544-216775566 AAGGAGGACTGGAATGAGGTTGG + Intergenic
946254016 2:218430249-218430271 AAGGAGAAATGGAGGGAGGCTGG + Intronic
947588608 2:231371742-231371764 AAGGAGGGCTGGGGAGAGCCTGG + Intronic
947955139 2:234183334-234183356 ATATAGGACTGGAGGGAGGCTGG - Intergenic
948025282 2:234771554-234771576 AAGTAGGACAGGAGGAAGGTAGG + Intergenic
948143186 2:235689447-235689469 AATTTTGACTGCAGAGAGGCAGG + Intronic
948274742 2:236699747-236699769 AACTTGGAGTGGAGAGAAGCAGG + Intergenic
948653719 2:239464350-239464372 AAGTAGGACAGCAGAGACACAGG + Intergenic
948940807 2:241195460-241195482 ACGGAGGCCTGGAGAGGGGCTGG - Intronic
948984426 2:241511511-241511533 AGGTAGGAGTGGAGAGAAGCTGG + Intergenic
949043272 2:241859021-241859043 GGGTAGGACTGGGGAGAGGGTGG + Intergenic
1169247891 20:4038242-4038264 AGGTAGGGCCGCAGAGAGGCAGG + Intergenic
1169284352 20:4295470-4295492 TAGGAGGACAGGAGAGAGCCAGG - Intergenic
1170069734 20:12353218-12353240 AAGTAGTTCTGAAGAAAGGCAGG - Intergenic
1170672373 20:18446276-18446298 AAGAAGGAAGGGAGAGAGGGTGG + Intronic
1170690970 20:18614802-18614824 AAGGAGGAAGGGAGAGAGGGAGG - Intronic
1170867982 20:20177372-20177394 CAGGAGGTCTGGAGATAGGCAGG + Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1170906235 20:20517276-20517298 CATTAGGACAGGAGTGAGGCTGG + Intronic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1171208213 20:23297467-23297489 AAGGCGAACTGGAGAGAGGCTGG + Intergenic
1172850218 20:37956474-37956496 AATTAGGATTGGGGAGAGGGTGG - Intergenic
1173187508 20:40852034-40852056 AAGAAGGACTTGAGAGAGAAAGG + Intergenic
1173557698 20:43978347-43978369 AAGAAGGGCGGGAGGGAGGCAGG - Intronic
1174251108 20:49220312-49220334 CAGTGTGAATGGAGAGAGGCGGG - Intronic
1174359343 20:50018082-50018104 GAGTAGGAATGGAGGGAGGGAGG - Intergenic
1174526943 20:51180076-51180098 AACTGGGGCTGGAGAGATGCAGG - Intergenic
1175182122 20:57156174-57156196 ACGTAGGACTGGAGAGTAGCTGG + Intergenic
1175501169 20:59452262-59452284 AGGGAGGTCTGGAGAGAGACAGG - Intergenic
1175693577 20:61084328-61084350 ACGTAGGTCTGGTGACAGGCAGG - Intergenic
1175694728 20:61093222-61093244 AAATGAGACTGGAGAGAGGGTGG - Intergenic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1177758387 21:25373911-25373933 AAGTGGGTGGGGAGAGAGGCTGG - Intergenic
1178018389 21:28378871-28378893 AAGTAGGGCTGCAGAGGAGCAGG + Intergenic
1178333378 21:31721130-31721152 AAGGAGGAATGGAGAGTGACTGG - Intronic
1178605471 21:34032981-34033003 AGGTAGCAGTGGAGGGAGGCAGG - Intergenic
1178625617 21:34215704-34215726 AAGTGGGACTTGACATAGGCTGG - Intergenic
1179309101 21:40181101-40181123 AAGTGTGACTGGGGAGAGTCTGG - Intronic
1179710228 21:43209107-43209129 AAGTGGAGCTGGACAGAGGCTGG - Intergenic
1181622385 22:24099902-24099924 AAGCAGGAAAGGAGGGAGGCAGG + Intronic
1182103751 22:27674538-27674560 AAGAAGGAGTGGGGAGAGGGAGG - Intergenic
