ID: 1170900111

View in Genome Browser
Species Human (GRCh38)
Location 20:20454361-20454383
Sequence CTGAGGCTCTCGCACACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170900107_1170900111 5 Left 1170900107 20:20454333-20454355 CCAGTCCTCTCTGACCGGCAGGC No data
Right 1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 201
1170900110_1170900111 -9 Left 1170900110 20:20454347-20454369 CCGGCAGGCAGCTGCTGAGGCTC 0: 1
1: 0
2: 5
3: 40
4: 472
Right 1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 201
1170900108_1170900111 0 Left 1170900108 20:20454338-20454360 CCTCTCTGACCGGCAGGCAGCTG 0: 1
1: 0
2: 2
3: 28
4: 203
Right 1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170900111 Original CRISPR CTGAGGCTCTCGCACACAGC AGG Intronic
900758342 1:4453517-4453539 CTGAGGGTCTGTCACACAGTAGG + Intergenic
901198771 1:7455014-7455036 CCGAGGCTCTGGCACGGAGCAGG - Intronic
901610700 1:10495682-10495704 CTGAGGCGCTCGCACCCTGAGGG - Intronic
902723768 1:18322149-18322171 CACAGGGTCTCGCACACAGGAGG + Intronic
906697638 1:47834268-47834290 CTGAGGCATTCGAAAACAGCTGG + Intronic
907328384 1:53655737-53655759 ATGGGGGTCTGGCACACAGCAGG + Intronic
907356261 1:53877125-53877147 CAGAGGCCTTGGCACACAGCAGG - Intronic
907518010 1:55005696-55005718 CTCAGTCTCTGGCACACAGAAGG - Intronic
909676920 1:78249078-78249100 CTGTGGCTCTCTCAAACAGAAGG - Intergenic
917502876 1:175601667-175601689 CTCAGGCCCTGGCACACAACAGG - Intronic
920047285 1:203141474-203141496 CTGAGGCACACCCACACTGCTGG + Intronic
920453244 1:206076507-206076529 CAGAGGCTCACGCCCACGGCAGG + Intronic
920628386 1:207626629-207626651 CTGTGGCTCTCCCATAGAGCAGG - Intronic
923127022 1:231041070-231041092 CCGAGGCTCTGGCTCACAACCGG + Intergenic
923525660 1:234770588-234770610 CTGGGGGCCTGGCACACAGCAGG - Intergenic
923619690 1:235568336-235568358 CTGAGGGTCTTGCACATGGCTGG - Intronic
1066758675 10:38735765-38735787 CACAGGCTCTAGCACCCAGCAGG - Intergenic
1068939112 10:62663572-62663594 GTGAAGCACTGGCACACAGCAGG + Intronic
1069589684 10:69634134-69634156 CTGAGGCTCTGGGCCACAGAGGG + Intergenic
1069719726 10:70541718-70541740 CTGAGGCCCTGGCAGACGGCCGG + Intronic
1069723566 10:70564010-70564032 CTGAGGCCCTCCCACACGGCAGG - Intronic
1069913683 10:71774557-71774579 CTGAGACCCTAGCACAAAGCTGG + Intronic
1070534262 10:77363363-77363385 CTGAGGCTGCAGCACACAGCAGG + Intronic
1071093823 10:81950335-81950357 AGGATGCTCTGGCACACAGCAGG - Intronic
1072928623 10:99640305-99640327 CAGTGGCTCACTCACACAGCTGG + Intergenic
1073136499 10:101223343-101223365 TTGAGGCTCTCTCACATCGCCGG + Intergenic
1073461619 10:103668843-103668865 CAGAGGCGCTGGGACACAGCCGG + Intronic
1075582079 10:123627023-123627045 CTGAAACTCTCGTACACTGCTGG - Intergenic
