ID: 1170904298

View in Genome Browser
Species Human (GRCh38)
Location 20:20498570-20498592
Sequence AGCCGGGCCCACTGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170904298_1170904302 3 Left 1170904298 20:20498570-20498592 CCTGCTCCTCAGTGGGCCCGGCT 0: 1
1: 0
2: 3
3: 21
4: 247
Right 1170904302 20:20498596-20498618 ACTTTTACTAAGTAACAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170904298 Original CRISPR AGCCGGGCCCACTGAGGAGC AGG (reversed) Intronic
900364324 1:2304706-2304728 AGGCAGGCCCACTGAGGTGGAGG - Intronic
900544721 1:3222237-3222259 AGCCTCCCCCAGTGAGGAGCTGG + Intronic
900711765 1:4119030-4119052 AGCCGGGACCCGTGAGGAGGGGG - Intergenic
902116228 1:14123903-14123925 AGCCTGGGCCACTTGGGAGCTGG - Intergenic
902410679 1:16209977-16209999 AGCCTGGCCCACCCAGGGGCTGG - Intronic
902682019 1:18050308-18050330 TCCCGAGCCCACAGAGGAGCAGG + Intergenic
902986887 1:20160326-20160348 AGCCGGTGCCACTGATGACCAGG + Intergenic
903285031 1:22271435-22271457 AGCAGGGACCACTGTGGTGCTGG - Intergenic
906215075 1:44033892-44033914 AGCCTGGGCCACTGTGGGGCGGG + Intergenic
908464285 1:64376281-64376303 AGCCCAGCCTACTGAGTAGCTGG - Intergenic
915145814 1:153795226-153795248 GGCCTGGCCATCTGAGGAGCAGG - Intergenic
916771145 1:167909923-167909945 AGCCGGCGCCACTGATGACCAGG + Intronic
917565319 1:176206997-176207019 AGCCGGGCGCTCGGAGGAGAGGG + Exonic
917993018 1:180402676-180402698 AGCCGAGCCTCCTGAGTAGCTGG - Intronic
919779575 1:201213325-201213347 GGCCTGGCTCACTCAGGAGCAGG + Exonic
921249439 1:213282446-213282468 AGCAGGCGCCTCTGAGGAGCAGG - Intergenic
922416506 1:225427699-225427721 AGCCGGGCCCGCTGCGGAAATGG - Intronic
923539092 1:234875612-234875634 ACCCGGGGCCTCTGATGAGCTGG - Intergenic
923956298 1:239025528-239025550 GGCCAGACCCACTGAGGAACTGG + Intergenic
1064464167 10:15562802-15562824 AGCCTGGCACAATGAGGAGGAGG + Intronic
1064932238 10:20640707-20640729 ATCCAGGCCCACTGAGAAGAGGG + Intergenic
1066351398 10:34640500-34640522 AGACAGGCCCCCTGAGTAGCTGG - Intronic
1066389695 10:34968966-34968988 AGCCGGTGCCACTGATGACCTGG + Intergenic
1070827102 10:79397694-79397716 AGCCAGGCCCACTCTGGATCTGG + Intronic
1070917111 10:80161934-80161956 AGCCGGGCCCACCTGGTAGCAGG - Exonic
1071344704 10:84681961-84681983 AGCCAGGGCCACTGTGGAACAGG + Intergenic
1075009643 10:118856669-118856691 AAGCTGGCCCAGTGAGGAGCAGG - Intergenic
1075537798 10:123285673-123285695 GGCAGGGCCCAATGAGGACCAGG - Intergenic
1076456727 10:130605071-130605093 AGCAGGGTGCAGTGAGGAGCTGG + Intergenic
1076627656 10:131831851-131831873 AGCCGGTCCCACAGAGAGGCAGG + Intergenic
1083302020 11:61744508-61744530 AGCCGGGCCCAGGCAGGAGCAGG + Exonic
1084546551 11:69817829-69817851 CGCCGAGCCCTTTGAGGAGCAGG - Intronic
1084982267 11:72836188-72836210 AGCCAGCCACACTGAGGACCAGG - Intronic