1182736333 22:32534166-32534188 AGGAAGGAGGGGAGAGAGGCAGG + Intronic
1183264604 22:36817486-36817508 AGGTAGGAGTGGAGAGAGAAAGG - Intronic
1183318618 22:37150187-37150209 ATGTAGGAGGGGAGAGAGGGAGG - Intronic
1183592479 22:38788049-38788071 AGGCAGGCCTGGACAGAGGCTGG - Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
949506342 3:4731714-4731736 AAGGAGGAAAGGAGATAGGCAGG - Intronic
950164560 3:10784344-10784366 AAGGAGGAAAGGAGAGAGGAAGG + Intergenic
950526290 3:13526190-13526212 AAGTGGGCTTGCAGAGAGGCAGG + Intergenic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
953300609 3:41771954-41771976 TAGTGGGATTGGGGAGAGGCAGG - Intronic
953737498 3:45508887-45508909 AAGAAGGAAGGGAGGGAGGCAGG - Intronic
953788395 3:45928522-45928544 AAGTGGGTCTGGAGAGAGGGTGG + Intronic
954129651 3:48553909-48553931 AAGAAGGACTGCAGAAAGGACGG - Intronic
954298628 3:49687531-49687553 AAGTGGGGGTGGAGAGGGGCAGG - Intronic
954903918 3:54043677-54043699 AAGAAGGAGGGAAGAGAGGCAGG + Intergenic
956111106 3:65870619-65870641 GAGAAAGACAGGAGAGAGGCAGG + Intronic
956181314 3:66520415-66520437 CAGGAGGACAGCAGAGAGGCTGG - Intergenic
956886318 3:73563879-73563901 AGGTAGGACTTGAGGCAGGCTGG + Intronic
959538336 3:107512439-107512461 AAGTATGACTGGAGAGGAGAAGG + Intergenic
960983492 3:123254487-123254509 AAGTGGGAGTGGACAGAGGTGGG - Intronic
961031053 3:123604344-123604366 AAGTTGGACTGGAGAGACCACGG - Intergenic
962388976 3:134956069-134956091 AAGTTGGACTGCAGGGAGGAAGG + Intronic
963332373 3:143928997-143929019 ATGGAGGAGTGGAGAGGGGCAGG - Intergenic
964427788 3:156571367-156571389 AAGTAGCACTGGGGTGAAGCAGG + Intergenic
965907042 3:173721680-173721702 AAGAAGGACTGGAGATAGTAGGG + Intronic
966944334 3:184767291-184767313 AAGAAAGAATGGAGAGAGGGAGG + Intergenic
967496073 3:190145783-190145805 AAGGAGGAATGGAGAGTGGAAGG - Intergenic
968650302 4:1757739-1757761 AGGTAGGAGTGGAGACAGGGTGG - Intergenic
968953839 4:3708340-3708362 GAGTGAGAATGGAGAGAGGCGGG - Intergenic
969481294 4:7448458-7448480 AAGAAGGAAGGGAGAGAGGGAGG - Intronic
969504284 4:7574578-7574600 AAGGAGGGAGGGAGAGAGGCAGG + Intronic
970365044 4:15350064-15350086 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
970807960 4:20057961-20057983 AAAGAGGACTGGATAGAGCCAGG + Intergenic
971364516 4:25967004-25967026 AAGAATAACTGGAGAAAGGCCGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972766541 4:42156659-42156681 AAGGAGGAGAGGAGAGAGGCGGG + Intergenic
972889742 4:43542319-43542341 AGGGAGGAATGGAGAGAGGGAGG - Intergenic
973036639 4:45415458-45415480 ATTTAGGACTGGAAAGATGCAGG + Intergenic
973744324 4:53948372-53948394 AAGAAGGACAGGAGAGAAGGAGG + Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974671633 4:65037351-65037373 AAGTAGATCTGGAGAGACGTTGG - Intergenic
975168144 4:71201174-71201196 AAGTTGGACTGGGAAGAGGGAGG + Intronic
975379356 4:73680404-73680426 AAGGAGGGATGGAGAGATGCAGG + Intergenic