1076643267 10:131933490-131933512 CTGAGACTCCCCCACACTGCAGG + Intronic
1076778228 10:132709806-132709828 CTGAGCCTCTGTCACACTGCAGG - Intronic
1077427121 11:2486664-2486686 CTGAGGCTCTCGCCAGAAGCAGG - Intronic
1079100591 11:17539168-17539190 CTTAGGCTCCCACACAAAGCTGG + Intronic
1082987321 11:59180151-59180173 CTGAGGCTTAATCACACAGCTGG + Intronic
1085096004 11:73761065-73761087 CAGAGGCTCGCGCACTCAGCAGG - Exonic
1085392888 11:76191480-76191502 CTCAGGGTCACGCACACAGCAGG - Intronic
1085663301 11:78389884-78389906 CTGAAGTTCTTGCACACAGCAGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1088913472 11:114209538-114209560 CTGAGGCTCTGGGAAGCAGCAGG + Intronic
1090138197 11:124222720-124222742 CTCAAGCTCTCACACATAGCTGG - Intergenic
1092812463 12:12284626-12284648 CTCAGCCTCTGGCACACAGTAGG - Intergenic
1099062228 12:77926122-77926144 CAGAGGCTCTTAAACACAGCAGG + Intronic
1101167643 12:102054322-102054344 GTGAGTCTCTTGTACACAGCAGG - Intronic
1101292343 12:103383955-103383977 CTGTGGCTCTCACACACTTCGGG - Intronic
1103962432 12:124617490-124617512 CTGAGGCTCAGGGTCACAGCAGG + Intergenic
1108573345 13:51771010-51771032 ATCAGGCTCTCACACACTGCTGG - Intronic
1112602430 13:100869535-100869557 CTGTGGATCTGGCACACAGTGGG - Intergenic
1112777926 13:102865792-102865814 AGGAGGCTCTCGGACTCAGCAGG - Exonic
1113403446 13:110017104-110017126 CTGGTACTCTTGCACACAGCCGG - Intergenic
1113723544 13:112579712-112579734 CTGGAGCTCTCCCACACTGCTGG + Intronic
1113862483 13:113497269-113497291 CTGCAGGTCTTGCACACAGCTGG - Intronic
1113862487 13:113497378-113497400 CTGCAGGTCTCACACACAGCTGG - Intronic
1113862490 13:113497430-113497452 CTGCAGGTCTCACACACAGCTGG - Intronic
1114715263 14:24817757-24817779 CTGAGGCTCTGGCCTCCAGCAGG + Intronic
1114769481 14:25412065-25412087 CTGAGGATCTCACAGGCAGCAGG + Intergenic
1114920353 14:27318839-27318861 CTGAAGTTCTCACACACACCTGG - Intergenic
1119109856 14:71961294-71961316 CTGAGGGTCTAGCTCAGAGCTGG + Intronic
1119375735 14:74191120-74191142 CTGTGGCTCTGGCGCAGAGCTGG - Intronic
1121254191 14:92519511-92519533 CTGAGGAGATCGCAGACAGCCGG + Intronic
1121572772 14:94959941-94959963 CAGAGGCCCTGGCACACAGAAGG + Intergenic
1129743168 15:78000064-78000086 CTGAGGCTCTAGCCCAGAGGCGG + Intronic
1130337634 15:82970935-82970957 CACAGGCTCTGGAACACAGCTGG - Intronic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1131395955 15:92086246-92086268 CTGAAGCTCTCCTACACTGCTGG - Intronic
1132344815 15:101101696-101101718 CCGATGGTCTGGCACACAGCTGG + Intergenic
1132622430 16:874229-874251 CTGAGGCTCTGTCCCAGAGCTGG - Intronic
1132622477 16:874377-874399 CTGAGGCGCCTGCCCACAGCGGG - Intronic
1134298063 16:12964241-12964263 CTAGGGCTTTAGCACACAGCAGG + Intronic