1089680642 11:120117175-120117197 AGCCTGGCCCACAGAGCACCTGG - Intronic
1090935020 11:131333603-131333625 AGCTGTGCCCACGGGGGAGCTGG - Intergenic
1092651602 12:10641124-10641146 AGCTGGGGAAACTGAGGAGCTGG - Intronic
1093958880 12:25251186-25251208 AGCCGGGCCGGCTGGAGAGCGGG + Intergenic
1096255575 12:50059983-50060005 AGCCTGGCCCACAGAGGAGGAGG + Intronic
1102569220 12:113817448-113817470 AGCCGGGCCCACTCTGCAGAGGG - Exonic
1103561673 12:121796138-121796160 CGCTGGGCCCACTGAGGAACTGG + Intronic
1104401594 12:128480956-128480978 AGCTGGACCCTGTGAGGAGCTGG - Intronic
1107548546 13:41455654-41455676 AGCCGGTGGCAATGAGGAGCCGG + Intergenic
1109126828 13:58528480-58528502 AGAGCGGACCACTGAGGAGCCGG - Intergenic
1113709655 13:112455032-112455054 AGCCAGGCCCACTGAGGCAGGGG + Intergenic
1113781361 13:112979425-112979447 GGCCGGGCACTCTGAGGAGGTGG + Intronic
1113800150 13:113082332-113082354 GGCCTGGCCCACAGATGAGCCGG + Intronic
1114613496 14:24056582-24056604 AAACGGGCCCAGTGAGGGGCAGG - Intronic
1118206519 14:63728131-63728153 ACCCGGGCTCCCTGAGGGGCCGG + Intergenic
1118285369 14:64465717-64465739 ATCCGAGCCCTCTGAGGTGCTGG + Intronic
1118347681 14:64951675-64951697 AGCCAGTCCCTCAGAGGAGCAGG + Intronic
1118841988 14:69520288-69520310 GGCAGAGCCCACTGAGGAGAGGG + Intronic
1119702014 14:76761910-76761932 AGCCGGTCCCGCTGAGCCGCGGG + Intergenic
1120914186 14:89696078-89696100 AGTCTGGCCCACTGAGCAACTGG + Intergenic
1121005355 14:90487238-90487260 GGCTGGGCTCACTGAGCAGCTGG - Intergenic
1121963277 14:98280992-98281014 ACCTCTGCCCACTGAGGAGCTGG - Intergenic
1122060631 14:99134517-99134539 TGTCTGTCCCACTGAGGAGCCGG - Intergenic
1124441491 15:29689162-29689184 CGCCGGGCTCACTCAGGAGCAGG - Intergenic
1124584356 15:30991616-30991638 AGCCGGGCGGACTGACGGGCGGG + Intergenic
1125520958 15:40347625-40347647 AGCCCAGGCCACTGAGGAGAGGG + Intergenic
1126910229 15:53409716-53409738 AGCAGGGCCCACAGAGAAGCAGG + Intergenic
1128227601 15:66013055-66013077 AGCAAGGCCCACAGAGGAGTGGG + Intronic
1129453428 15:75663360-75663382 AGCCAGCGCCACTGAGGAGCAGG + Intergenic
1129522214 15:76193014-76193036 AGCCGGGCAGGCTGAGCAGCTGG + Intronic
1129718571 15:77865590-77865612 ACCCGGGTCCACTCTGGAGCAGG - Intergenic
1130460357 15:84155276-84155298 ACCCGGGTCCACTCTGGAGCAGG + Intergenic
1130896481 15:88174139-88174161 AGCTGGGGCCACTGAGGGGCAGG - Intronic
1132572393 16:649697-649719 AGCCGGGGCCACTGCGGGGCTGG - Intronic
1132840576 16:1976736-1976758 AGCCTGGCCCTGTGGGGAGCTGG + Intronic
1133300216 16:4777895-4777917 AGCCGGGCCCGCGGGGCAGCAGG + Exonic
1134242566 16:12516778-12516800 GGAGGGGCCCACTGGGGAGCGGG + Intronic
1134593598 16:15476902-15476924 AGCAGGGCCAACTGGGGATCTGG - Intronic
1136271726 16:29152581-29152603 TGCTGGGCCCACAGAGGGGCAGG + Intergenic
1136683937 16:31983321-31983343 AGCCAGGCCCCCAGAGGAGGAGG - Intergenic