975938131 4:79606814-79606836 AAGTAGCACTGCAGAGAAGATGG - Intergenic
976489398 4:85651135-85651157 AAACAGGACGGGGGAGAGGCAGG + Intronic
977206917 4:94173560-94173582 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
978797239 4:112720401-112720423 AAGTAAGACTGGAGAAAAGATGG - Intergenic
978818975 4:112943344-112943366 AAGAAGGGATGGAGAGAGGCAGG - Intronic
979769246 4:124502209-124502231 AAGAAGGAATGGAGAAAGGAAGG + Intergenic
980344562 4:131596289-131596311 AAGAAGGAAGGGAGAGAGGGAGG - Intergenic
981747919 4:148068862-148068884 AAGTAGCACCAAAGAGAGGCAGG - Intronic
982645208 4:158015507-158015529 CAGTAGGGCTGGAAAAAGGCTGG + Intergenic
983588494 4:169382301-169382323 AAGGAGGAATGAAGAGAGGCTGG + Intergenic
984936978 4:184898122-184898144 TAGCAGGCCTGGACAGAGGCAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985212694 4:187612218-187612240 AATAAGGAATGAAGAGAGGCAGG + Intergenic
985941330 5:3138733-3138755 AAGTAGGACTGGAGCCAGGGAGG - Intergenic
986088598 5:4479160-4479182 TGGGAGGACAGGAGAGAGGCAGG - Intergenic
986969789 5:13319143-13319165 AAGAGGGATTGGAAAGAGGCTGG - Intergenic
987256956 5:16164879-16164901 AGACTGGACTGGAGAGAGGCAGG - Intronic
987599871 5:20053968-20053990 AAGTAGGATTGGACAGAGAAAGG - Intronic
987723840 5:21671753-21671775 AAGGAGGAATGGAGGGAGGGAGG - Intergenic
989103235 5:37839312-37839334 AAGTAGAACCGGAGAGAGGCCGG - Intronic
990878683 5:60517059-60517081 AGCTAGGAGTGGGGAGAGGCTGG - Intronic
991558471 5:67923041-67923063 AAGAAGGTATGGAGAGAGGGAGG + Intergenic
991942128 5:71863206-71863228 AAGGAGGAAAGGAGAGAGGGAGG - Intergenic
993033219 5:82728338-82728360 AACAAGGACTGGTGAGAGACTGG - Intergenic
993249711 5:85504319-85504341 AAGTAGGTCTAGAGAGATGCAGG + Intergenic
993536784 5:89096149-89096171 ATGAAGGAGTGGGGAGAGGCAGG - Intergenic
994320969 5:98393535-98393557 AAGCAGGAGTGGAGGCAGGCGGG + Intergenic
996092682 5:119366095-119366117 AAGTAGGAGTGGAGAGAGAGAGG + Intronic
996097575 5:119414982-119415004 AAGTAAGACAGAAAAGAGGCTGG + Intergenic
996509759 5:124305034-124305056 AAGGAGGACTGGAGGGTGGAAGG - Intergenic
997191601 5:131942026-131942048 AAGAAGGACTGGAAAGAATCAGG - Intronic
997660402 5:135585068-135585090 AGGTGGCACTGCAGAGAGGCAGG + Intergenic
998185397 5:139975403-139975425 AAGTAGGACTGGGGTAAGGGTGG - Intronic
998533398 5:142906494-142906516 CAGTAGGAAGGGAGAGAGGGAGG - Intronic
999070276 5:148736994-148737016 AAGTTGGACTAGAGAGTGACAGG - Intergenic
999948431 5:156622685-156622707 AAGTATGACTGGACAAAGGGGGG + Intronic
1000203002 5:159030466-159030488 ATGAAGCACTAGAGAGAGGCAGG + Intronic
1000922744 5:167158295-167158317 AAGTAAGAGTGGTGAGGGGCTGG - Intergenic
1002213246 5:177610626-177610648 CCACAGGACTGGAGAGAGGCAGG + Intergenic
1002270223 5:178066954-178066976 AAGGAGGATGGGAGAGAAGCAGG + Intergenic
1002364104 5:178696782-178696804 AAGCAGTACTGGGGAGAGGGTGG + Intergenic