1135562847 16:23489759-23489781 CAGAGGCTCACGAAAACAGCGGG + Intronic
1140450687 16:75068631-75068653 CGGAGGCCCTCACACACACCTGG - Intronic
1141154497 16:81587796-81587818 CTGAGGCTCTCACCCTCAGGAGG - Intronic
1141871657 16:86790612-86790634 CTGAGCCCCAGGCACACAGCGGG + Intergenic
1142376185 16:89708210-89708232 CTCAGCCTCTCCCAGACAGCAGG - Intronic
1143256219 17:5559905-5559927 CAGAGGCTCTCTCTCACAGAAGG + Exonic
1143285595 17:5786714-5786736 CTGAGGCTCAGGCACCCACCGGG - Intronic
1143378967 17:6483950-6483972 CAGAGGTTCTATCACACAGCAGG - Intronic
1144694525 17:17293212-17293234 CTGGAACTCTCACACACAGCTGG - Intergenic
1146449665 17:32962624-32962646 CTAAGGCACTCCCACACAGAGGG - Intergenic
1149658546 17:58322961-58322983 CTGTGGCTCTCCCACTGAGCCGG + Exonic
1150328130 17:64273239-64273261 CTGAGGCACTCACACACCCCAGG + Intergenic
1151680114 17:75618728-75618750 CACAGGCTCTAGCACACAGTAGG + Intergenic
1153528459 18:6019991-6020013 CTTAGGGTCTGGCACACAGTAGG - Intronic
1155832698 18:30537986-30538008 CATTGGCTCTTGCACACAGCAGG - Intergenic
1157698535 18:49744554-49744576 ATGCGGCTTTCCCACACAGCAGG + Intergenic
1157811102 18:50696616-50696638 CTGAGGCTCTGGCTTTCAGCCGG - Intronic
1161113820 19:2485564-2485586 CACAGGCCCTCGCACACAGTAGG - Intergenic
1161501881 19:4620731-4620753 ATGAGGGTCTCACACAAAGCTGG - Intergenic
1162017686 19:7854330-7854352 CTGTGACTTTGGCACACAGCAGG - Intronic
1162366893 19:10255196-10255218 CTGAGCCACTTGCACACAGCCGG - Intronic
1163446121 19:17347478-17347500 CTGGGGCCCTGGCACACAGCTGG + Intergenic
1164179425 19:22806675-22806697 CTGAAGCCCTCGCACTCATCAGG + Intergenic
1165385027 19:35505305-35505327 CTGAGGCTCTCGGCCAGTGCTGG + Intronic
1165516587 19:36292510-36292532 CCGAGGCGCACGCACACAGACGG - Intergenic
1166519538 19:43471236-43471258 CTGAAACTCTCCCACACAGCTGG - Intergenic
1168280610 19:55303602-55303624 CTGAGGCAGTTGTACACAGCTGG + Intronic
925139080 2:1537619-1537641 CTGGGGATGTTGCACACAGCGGG - Intronic
925832167 2:7906618-7906640 CAGAGACTCTGTCACACAGCAGG - Intergenic
930732284 2:54739676-54739698 CTGAGGCTCTCACACACTTTGGG - Intronic
930998703 2:57755277-57755299 CTGAGGCCCCCCCATACAGCTGG + Intergenic
931501648 2:62875270-62875292 CTCAGGCCCTCGAGCACAGCAGG + Intronic
931618539 2:64186740-64186762 CTGAGACACTCTAACACAGCAGG - Intergenic
932301884 2:70673272-70673294 CTGAAGAACTCGCACACGGCCGG + Intronic
932599546 2:73113740-73113762 CTTAGGCCCTGGCACACAGTAGG - Intronic
933827069 2:86172080-86172102 CTCAGCCTCTGGCACACAGCTGG + Intronic
935953236 2:108350124-108350146 CTGAGGCTCTCAGAAGCAGCAGG + Intergenic
936069123 2:109353602-109353624 CAGAGGCACTCTCACCCAGCAGG - Intronic
937880747 2:126862805-126862827 CTGAGGCACTCTCACACAGCTGG + Intergenic
