ID: 1170898882

View in Genome Browser
Species Human (GRCh38)
Location 20:20440822-20440844
Sequence CGGGGCATTCTGAAGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170898882 Original CRISPR CGGGGCATTCTGAAGAAAGT GGG (reversed) Intronic
901719637 1:11186272-11186294 CGGGGCATTTTCAAGCAAATGGG + Intronic
902277766 1:15351695-15351717 CGGGGCATGCAGAAGAGTGTGGG + Intronic
902435575 1:16396338-16396360 CAGAACATTCTGAATAAAGTTGG + Exonic
904674328 1:32189477-32189499 AGTGCCATTCTGAAGCAAGTCGG - Intronic
909426254 1:75528605-75528627 GGCTGCATTCTGGAGAAAGTTGG - Intronic
909742295 1:79045433-79045455 CGGGGCAGTCAGAGGAAAGCTGG - Intergenic
911723578 1:101218012-101218034 CGGGGGATTGTAAAGAAATTAGG + Intergenic
912485462 1:110024023-110024045 GGGGGCATTCTTCAGAAATTAGG - Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
915124291 1:153652641-153652663 TGAGGCAGTCTGCAGAAAGTGGG + Intergenic
916629242 1:166593844-166593866 GGGAGAATTCTTAAGAAAGTGGG - Intergenic
920403327 1:205691071-205691093 CGGGGTATTGTGAAGAAGGGAGG - Intergenic
921720908 1:218469972-218469994 AGGGGCTCTATGAAGAAAGTAGG + Intergenic
1063003603 10:1947192-1947214 CTGGGAATTGAGAAGAAAGTGGG + Intergenic
1065195079 10:23256622-23256644 CGGGGCAGTCTGAAGTAGCTGGG + Intergenic
1070051787 10:72896462-72896484 AGGGGCATTTTAAAGAAAGAGGG + Intronic
1070428253 10:76310243-76310265 AGCGGCATTCTCAAAAAAGTTGG + Intronic
1071116232 10:82223693-82223715 TGGGGCATCCAGAAGAACGTGGG - Intronic
1072926113 10:99619113-99619135 CAGGTCCTTCTGAAGAAAGCTGG - Intronic
1073974401 10:109085096-109085118 CAGAGCATTCTGAATAAAGTTGG + Intergenic
1074481594 10:113826801-113826823 GGGGTTATTCTGAAGAAAATTGG - Intergenic
1076463139 10:130660076-130660098 AGGGGCATTCAGAAGGAGGTTGG + Intergenic
1076756028 10:132572241-132572263 GGGGGCCTTCAGAAGAATGTCGG + Intronic
1079095978 11:17510351-17510373 TGGGTCATTCTGAAGACAGCAGG + Intronic
1079541571 11:21582231-21582253 CTGGGCATTTTGAAGAAATGTGG + Intergenic
1080825909 11:35849222-35849244 CAGGGCATACACAAGAAAGTAGG - Intergenic
1081596128 11:44460833-44460855 GGGGGCACTGTGAAGAGAGTGGG - Intergenic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1085615636 11:77996030-77996052 TGAGGCACTCTGAAGAAATTAGG - Intergenic
1089917607 11:122173657-122173679 TGGGGCATTCAGAAGCAAGTGGG - Intergenic
1091633988 12:2183584-2183606 CGTGACATTCTGATGAAAGCCGG - Intronic
1093769625 12:23003558-23003580 GGGGGTACTCTGAAGAAAGAGGG - Intergenic
1096444150 12:51673556-51673578 CTGGGCACCCAGAAGAAAGTTGG + Intronic
1098688881 12:73461854-73461876 AGAGGCATTCTGAAGATATTAGG + Intergenic
1100273057 12:93044561-93044583 TGTGGCCTCCTGAAGAAAGTAGG + Intergenic
1100700498 12:97142664-97142686 TAGGGCATTCTAAAGAAAGAGGG - Intergenic
1101331642 12:103762179-103762201 CGAGGCATTCTGGAGCCAGTGGG - Intronic
1102097672 12:110253186-110253208 CGGCTTATTCTGGAGAAAGTAGG - Intergenic
1102596785 12:113999041-113999063 CTGGTCATTTTGAAGAAAATGGG + Intergenic
1107963623 13:45579879-45579901 CAGGGCACTCTGAAGAAAGCAGG + Intronic
1109155314 13:58902214-58902236 CAGGGAAATCTGAATAAAGTAGG - Intergenic
1112975269 13:105309649-105309671 TGGGGCATTCTGATGGAATTTGG - Intergenic
1116936431 14:50745215-50745237 CGGGGCATTCTGGACACTGTAGG + Intronic
1117156839 14:52950684-52950706 CGGGGCTTTCGGCAGAAACTCGG + Intronic
1120077880 14:80180896-80180918 CTGAGCCTTCTGGAGAAAGTTGG + Intergenic
1133971696 16:10572782-10572804 AGGTGCATTCTGAAGACAGTAGG - Intronic
1135958230 16:26974449-26974471 AGGGTAATTCTGAAGAAAATTGG + Intergenic
1142574502 17:897575-897597 CGGGGCATTGTGAAGCTAATAGG - Intronic
1143038277 17:4013813-4013835 CAGGGCATTTTGAAAAAAGGAGG - Intronic
1143762719 17:9116563-9116585 CAGGGCTTTCTGTAGATAGTGGG + Intronic
1144777807 17:17793568-17793590 CTGGGAATGCTGAGGAAAGTGGG - Exonic
1145060877 17:19732742-19732764 TGGGGCATTATGAATAAAGTAGG + Intergenic