1002516086 5:179760043-179760065 AAACAGGACTGGGGAGAGGCTGG + Intronic
1002916006 6:1528475-1528497 CAGTAGGATTTGAGAGAGGAAGG - Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003236046 6:4295901-4295923 CAGCAGGACTGGGGTGAGGCTGG - Intergenic
1004903009 6:20211233-20211255 AAGGAGCACTGGTGAGAGGAAGG + Intronic
1005682882 6:28224602-28224624 AAGGAGGATGGGAGAAAGGCAGG + Intergenic
1006388868 6:33747084-33747106 AAGGAGGACTGGTCTGAGGCAGG + Intergenic
1006779797 6:36624574-36624596 AATGAGGACTGGGGAGAGCCTGG + Intergenic
1007174317 6:39885715-39885737 CAGCAGGACTGGAGAGATCCCGG + Intronic
1007410136 6:41656750-41656772 AAAGAAGACTGGAGAGAGGCAGG - Intergenic
1007518406 6:42431584-42431606 AAGTAGAACTGGAGGAAGGGAGG + Intronic
1007817368 6:44534159-44534181 AAGTTGGAATTGACAGAGGCTGG + Intergenic
1010725881 6:79332521-79332543 AAGTGGTTCTTGAGAGAGGCTGG - Intergenic
1011184097 6:84655097-84655119 CAGTAGGATTGGGGTGAGGCTGG + Intergenic
1011255356 6:85415026-85415048 AAGTGGGACTGGACAAAGGAAGG - Intergenic
1011260198 6:85462264-85462286 AAGTAGGGCTGGAGGCAGTCCGG - Intronic
1011743641 6:90387985-90388007 AAGGAGGAGGGGAGAGAGGGAGG - Intergenic
1012335686 6:98053616-98053638 CAGTAGGAGTGGAGAGAGAGTGG + Intergenic
1013808285 6:114017150-114017172 AAGTAGGAATGGAGGGTGGAAGG + Intergenic
1014020552 6:116583364-116583386 TAGTAGGAATGGTGAGATGCTGG + Intronic
1014179604 6:118370765-118370787 GAGTTGGCCTGGAGAGAGGTGGG - Intergenic
1015364731 6:132385002-132385024 TAGTATCACTGGAGAGAGGTGGG + Intronic
1015383712 6:132598870-132598892 AAGAAGGATGGGAGAGAGGAAGG + Intergenic
1015998506 6:139018829-139018851 AAGGAGGACAGGAGGGAGGGAGG + Intergenic
1016395475 6:143619245-143619267 AACTAGGTCTGGAGTGGGGCTGG - Intronic
1016919645 6:149279275-149279297 AGGTAGGAGTGGAGAAAGACTGG - Intronic
1016990768 6:149926146-149926168 AAGAAGGATTGGAGGGAGGGCGG + Intergenic
1017007499 6:150038283-150038305 AAGAAGGATCGGAGAGAGGGCGG + Intergenic
1017038605 6:150289399-150289421 AAGCAGGACTGGAGAGCTGAGGG + Intergenic
1017682933 6:156882284-156882306 AAGAAGCACAGCAGAGAGGCAGG - Intronic
1018219152 6:161561354-161561376 ATGGATGGCTGGAGAGAGGCAGG - Intronic
1018470512 6:164092557-164092579 AAGTAGGGCTGAAGAGATACAGG + Intergenic
1020257199 7:6508925-6508947 AAGCAGGTGTGGAGGGAGGCGGG - Intronic
1020990308 7:15187409-15187431 AAGTAGCTCTACAGAGAGGCTGG - Intergenic
1021760130 7:23895599-23895621 ACTTAGGACTGGAGTGAGGGAGG + Intergenic
1022337321 7:29433912-29433934 AAGGAGGGAGGGAGAGAGGCAGG + Intronic
1022422926 7:30241052-30241074 TATTAGGAATGGAGAGAGGTGGG + Intergenic
1022537931 7:31109528-31109550 AAGTGGGGCTGGGGAGAAGCAGG + Exonic
1022894018 7:34730918-34730940 AAGTAGGAGAGGAGAGGGGCAGG + Intronic
1023649417 7:42352752-42352774 AAGTAGGACTGAAATGAGGGAGG + Intergenic
1024248267 7:47487000-47487022 AGTAAGGACTGAAGAGAGGCCGG + Intronic