938271847 2:129979653-129979675 CAGAGGCTCGCGCACTCAGCAGG + Exonic
938444154 2:131364147-131364169 CAGAGGCTCGCGCACTCAGCAGG - Intergenic
938493079 2:131776100-131776122 CTGTGGCTCTGGGACACACCGGG - Intergenic
941640317 2:167980634-167980656 CAGAGGCTCTCTCACACATGTGG + Intronic
946279933 2:218659435-218659457 CGGAGGCGGTCGCACAAAGCGGG - Exonic
1170900111 20:20454361-20454383 CTGAGGCTCTCGCACACAGCAGG + Intronic
1171399277 20:24861191-24861213 CTGTGGCTCTCACACCCATCTGG - Intergenic
1172780340 20:37433028-37433050 CTGAAGATCTGGCACACAGGAGG - Intergenic
1176290254 21:5040164-5040186 CTGAGGCTTCTTCACACAGCAGG + Intronic
1178781048 21:35603728-35603750 CTCAGGGCCTCGCACACAGCAGG - Intronic
1178938604 21:36885784-36885806 CACAGGATCTTGCACACAGCTGG + Intronic
1179867001 21:44223477-44223499 CTGAGGCTTCTTCACACAGCAGG - Intronic
1180594682 22:16965381-16965403 CTCAGTCCCCCGCACACAGCTGG - Intronic
1181140691 22:20802797-20802819 CAGAGACACTAGCACACAGCAGG + Intronic
1181463695 22:23099568-23099590 CTGAGGCTCAGGCACACAGCTGG + Intronic
1181521253 22:23449943-23449965 CTGAGGGTCGTGCACACAGCAGG + Intergenic
1181765150 22:25086250-25086272 CTTAAGGTCTTGCACACAGCAGG + Intronic
1183417934 22:37693129-37693151 CAGGGGTTCTTGCACACAGCAGG + Exonic
1184226611 22:43132458-43132480 CTCACTCTCTAGCACACAGCAGG + Exonic
1184534755 22:45078582-45078604 CTGGGACTCTCACACACTGCTGG + Intergenic
1184869109 22:47222307-47222329 CTGTGTCTCCGGCACACAGCAGG - Intergenic
1184978661 22:48080945-48080967 CTGGGGCTCCAGCATACAGCAGG - Intergenic
949656145 3:6222440-6222462 CTGAGGCTCTGACACATACCAGG + Intergenic
953851885 3:46470959-46470981 CTGAGGTTTTTGCACACAGTGGG - Intronic
955494814 3:59520256-59520278 CAGAGTATCCCGCACACAGCAGG + Intergenic
955845429 3:63157901-63157923 CAGAGGATCTCACGCACAGCAGG - Intergenic
956065686 3:65395137-65395159 CTCAGTATCTGGCACACAGCAGG - Intronic
961415774 3:126755442-126755464 CTGAGGCTCTGCAGCACAGCAGG + Intronic
962252022 3:133841362-133841384 CTGCAGCTCTGGGACACAGCTGG - Exonic
962826154 3:139102269-139102291 CTGAGGGTCTTTCACCCAGCAGG - Intronic
963860425 3:150304074-150304096 CTAAGGCTCTGGCCAACAGCAGG + Intergenic
966868809 3:184276921-184276943 GTTAGGCTCACGCACGCAGCTGG + Exonic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
971423732 4:26496430-26496452 CTGAGGCTCTCGCGCACCCCTGG + Intergenic
971673646 4:29595769-29595791 CTGAGTTTCAAGCACACAGCTGG - Intergenic
972562794 4:40243546-40243568 CTGGGCCTCTGGGACACAGCCGG + Exonic
974328821 4:60450144-60450166 CTGAGTCTCTGGCACACCACTGG + Intergenic
976207570 4:82637473-82637495 CTCAGGGTCTGGCACATAGCAGG - Intronic
981727793 4:147866041-147866063 CTGGGGCTCTGACACCCAGCAGG - Intronic