1146275208 17:31512036-31512058 CAGGGCATTCTGGAGAGAGCTGG - Intronic
1150499144 17:65633394-65633416 CGGGGCATAATGAAGAAAACAGG - Intronic
1150704052 17:67471808-67471830 TGGTGAAATCTGAAGAAAGTCGG - Intronic
1156307999 18:35897107-35897129 CGGGGCATTGTCAGGAAAATTGG - Intergenic
1156763323 18:40620237-40620259 TGAAGAATTCTGAAGAAAGTTGG - Intergenic
1158781362 18:60656215-60656237 AGGGGCAGCCTGAAGAAATTTGG + Intergenic
1161759608 19:6161473-6161495 TGGGGCCTTGTGAGGAAAGTGGG + Intronic
1162301200 19:9846156-9846178 CGGGGCATTCTGATCAAACCAGG + Intronic
940895725 2:159080588-159080610 CAGAGCATTCTGAATAAAGTTGG + Intronic
946970846 2:225089364-225089386 AGGGGCATTTGGAAGAAAGAAGG + Intergenic
1170898882 20:20440822-20440844 CGGGGCATTCTGAAGAAAGTGGG - Intronic
1173308419 20:41873624-41873646 CGGGGCATCGAGAAGAAACTGGG + Intergenic
1180730803 22:17980716-17980738 TGTGGCACTCTGGAGAAAGTGGG - Intronic
1182568992 22:31222009-31222031 CAGTGCATTATGCAGAAAGTGGG + Intronic
953769388 3:45767096-45767118 AGGGGCATACTGAAAATAGTTGG + Intronic
955561184 3:60192583-60192605 CAGGGCATTCAGAAGTAAATGGG + Intronic
956077147 3:65517529-65517551 AGGGGAAAACTGAAGAAAGTGGG + Intronic
957956394 3:87194158-87194180 CAGGGCATTCTGAAGACAAGCGG - Intergenic
963441933 3:145351368-145351390 CTGGGCATTGTGCAGAAACTAGG - Intergenic
963811166 3:149777736-149777758 GAAGGCATTCTGGAGAAAGTGGG - Intronic
970302872 4:14700143-14700165 CTGGGCAATCTGAAGACTGTTGG - Intergenic
971865975 4:32172995-32173017 CCAAGCATTCTGAAGAAAGAAGG + Intergenic
979144049 4:117218097-117218119 AAGGGCATTTTGAAGAACGTTGG + Intergenic
979681782 4:123467902-123467924 TGGGGCATACGGAAGGAAGTAGG - Intergenic
982504417 4:156198837-156198859 GGGGGCAGTCGGAAGAGAGTCGG + Intergenic
988708946 5:33754380-33754402 CTGGGCATTCAGAAGAACCTGGG + Intronic
990451321 5:55933804-55933826 GGGTGCATTCTCAGGAAAGTGGG + Intergenic
994607855 5:101993315-101993337 CAGTGCATTTTGAAGATAGTTGG - Intergenic
996489796 5:124080306-124080328 CATGGGATTCTGAAGAAAGAAGG - Intergenic
1005824308 6:29623405-29623427 GGGTGCGTTCGGAAGAAAGTGGG + Exonic
1018709838 6:166490449-166490471 CTGGGCATTCTAATGACAGTGGG - Intronic
1020595800 7:10205441-10205463 CATGGCATGTTGAAGAAAGTAGG + Intergenic
1022127267 7:27370524-27370546 CATGGCATTCTGAAGTAAATTGG + Intergenic
1024442016 7:49430973-49430995 AGAGGGATTCTGAAGAAAGGAGG - Intergenic
1040560206 8:48517106-48517128 GGGGGAATTCTGAAGATGGTGGG - Intergenic
1043946395 8:86258752-86258774 CTGAACATTCTGAAGAAAGTAGG + Intronic
1047039184 8:120973964-120973986 CAGGTCATTCTGAAGAAAAATGG + Intergenic
1053421539 9:37983028-37983050 CTGGGCATTCAGTAGATAGTTGG - Intronic
1055005799 9:71504571-71504593 GAGGGCATTCTGGAGAAGGTAGG + Intergenic
1055758083 9:79576059-79576081 TGGGGCATTTTGAACAAACTAGG + Intronic
1056024399 9:82477885-82477907 CCTTGCATCCTGAAGAAAGTTGG - Intergenic
1058729220 9:107834034-107834056 AGGGGCATTCTGATGGAAGAGGG - Intergenic
1059406013 9:114098644-114098666 CGGGGCATTCTGGGGAGGGTAGG + Intronic
1062096476 9:134706437-134706459 TGGGGCATCCTGCAGAAGGTGGG + Intronic
1189094058 X:38119145-38119167 CTGGGAATTCTGAATAAAATTGG - Intronic
1189107321 X:38250342-38250364 GGGGGCAATCTTTAGAAAGTTGG + Intronic
1194170965 X:90581043-90581065 AGGTGCTTTCTGAAGAAAGATGG + Intergenic
1194799132 X:98249907-98249929 GGGGCCCTTCTGAAGAAATTAGG - Intergenic
1194845686 X:98805362-98805384 AGGGACATTCAGAAGAAAATTGG - Intergenic
1196126042 X:112099990-112100012 TGAAGCATACTGAAGAAAGTAGG + Intergenic
1196514434 X:116552891-116552913 GTTGGTATTCTGAAGAAAGTGGG - Intergenic
1197094233 X:122574472-122574494 CAGGGCATCCTGGAGGAAGTGGG + Intergenic
1199739105 X:150715729-150715751 CGGGGAAATCTGAAGCAATTGGG + Intronic
1200517200 Y:4158789-4158811 AGGTGCTTTCTGAAGAAAGATGG + Intergenic
1201707197 Y:16950188-16950210 CTGGCCATTCTGAAGACATTAGG + Intergenic