1025232855 7:57214326-57214348 CAGTAAGACAGGAGAGTGGCAGG - Intergenic
1025488135 7:61077431-61077453 AGGGAGGAATGGAGAAAGGCAGG - Intergenic
1025837903 7:65112912-65112934 AAGGAGGAAGGGAGAAAGGCAGG + Intergenic
1025879366 7:65520171-65520193 AAGGAGGAAGGGAGAAAGGCAGG - Intergenic
1025885165 7:65583072-65583094 AAGGAGGAAGGGAGAAAGGCAGG - Intergenic
1026290996 7:69006093-69006115 GAGTAGGAAGGGTGAGAGGCTGG - Intergenic
1026509357 7:71015680-71015702 AAGGAGGACTGGAGTGAGTTCGG + Intergenic
1027416900 7:77983456-77983478 AGGGAGGAAGGGAGAGAGGCAGG - Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027717012 7:81685283-81685305 AAGTAGGTTTGGAGATAGACAGG - Intergenic
1028061239 7:86319324-86319346 AAGAAGGAGGGGAGAGAGACAGG + Intergenic
1028776603 7:94684332-94684354 AAGTAAGAAGGGAGAGAGGAAGG - Intergenic
1029234144 7:99099264-99099286 GAGAAGGAATGGAGAGAGGCAGG + Intronic
1030090279 7:105852147-105852169 ATGGGGGACTAGAGAGAGGCAGG - Intronic
1030650898 7:112115008-112115030 TAGATAGACTGGAGAGAGGCAGG - Intronic
1031844810 7:126792399-126792421 AAGCAGGGCTGGGGAGAGACTGG - Intronic
1032444552 7:131970833-131970855 AGGAAGTGCTGGAGAGAGGCTGG - Intergenic
1032598450 7:133267050-133267072 AAGTGGGACTAAAGAGATGCAGG - Intronic
1033154596 7:138946075-138946097 ACGTGGGACTGGGGAGAGGCAGG - Intronic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1034120359 7:148621201-148621223 TAACAAGACTGGAGAGAGGCTGG - Intergenic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1036475100 8:9086056-9086078 AATTAGGACTTGAAAGAGGACGG - Intronic
1036616195 8:10389667-10389689 AGGCAGGACTGGAGAGAGGATGG - Intronic
1036643721 8:10599589-10599611 AAGTTGTACTGGGGAGAGGGAGG + Intergenic
1037009742 8:13826071-13826093 ACGAAGGACTGGAGAGTGCCAGG + Intergenic
1037331934 8:17751472-17751494 AAGGAGGACTGGAAAGTGTCTGG - Intronic
1037752835 8:21693759-21693781 AAGAAGGAGAGGAGAGAGGAAGG + Intronic
1038349449 8:26762892-26762914 CATCAGGACTGGAGAGAGGAAGG + Intronic
1039764422 8:40613105-40613127 GAGAATGACTGGATAGAGGCCGG - Intronic
1040063448 8:43124530-43124552 AAGGAGGACTGGAGAGACAATGG + Intergenic
1041446588 8:57958426-57958448 AAGTAGTAATGGAGAGAGTCTGG - Intergenic
1041837314 8:62231006-62231028 AATAGGGACTGGTGAGAGGCAGG - Intergenic
1043161929 8:76856226-76856248 GAGAAGGACTGGAGGAAGGCCGG - Exonic
1043529977 8:81138780-81138802 AAGTAGGGATGGAGAGTGGCAGG + Intergenic
1043547811 8:81335081-81335103 AGGGAGGACAGGAGAGAGGAAGG + Intergenic
1045161372 8:99549753-99549775 CAGCGGGCCTGGAGAGAGGCAGG - Intronic
1045362841 8:101449007-101449029 AAACAGGACTGGAGAGTGCCTGG + Intergenic
1045664583 8:104470935-104470957 TAGTAGGAGTGGAGAGGGTCAGG - Intergenic
1045677132 8:104619822-104619844 AGGTAGGAAGGGAGAGACGCAGG - Intronic
1046386485 8:113513949-113513971 AAGGAGGAATGGAGAGTGGAAGG + Intergenic