1136784564 16:32926873-32926895 AGCCAGGCCCCCAGAGGAGGAGG - Intergenic
1136885219 16:33926933-33926955 AGCCAGGCCCCCAGAGGAGGAGG + Intergenic
1138191175 16:55015648-55015670 AGCCAGGCCTTCTGAGGTGCAGG - Intergenic
1139668005 16:68471753-68471775 ACCAGGGACCACTCAGGAGCTGG - Intergenic
1139949089 16:70660572-70660594 AGCCTGGCAGACTGGGGAGCTGG + Exonic
1141610187 16:85176879-85176901 AGCCAGGCCCCCTGAGGAGCAGG - Intronic
1141673716 16:85506509-85506531 AGCAGGGCCCGCTGACGATCAGG + Intergenic
1141686294 16:85571799-85571821 GGCCAGGCCCAGGGAGGAGCTGG + Intergenic
1141851539 16:86649630-86649652 GGCCAGACCAACTGAGGAGCAGG - Intergenic
1142075393 16:88114741-88114763 TGCTGGGCCCACAGAGGGGCAGG + Intronic
1142253213 16:89002252-89002274 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253251 16:89002360-89002382 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253255 16:89002377-89002399 AGCCGGGAGTACAGAGGAGCCGG + Intergenic
1142253262 16:89002394-89002416 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253266 16:89002411-89002433 AGCCGGGAGTACAGAGGAGCCGG + Intergenic
1142253273 16:89002428-89002450 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253308 16:89002519-89002541 AGCCGGGGGGACGGAGGAGCCGG + Intergenic
1142253313 16:89002536-89002558 AGCCGGGAGGACAGAGGAGCCGG + Intergenic
1142253337 16:89002604-89002626 AGCCGGGAGGACAGAGGAGCCGG + Intergenic
1142253342 16:89002621-89002643 AGCCGGGCGGACAGAGGAGCCGG + Intergenic
1142253347 16:89002638-89002660 AGCCGGGAGGACAGAGGAGCCGG + Intergenic
1142253354 16:89002655-89002677 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253381 16:89002729-89002751 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253409 16:89002803-89002825 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253430 16:89002871-89002893 AGCCGGGAGGACAGAGGAGCCGG + Intergenic
1142253437 16:89002888-89002910 AGCCGGGGGGACAGAGGAGCTGG + Intergenic
1142253464 16:89002962-89002984 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253492 16:89003036-89003058 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253525 16:89003127-89003149 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253534 16:89003150-89003172 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1142253560 16:89003218-89003240 AGCCGGGGGGACAGAGGAGCCGG + Intergenic
1203087223 16_KI270728v1_random:1190879-1190901 AGCCAGGCCCCCAGAGGAGGAGG - Intergenic
1142631745 17:1229937-1229959 AGCGGGGCCGACAGGGGAGCGGG - Intergenic
1142686103 17:1577778-1577800 AGCTGGGCGCACTGAGGCTCTGG + Intronic
1142811241 17:2396603-2396625 GGCAAGGCCCACTCAGGAGCTGG + Intronic
1144110003 17:12021467-12021489 AGCGGGGCCCACTGCGGCGGCGG - Intronic
1144848577 17:18232767-18232789 AGCCGGGCCGGCTGGGCAGCTGG - Exonic