985474632 5:72736-72758 CGGAGGCCCTGGGACACAGCAGG + Intergenic
985474693 5:72932-72954 CGGAGGCCCTGGGACACAGCAGG + Intergenic
985474738 5:73079-73101 CGGAGGCCCTGGAACACAGCAGG + Intergenic
985474750 5:73128-73150 CGGAGGCCCTTGAACACAGCAGG + Intergenic
985474766 5:73177-73199 CGGAGGCCCTGGGACACAGCAGG + Intergenic
985474781 5:73226-73248 CAGAGGCCCTGGGACACAGCAGG + Intergenic
985474797 5:73275-73297 CGGAGGCCCTGGGACACAGCAGG + Intergenic
985474812 5:73324-73346 CGGAGGCCCTGGAACACAGCAGG + Intergenic
985474858 5:73471-73493 CAGAGGCCCTGGAACACAGCAGG + Intergenic
985474889 5:73569-73591 CAGAGGCCCTGGAACACAGCAGG + Intergenic
985474950 5:73764-73786 CGGAGGCCCTGGAACACAGCAGG + Intergenic
985474965 5:73813-73835 CGGAGGCCCTGGGACACAGCAGG + Intergenic
985638054 5:1049610-1049632 CTGAGGCTGTGCCACACACCAGG + Intergenic
985673833 5:1220056-1220078 CTGAGGCTCTACCACACTGCTGG - Intronic
986263831 5:6175318-6175340 CAGAGGCTTTCGTACCCAGCTGG + Intergenic
986716434 5:10527375-10527397 TGGAGTCTCTCGGACACAGCAGG - Intergenic
991086682 5:62654099-62654121 CTGAAGCTCAGGTACACAGCTGG - Intergenic
992251110 5:74876687-74876709 CTGAGGCCTCCACACACAGCAGG + Intergenic
995454096 5:112333758-112333780 CAGAGGCCCTGGCAGACAGCCGG - Intronic
995864563 5:116677503-116677525 CTGAGTGTCTCCCACACACCAGG - Intergenic
997740451 5:136248390-136248412 CACAGGGTCTGGCACACAGCAGG + Intronic
998395034 5:141812717-141812739 CAGAGGCTCTCCCACCCACCTGG - Intergenic
1001133111 5:169080541-169080563 CGGAGGCCCTAGAACACAGCTGG - Intronic
1001141428 5:169147213-169147235 CAGAGGGTCTGGCACATAGCAGG + Intronic
1001309874 5:170603048-170603070 CTAAGGCTGGTGCACACAGCAGG + Intronic
1002063453 5:176640244-176640266 CTGAGGCTCCAGCTGACAGCTGG + Intronic
1002679671 5:180950973-180950995 CTCTGGCTCTGGCACAGAGCAGG - Intergenic
1002754092 6:144950-144972 CTCAGGCTCTGGCACAAACCTGG + Intergenic
1006794934 6:36725912-36725934 CTGCAGCTCTGGGACACAGCTGG + Exonic
1007446271 6:41908777-41908799 CAGAGACTCTCTAACACAGCTGG - Intronic
1010001960 6:70956978-70957000 CTGCGGCGCGCGAACACAGCCGG - Exonic
1011995653 6:93584317-93584339 CTGAGGCTCTGAGACACATCAGG - Intergenic
1013978751 6:116105203-116105225 CTGAGGGGCCTGCACACAGCTGG - Intronic
1015417308 6:132963992-132964014 CAGGGGCTCTCTCACAAAGCGGG - Intergenic
1016520907 6:144945434-144945456 CAGAGGCTCTGGCACAAAGTAGG + Intergenic
1016559636 6:145380828-145380850 CTGAGACTCTCACACATTGCTGG + Intergenic
1017027316 6:150192727-150192749 CTTGGGCTCTCTTACACAGCCGG + Intronic
1017121270 6:151026304-151026326 CACAGTCTCTCGCACAGAGCAGG - Intronic
1018128489 6:160705258-160705280 CTGAGGCTCTTCCAGACATCTGG - Intronic
1018385418 6:163299123-163299145 CTGAAGCTCTAGAACACAGCTGG + Intronic