1046512250 8:115215512-115215534 AAGTGGAAGTGAAGAGAGGCTGG - Intergenic
1047219036 8:122903835-122903857 CAGTAGGACTGGAAAGAGAGGGG + Intronic
1047336728 8:123943253-123943275 AAGTATGTCTGGATAGTGGCTGG + Intronic
1047789059 8:128183845-128183867 AAGAAGGAAGGGAGAGAGGGAGG - Intergenic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1048287208 8:133151246-133151268 AAAAAGGACTGGAGAGAGTCTGG - Intergenic
1049228241 8:141467906-141467928 AAGGAGGACTGGAGCCTGGCAGG - Intergenic
1049261182 8:141640128-141640150 ATGGAGAACTTGAGAGAGGCTGG + Intergenic
1049358032 8:142198383-142198405 CAGCCGGACAGGAGAGAGGCAGG - Intergenic
1049361076 8:142212859-142212881 AGGAAGGATTGGAGAAAGGCGGG - Intronic
1049579303 8:143404185-143404207 AAGTAGGACATCAGAAAGGCGGG - Intergenic
1049692799 8:143969933-143969955 AAGCGGGCCTGGAGAGGGGCTGG + Intronic
1050140324 9:2510651-2510673 AAGGAGGAATGGAGAGTGGAAGG - Intergenic
1050550377 9:6744042-6744064 ACATAGAACTGGAGAGGGGCCGG - Intronic
1051181879 9:14419947-14419969 AATTAGTCCTGGAGAGAGGAAGG + Intergenic
1051352411 9:16210217-16210239 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
1051638223 9:19200767-19200789 AAGGAGAACTGGAGAAAGGAAGG - Intergenic
1053054736 9:34987880-34987902 AAGAAGGGCTGGGGAGGGGCAGG - Intergenic
1054952757 9:70871396-70871418 AAGTAAGACTGGAGAGAATCGGG - Intronic
1055001332 9:71452429-71452451 AAGGAGGGATGGAGAGAGGGAGG + Intergenic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055292055 9:74792457-74792479 AAAGAGGACTGGAGGAAGGCAGG - Intronic
1055809463 9:80135276-80135298 TAGTAAGACTGGCCAGAGGCAGG - Intergenic
1056027547 9:82514777-82514799 AAGTAGGAAAGGAGGGAGGGAGG - Intergenic
1056316864 9:85398608-85398630 AACTAAGGCTGGAGAGGGGCTGG - Intergenic
1057179127 9:93020402-93020424 AGGCATGTCTGGAGAGAGGCTGG - Exonic
1057968995 9:99535196-99535218 AAATAGGACTGTAGAGAGATAGG - Intergenic
1058330465 9:103753971-103753993 AAGGAGGGAAGGAGAGAGGCAGG - Intergenic
1058632099 9:106999927-106999949 TAGTTGGACTGGGGAGGGGCAGG + Intronic
1059379299 9:113910695-113910717 AGGAAGGACAGGAGAGAGGATGG - Intronic
1059960879 9:119563298-119563320 AAGTTGGACTTGGGAGGGGCTGG + Intergenic
1060109081 9:120893963-120893985 CAGTAGTTCTGGAGTGAGGCTGG - Intronic
1060126563 9:121053436-121053458 AAGACTGACTGGAGAGAGGGCGG + Intergenic
1060252477 9:121997389-121997411 AGGTGGGGCTGGACAGAGGCTGG - Intronic
1060337222 9:122736689-122736711 GAATAGGTCTGGAGTGAGGCAGG + Intergenic
1060968447 9:127724456-127724478 AAGGAGGAAGGGAGAGAGGAAGG + Intronic
1061271542 9:129546575-129546597 AAGAAGGAGTGGAGAAAGGTGGG - Intergenic
1061498375 9:130988868-130988890 AAGTGGCAATGGAGAGAGGATGG + Intergenic
1061864246 9:133484464-133484486 GAGAAGGACAGGAGAGAGGAAGG - Intergenic
1062050990 9:134446951-134446973 AAGCAGGGCTGGAGAGAGACGGG + Intergenic