1145277236 17:21439351-21439373 AGCTGTGCCCACTGAAGGGCGGG + Intergenic
1145315072 17:21725245-21725267 AGCTGTGCCCACTGAAGGGCGGG + Intergenic
1145713508 17:26997183-26997205 AGCTGTGCCCACTGAAGGGCAGG + Intergenic
1145940348 17:28740381-28740403 AGGAGGGCCCACTGAGGGGAGGG - Intronic
1145994186 17:29096194-29096216 AGCAGGGCGCCCTGGGGAGCGGG - Intronic
1146454293 17:32997113-32997135 GGCTGGGCCCACGGAGGAGAGGG + Intronic
1147438727 17:40433775-40433797 AGCAGGGCCCACTGGGCAGGAGG + Intergenic
1147914208 17:43877062-43877084 AGCCTGGCCCTGTGGGGAGCAGG + Intronic
1150003184 17:61454708-61454730 AGCCCTGCCCTGTGAGGAGCTGG - Intronic
1151380110 17:73719886-73719908 AGCCAGGCCCTCCCAGGAGCAGG - Intergenic
1151460025 17:74248939-74248961 AGCGGGGCCCTGGGAGGAGCCGG - Intronic
1152243756 17:79174784-79174806 GGCCCGGCACAGTGAGGAGCAGG + Intronic
1152687187 17:81700498-81700520 AGCAGGGGCCACTGGGGCGCAGG + Exonic
1153100325 18:1461080-1461102 AGCCATGCCCAGTGACGAGCAGG - Intergenic
1158496094 18:57956375-57956397 AGCCTGCCCAACTGGGGAGCTGG + Intergenic
1159531236 18:69658064-69658086 ACCCCAGCCTACTGAGGAGCTGG + Intronic
1160241309 18:77124993-77125015 AGCCGGGACCTCAGAGGAGTGGG - Intronic
1160919391 19:1512813-1512835 GGCAGGGCCCATTGAGGAGGGGG - Intronic
1160996078 19:1882441-1882463 AGCCAGGCCTGCTGAGGGGCAGG + Intronic
1161085687 19:2333944-2333966 AGCCTGTCCCACTCAGGACCCGG + Intronic
1161370372 19:3907955-3907977 AGCCCGGCCCACTGGGCAACAGG + Intronic
1161583194 19:5091769-5091791 AGGAGGGCCCACGGAGGTGCGGG + Intronic
1162905061 19:13818309-13818331 TGGCGGGGCCAATGAGGAGCAGG - Intronic
1162926683 19:13933745-13933767 TGCCGAGCCCAGTGAGCAGCAGG + Intronic
1163116555 19:15192222-15192244 ATCGGGCCCCACTGAGCAGCGGG + Exonic
1163701824 19:18790049-18790071 AGCCGGGCGCGCAGTGGAGCAGG + Exonic
1163772312 19:19198539-19198561 AGATGGGCCCAGTGATGAGCAGG + Intronic
1165784470 19:38453057-38453079 GGGCGGGACCACTGAGGGGCGGG + Intronic
1165899195 19:39160914-39160936 AGCCGGGACCACTGGGGAACAGG + Intronic
1166269766 19:41706889-41706911 AGCCGGGCCCACAGCCCAGCAGG + Intronic
1167023964 19:46900887-46900909 AGCAGGTCCCACTGAGCAGGAGG - Intergenic
1168332648 19:55579144-55579166 AGCAGGGGCCACGGAGGAGGAGG - Exonic
925029208 2:636499-636521 CACCGGCCCCTCTGAGGAGCAGG + Intergenic
925131239 2:1495697-1495719 ACCCGGGACCACTCAGGTGCAGG - Intronic
925131257 2:1495769-1495791 ACCCGGGACCACTCAGGTGCAGG - Intronic
925727095 2:6883617-6883639 AGCCAGGCCTGCTGAGGAACTGG + Intronic
926541094 2:14182539-14182561 AGCCAGGCCCAAGGTGGAGCTGG + Intergenic
927111653 2:19868345-19868367 AATCGGGACCACTGAGGAGGAGG + Intergenic
929556588 2:42929350-42929372 AGCAGGGTCCACTGCAGAGCTGG - Intergenic
930651846 2:53971144-53971166 AGCCGGGCCCACGGCGAAGAAGG - Intronic
931947390 2:67325160-67325182 ATCCTGGCACACTGAGCAGCAGG - Intergenic