1018389875 6:163334093-163334115 CTGCGTCTCTCACATACAGCAGG - Intergenic
1018432771 6:163735970-163735992 CTGAGCATTTCGCACACATCAGG - Intergenic
1019590084 7:1826535-1826557 CTGAGGGTCGTGCACACAGCAGG - Intronic
1019756174 7:2771890-2771912 CTCAGGCTCTCACACACCCCTGG - Intronic
1019982460 7:4631478-4631500 CTGCGTCTCTAGCACTCAGCAGG + Intergenic
1023867945 7:44247642-44247664 CTGGGGCTTTCTCACACACCAGG - Intronic
1025023364 7:55497031-55497053 CTGAGGCTCCCGCCCACAGGAGG + Intronic
1026442586 7:70457215-70457237 CTGAGGCCCCCTCACACAGCTGG - Intronic
1026457432 7:70584858-70584880 CAGAAGCTCTGGCACACAGGTGG + Intronic
1029358439 7:100070415-100070437 CTGACCCTCTCCCTCACAGCCGG + Exonic
1029471181 7:100755267-100755289 CTGGGGCTCTTGCACGAAGCAGG - Exonic
1031295802 7:120002284-120002306 CTGAGGCACTTGAACACAGGAGG - Intergenic
1032019698 7:128400481-128400503 CTGAGCCCCTCGCACACTGTGGG - Exonic
1032882384 7:136103327-136103349 GGGAGGCCCTGGCACACAGCAGG + Intergenic
1034948559 7:155280733-155280755 CTCAGGGTCTCCCCCACAGCGGG + Intergenic
1035903777 8:3487007-3487029 CTGAACCTCTCACACACAGAAGG + Intronic
1036222284 8:6930828-6930850 CTGAGACACTCGCGCACAGGTGG - Intergenic
1036531331 8:9590614-9590636 CTGAGGTTCTGGCACAGAGTAGG - Intronic
1036800099 8:11784536-11784558 ATGAGGCTCTTGGAAACAGCAGG + Intronic
1038740294 8:30211280-30211302 CTCAGGGTCTGGCACACAGTAGG + Intergenic
1040804372 8:51377788-51377810 CTGAGCCTCCCCCACACCGCGGG + Intronic
1050420010 9:5453468-5453490 CTGGGGCCCTGGCACACAGTAGG + Intronic
1052287751 9:26806087-26806109 CAGAGGCTCTTTCACACACCAGG - Intergenic
1052971583 9:34380282-34380304 CTGAGGCCCGAGCGCACAGCTGG - Intronic
1053411659 9:37919783-37919805 CTCAGGCTCTGTCACAGAGCAGG + Exonic
1058488009 9:105461936-105461958 TTGAGGCTCTGTCACACAGGTGG - Intronic
1058908308 9:109498547-109498569 CTGAGGGCCTGGCACACAGTAGG - Intergenic
1060423165 9:123483852-123483874 CTGAGTCTCTCTTACACATCTGG - Intronic
1061232883 9:129325194-129325216 CTGGGGCTCAGGCCCACAGCTGG - Intergenic
1061386127 9:130290250-130290272 CTGACCCTCTTGCCCACAGCAGG - Intronic
1061531708 9:131219114-131219136 TTGAGCTTCTGGCACACAGCAGG - Intronic
1062282912 9:135759934-135759956 CTGAGGCTGTGGCACAGTGCGGG + Intronic
1187270662 X:17776575-17776597 CTGAGGCTCTTGGACAGAGGAGG - Intergenic
1189659247 X:43279262-43279284 CTGAGCCCCTCGCACACCGTGGG - Intergenic
1190266388 X:48829620-48829642 CTGCAGCCCTCGCACACAGCTGG + Exonic
1193799952 X:85923163-85923185 CTGAAGCACTGTCACACAGCTGG - Intronic
1199106330 X:143873366-143873388 CTGAGGCTGTTGCAGTCAGCTGG - Intergenic
1199923753 X:152439481-152439503 CTGAGACTCTTACACACTGCCGG + Intronic
1199988789 X:152972103-152972125 TTGAGGCTCTACCACATAGCAGG + Exonic