1062352118 9:136144316-136144338 CTGCAGGTCTGGAGAGAGGCTGG + Intergenic
1062586543 9:137252277-137252299 AAGGAGGCCTGGAGAGAGGAGGG + Intronic
1062586732 9:137252968-137252990 AAGGAGGCCTGGAGAGAAGAGGG + Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1185525263 X:773534-773556 AAGAAGGAAGGGAGAGAGGAAGG + Intergenic
1185534838 X:852853-852875 AAGAAGGGATGGAGAGAGGTTGG - Intergenic
1185661797 X:1734289-1734311 AAGTAGAATTGAAGAGAAGCGGG + Intergenic
1185776632 X:2808557-2808579 AAGAAGGACAGGAGAAAGGAAGG + Intronic
1186269189 X:7866473-7866495 AAGAAGGAAGGGAGAGAGGAAGG - Intergenic
1187126317 X:16457621-16457643 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1187258899 X:17667302-17667324 AAGCACAAATGGAGAGAGGCAGG + Intronic
1187871284 X:23767088-23767110 GAGAAGCACAGGAGAGAGGCTGG - Intergenic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1189924321 X:45936934-45936956 AAGCAGGATTGGACAGAGGGAGG + Intergenic
1190053448 X:47168951-47168973 ACATAGGGATGGAGAGAGGCAGG + Intronic
1190287501 X:48971059-48971081 TAGTAGGGCTGGAGAGGGGAAGG + Exonic
1190417258 X:50192253-50192275 AAGTTGGAATGGGCAGAGGCAGG - Intronic
1190746830 X:53328823-53328845 CAGTAGGACTGGGGAAATGCAGG - Intergenic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1191820928 X:65306996-65307018 AAGTGGGTATGGTGAGAGGCTGG + Intergenic
1191975609 X:66867919-66867941 AAGTAGGACTGGCTAGAGCTGGG - Intergenic
1192141073 X:68647630-68647652 AAGGAGGGAGGGAGAGAGGCCGG - Intergenic
1192183656 X:68931449-68931471 AAGTAGGGCTCAAGACAGGCTGG - Intergenic
1194319541 X:92427035-92427057 AAGAAGGAAAGGAGAAAGGCAGG - Intronic
1194648364 X:96485987-96486009 ATGTAAGAGAGGAGAGAGGCCGG + Intergenic
1195095563 X:101498102-101498124 AAGCAGGATTGGACAGAGGGAGG - Intronic
1195597664 X:106711165-106711187 GAGTAGGTGGGGAGAGAGGCTGG - Intronic
1196418247 X:115496048-115496070 TAGAGGGACTGGAGAGGGGCTGG + Intergenic
1197899307 X:131352749-131352771 CATTACGACTGGAGAGAGGTAGG + Intronic
1199161956 X:144623377-144623399 AAGTCAGACTGGAGGGAGGCAGG + Intergenic
1199211849 X:145221605-145221627 AAGCAGGACAGGAGAAAAGCAGG + Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199868186 X:151873114-151873136 AAGTAGGAATGCAGGGTGGCAGG + Intergenic
1200116005 X:153770000-153770022 AAGGAGGACGGGAGGCAGGCGGG - Intronic
1200627665 Y:5540111-5540133 AAGAAGGAAAGGAGAAAGGCAGG - Intronic
1200791734 Y:7305259-7305281 GAGGATGACTGGAGAGAGACTGG - Intergenic
1201256097 Y:12109631-12109653 AGGGAGGACTGGAGGGAGGGAGG + Intergenic
1201267140 Y:12218278-12218300 AAGAAGGAAGGGAGAGAGGAAGG - Intergenic
1201484991 Y:14484520-14484542 AATGAGGACTGGACAGAGGGTGG - Intergenic
1201517703 Y:14835676-14835698 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
1201550256 Y:15211150-15211172 AAGAAGGAAGGGAGAGAGGGAGG + Intergenic
1201631951 Y:16079104-16079126 AAGTAGCTCTGGTGAGTGGCTGG - Intergenic