932556056 2:72825765-72825787 TGCCGGGACCACAGAGGGGCGGG - Intronic
934591146 2:95551168-95551190 AGCCGGTGCCACTGATAAGCCGG + Intergenic
934616431 2:95774221-95774243 AGACTGGCCCACTGAAGAGGAGG + Intergenic
934644462 2:96050339-96050361 AGACTGGCCCACTGAAGAGGAGG - Intergenic
934837878 2:97606429-97606451 AGACTGGCCCACTGAAGAGGAGG - Intergenic
935594180 2:104867025-104867047 AGCAGGGCGCACAGAGGAGGGGG - Intergenic
937932825 2:127219544-127219566 AGCCGGGACCCCTGGGGAGGAGG - Intronic
942301510 2:174567417-174567439 AGCCAGTCCCTCTTAGGAGCTGG + Intronic
942955325 2:181766382-181766404 AGCCAGGCCCACTCTGGAGAAGG + Intergenic
944221599 2:197309977-197309999 GGCCGGTCCCTCTGAGGAGGAGG - Intronic
948047579 2:234955452-234955474 CTCAGGGCCCACCGAGGAGCTGG - Intronic
948725072 2:239929583-239929605 AGCAGGGCCGGCGGAGGAGCAGG - Intronic
948725139 2:239929855-239929877 AGCAGGGCTGGCTGAGGAGCAGG - Intronic
948725231 2:239930212-239930234 AGCAGGGCTGGCTGAGGAGCAGG - Intronic
1168938031 20:1685029-1685051 AGCAGGGGCCAGTGGGGAGCAGG + Intergenic
1170904298 20:20498570-20498592 AGCCGGGCCCACTGAGGAGCAGG - Intronic
1174080840 20:47969646-47969668 AGGCGGGGCCACTGTGGAGAGGG + Intergenic
1175156013 20:56972181-56972203 AGACAGGCCCACTGTGGAGTAGG + Intergenic
1175311027 20:58011653-58011675 GGCCGGGGCCCCTGAGGAGGTGG + Intergenic
1175742581 20:61430362-61430384 CGCCTGGCACACTGATGAGCCGG - Intronic
1176130861 20:63496241-63496263 AGCCGCGCCCATTTCGGAGCAGG - Intronic
1176147675 20:63572690-63572712 AGCGGGGCCCAGGGAGGGGCAGG - Intronic
1178025505 21:28461706-28461728 AGGCTGGGGCACTGAGGAGCAGG - Intergenic
1178467203 21:32859229-32859251 AGAGGGGCCCAGTGAGGACCTGG - Intergenic
1179967944 21:44817794-44817816 GGGCGGGCCCACTTAGGGGCGGG + Intronic
1180068234 21:45423498-45423520 AGCCGGGCCCTCCGGGGGGCGGG - Intronic
1180099486 21:45577894-45577916 ACCCGGGCCCCCTGAGCAGGTGG - Intergenic
1180172624 21:46067700-46067722 GGCCAGGCCCACTGAGGTGGAGG + Intergenic
1181064502 22:20299202-20299224 AGCCGGTCCTCCCGAGGAGCGGG + Intergenic
1183188953 22:36309204-36309226 AGCTCGGCCCACTGTGGAGGTGG + Intronic
1183425203 22:37735384-37735406 AGACGGGCCCCCTGGGGAGCAGG + Exonic
1184152847 22:42648688-42648710 AGCCTGGCCCACTGAGCATTGGG + Intronic
1185277860 22:49957530-49957552 CGCCGTGTCCACTGCGGAGCAGG + Intergenic
1185326691 22:50229078-50229100 TGCCGGGCCCACTGGGGAGCAGG + Intronic
950443398 3:13022684-13022706 AGCCCGGCCCACCGACCAGCTGG + Intronic
950759224 3:15206116-15206138 GGCCGGGCCCACGCAGGAGCCGG - Intergenic
952264795 3:31775050-31775072 AGCCACCCCCACTGAGTAGCTGG - Intronic
952956815 3:38562700-38562722 AGCCTGGCCCAGTGCAGAGCTGG - Intronic
953043834 3:39278143-39278165 AGTGGGGCCAGCTGAGGAGCAGG + Intronic
953453214 3:43021126-43021148 AGCCCAGCCCACTGAGAAGCTGG - Intronic
953883339 3:46702528-46702550 AGCCAGGGCCAGGGAGGAGCAGG + Intronic
954317620 3:49809869-49809891 TGCCGGGCCCACTGTGGAGGAGG + Exonic
954326746 3:49868224-49868246 AGCTGGGCCAACTGAGAAGAGGG - Intronic
954619913 3:51989613-51989635 AGCAGGGGCCACAGAGGGGCAGG + Intergenic
954661125 3:52227467-52227489 AGCAGTGCCCACTCAGTAGCTGG + Intergenic
955590156 3:60526387-60526409 TGCTGGGCCAACTGAGGTGCTGG - Intronic
959683080 3:109118022-109118044 AGCTGGGCCCGCTGAAGCGCAGG + Exonic
959699363 3:109283929-109283951 AGCTGAGCCTACTGGGGAGCTGG - Intergenic
961444254 3:126971829-126971851 ACGCAGGCCCACTGAGGAGGGGG - Intergenic
963720835 3:148860244-148860266 AGCCGTGCACAGTGAGGATCCGG + Intergenic
966912997 3:184569602-184569624 AGCCGGGCCCTCAGGGGACCAGG + Intronic
967787354 3:193512040-193512062 AGCCGTGCTCTCTGAGGTGCTGG - Intronic
968622213 4:1608935-1608957 GGCGGGGCCCAAGGAGGAGCAGG + Intergenic
968811934 4:2804071-2804093 AGCCGAGCCCACTGAATAGGTGG + Intronic
968884358 4:3319557-3319579 AGCTGGGACTACTGAGTAGCTGG + Intronic
969606932 4:8206470-8206492 CGCGGGGCCCAGGGAGGAGCTGG + Intronic
972157454 4:36181969-36181991 AGCAGGTCCAGCTGAGGAGCAGG + Intronic
976786120 4:88823407-88823429 AGGCAAGCCCACTGAGGAGCAGG - Intronic
983831043 4:172329065-172329087 AGCCCTGCCCAGTGAGGACCAGG + Intronic
984255186 4:177382046-177382068 AGAGGGGCCCAGTGAGGACCTGG - Intergenic
984653926 4:182297553-182297575 AGCCTGGGACACTGAGGATCAGG - Intronic
984835597 4:184017159-184017181 AGCCCGGCCCATGGTGGAGCTGG + Exonic
984884987 4:184442091-184442113 ACCCGGGCCAGCTCAGGAGCTGG - Intronic
985758407 5:1732723-1732745 GGCGGGGCCCACTGTGGAGCTGG + Intergenic
985875881 5:2593727-2593749 AGCGGGGCTGAGTGAGGAGCTGG - Intergenic
986397800 5:7347500-7347522 AGCCCGTCCCACTGAGCAGCTGG + Intergenic
988430334 5:31111615-31111637 AGCAGTGCCCACCGAGGAACAGG + Intergenic
990159545 5:52922525-52922547 AGCAGGGCCCTCTGAGGAACTGG + Intronic
993461510 5:88188857-88188879 AGCCGGTGCCACTGATGACCCGG - Intergenic
994245550 5:97471761-97471783 AGAGGGGCCCAGTGAGGACCTGG - Intergenic
997579564 5:135008742-135008764 TCCCAGGCCCACTGAGGAGAAGG - Intronic
1001579946 5:172791612-172791634 AGCAAGGCCCAGTGAGGGGCAGG + Intergenic
1002315328 5:178339688-178339710 AGTGAGGCCCACTGAGGCGCTGG - Intronic
1002419645 5:179138918-179138940 AGCCGGGCCCAGTTACCAGCTGG - Intronic
1005080069 6:21947904-21947926 AGCCGGGCCCAGTAAGTAGTGGG - Intergenic
1006747157 6:36351202-36351224 AGCCAGCCCCACTGAGATGCCGG + Intergenic
1013612188 6:111805888-111805910 AGCTGGGACCACTTAGGAGCTGG + Intronic
1023121624 7:36915178-36915200 TGCCCAGCCCCCTGAGGAGCTGG + Intronic
1026878464 7:73893498-73893520 AGCCGGTCCCACTGCTGGGCCGG + Intergenic
1030593811 7:111511814-111511836 AGCAGGGCCCAGCAAGGAGCTGG + Intronic
1032848265 7:135770358-135770380 TGCCAGGACCACTGAGGTGCAGG + Intergenic
1033129741 7:138735569-138735591 AGGGGCACCCACTGAGGAGCCGG + Intronic
1034266990 7:149785850-149785872 AGCCAAGCCCAGTAAGGAGCTGG - Intergenic
1035394997 7:158528952-158528974 GGGCTGGCCCCCTGAGGAGCTGG - Intronic
1036239199 8:7068324-7068346 AGCCGGTGGCACTGATGAGCCGG + Intergenic
1036493485 8:9249269-9249291 AGCCGGTGCCACTGATGACCCGG + Intergenic
1036817609 8:11913613-11913635 AGCCGGTGGCACTGATGAGCCGG - Intergenic
1036820560 8:11936229-11936251 AGCCGGTGGCACTGATGAGCCGG - Intergenic
1036938946 8:13032744-13032766 AGTCAGGCCAACTGAGGAGTGGG - Intergenic
1037214851 8:16437112-16437134 AACCTGGCCCACTGAGGTGAAGG - Intronic
1039316464 8:36378187-36378209 AGCTGGTTCCACTGAGAAGCGGG + Intergenic
1039819123 8:41120746-41120768 AGCCAGGACCACAGTGGAGCAGG + Intergenic
1041121237 8:54588497-54588519 AGCTGGGCCCAGGAAGGAGCTGG + Intergenic
1048214204 8:132480692-132480714 AGGCGGGCCCCCTGGGGGGCAGG + Exonic
1049317571 8:141977432-141977454 GGCCAGGCTCACTGAGGACCTGG + Intergenic
1049345177 8:142134898-142134920 AGGCCGGGCCTCTGAGGAGCTGG + Intergenic
1049788578 8:144462777-144462799 GGCCGGGCCCACTGAGGCGGCGG - Intronic
1049807281 8:144546765-144546787 GGCCTGGGCCCCTGAGGAGCAGG - Intronic
1053003594 9:34590724-34590746 AGCCTGGGCCTCTGAGGGGCCGG + Intergenic
1056369753 9:85941652-85941674 CGCCGGGAGCAATGAGGAGCCGG - Intronic
1056693288 9:88826008-88826030 AGCCCAGCCTACTGAGTAGCTGG + Intergenic
1057271899 9:93656214-93656236 AGCCAGGTCCCTTGAGGAGCCGG - Intronic
1057481405 9:95447936-95447958 GGCCGGGGCTACCGAGGAGCTGG - Intronic
1060423139 9:123483663-123483685 AGCCTGTCCCACTGCAGAGCCGG - Intronic
1060547141 9:124468309-124468331 AGCAGGGCCCGGGGAGGAGCAGG + Intronic
1061492918 9:130956197-130956219 GGCCGCCCCCACTGAGGAGGGGG + Intergenic
1061573455 9:131491795-131491817 AGCAGGGCCTCCTGGGGAGCTGG - Intronic
1061959657 9:133981549-133981571 AGCAGGGCCCACTGAGCCTCAGG - Intronic
1062586656 9:137252682-137252704 AGGCGGGCCGGCTGAGCAGCTGG - Exonic
1062594839 9:137294999-137295021 AGCCGGGCCCTCTGGGCCGCAGG - Intergenic
1187157692 X:16736442-16736464 TGCTGGCCCCACTGGGGAGCTGG + Intronic
1189274891 X:39778461-39778483 ACCCAGTCCCACTGAGGACCTGG - Intergenic
1190280233 X:48924375-48924397 AGCAGGGGCCAGTGAGGAGGAGG - Intronic
1190369363 X:49726722-49726744 AGCGGGGCCCACTGAGGACCTGG + Intergenic
1191797368 X:65035120-65035142 AGCCGGGGCCAGAGAGGAGCTGG - Intergenic
1192088974 X:68132789-68132811 GGCGAGCCCCACTGAGGAGCCGG + Intronic
1192315067 X:70044720-70044742 AGCAGGGCCCAGAGAGGAGAGGG - Intronic
1192407668 X:70902651-70902673 AGCTGGGACCACAGAGTAGCTGG + Intronic
1202378893 Y:24259897-24259919 ACCCGGGTCCACTCTGGAGCAGG - Intergenic
1202491889 Y:25410224-25410246 ACCCGGGTCCACTCTGGAGCAGG + Intergenic
1202605088 Y:26632585-26632607 AGCAGGGCCCACACAGGACCCGG + Intergenic