ID: 1170907046

View in Genome Browser
Species Human (GRCh38)
Location 20:20525760-20525782
Sequence TAACTGGTAGGAAAGAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170907046_1170907053 -2 Left 1170907046 20:20525760-20525782 CCGCCCCTCTTTCCTACCAGTTA 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1170907053 20:20525781-20525803 TACCCCCACAAAGGTTATCGTGG 0: 1
1: 0
2: 0
3: 4
4: 35
1170907046_1170907058 19 Left 1170907046 20:20525760-20525782 CCGCCCCTCTTTCCTACCAGTTA 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1170907058 20:20525802-20525824 GGTAGCAATCTCATTACAGCCGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170907046 Original CRISPR TAACTGGTAGGAAAGAGGGG CGG (reversed) Intronic
900969738 1:5984807-5984829 AAACTCCTAGGAAAGAGGGAAGG + Intronic
901123138 1:6911130-6911152 AAATTGGAGGGAAAGAGGGGAGG + Intronic
901457117 1:9369410-9369432 GGGCTGGTAGGAAAGAAGGGTGG - Exonic
902437365 1:16407147-16407169 TGAATGGTAGGGAAGAGGTGGGG + Intronic
908366214 1:63426252-63426274 GAACTGGTAGGAAAGTAGTGAGG + Intronic
909338091 1:74499623-74499645 TCCCTGGTAGATAAGAGGGGAGG + Intronic
910977367 1:92920923-92920945 TAAGAGGAAGGAAAGAGGTGTGG + Intronic
911182488 1:94873628-94873650 TAACTGCAAGGAAAGGGGCGGGG - Intronic
911737284 1:101351830-101351852 TGCCTGTTAGGAAAGAAGGGAGG - Intergenic
912100713 1:106201323-106201345 TCACTGGGAGGACAGTGGGGAGG - Intergenic
912501855 1:110127915-110127937 TAAATGGTAGGAAATGAGGGAGG - Intergenic
912679443 1:111719927-111719949 GAAGAGGTAGGAAAGGGGGGGGG - Intronic
912988598 1:114460025-114460047 TAGCTCTTAGGAAAGAGGGGAGG - Intronic
914745357 1:150497473-150497495 TAACTGGAAGGAAAGCAGGTAGG - Intronic
916554993 1:165886783-165886805 TACCTGGTAGGGAAGAAGGCAGG - Intronic
918320366 1:183358499-183358521 AAAGTGGGAGGAAAGAGGGAAGG + Intronic
919781545 1:201224508-201224530 ACACAGGTGGGAAAGAGGGGTGG - Intronic
919866748 1:201788448-201788470 TCACTGGAAGGACAGAGGGAAGG - Exonic
920090051 1:203446211-203446233 CAACTGGTATGAAAGAGGACAGG + Intergenic
920274008 1:204790428-204790450 TTACGGGTAGGAAGGAGGGAGGG - Intergenic
921266465 1:213424811-213424833 TAACAGGTAGGGAAGAAGGATGG - Intergenic
921526693 1:216227056-216227078 TCACTGGTGGGAAAAAGGGAGGG - Intronic
922152122 1:223015704-223015726 TAACTGATAGGAGAGAGGCAGGG + Intergenic
923805346 1:237251548-237251570 TATGAGGTTGGAAAGAGGGGAGG - Intronic
924501002 1:244637927-244637949 TAACAGGACGGAAAGAGGAGAGG - Intronic
924716331 1:246577939-246577961 TATCTGGTAGGAAACAGAAGAGG - Intronic
1062813576 10:483215-483237 TAAATGTTAGGAAAAAAGGGTGG + Intronic
1063116127 10:3073294-3073316 TATGTGTTAGGGAAGAGGGGAGG - Intronic
1065177660 10:23095349-23095371 AGAGTGGGAGGAAAGAGGGGCGG + Intergenic
1067207799 10:44234305-44234327 TAACAGGAAGAAGAGAGGGGCGG - Intergenic
1070609364 10:77922959-77922981 GAACTGGAAGGAAACTGGGGAGG - Intronic
1072627008 10:97119162-97119184 TTACAGGAAGGTAAGAGGGGTGG - Intronic
1073182029 10:101589367-101589389 AAAATGGTAGGAAAGAGTGAAGG + Intronic
1074735222 10:116424430-116424452 TACCTGGTAGGGAATAGGGAGGG + Intergenic
1074867014 10:117550655-117550677 GAAATGGGGGGAAAGAGGGGAGG - Intergenic
1075275511 10:121089451-121089473 TAGGGGGTAGGAGAGAGGGGAGG - Intergenic
1078256366 11:9662608-9662630 GAACTGGTGGGGAAGAGGAGAGG - Intergenic
1078479489 11:11663618-11663640 ACATTGGCAGGAAAGAGGGGTGG + Intergenic
1079222030 11:18571537-18571559 TTGCTGATAGGAAAGAGGGAAGG - Intronic
1079900640 11:26179427-26179449 AAACTAGAAGGAAAGACGGGGGG - Intergenic
1080987304 11:37484157-37484179 TCACTCTTAAGAAAGAGGGGAGG - Intergenic
1081234260 11:40626974-40626996 TAACTGGTAGCAAAGCTAGGAGG - Intronic
1083549410 11:63575180-63575202 ACATTGGTAGGGAAGAGGGGAGG + Intronic
1085088100 11:73686080-73686102 AAACTGGTGGGAAAGATGTGGGG + Intronic
1086424965 11:86673900-86673922 TACCTGGTAGGAAATAAGGATGG + Intergenic
1086920933 11:92585914-92585936 TGACTGGAAGGAAGGAAGGGAGG - Intronic
1088390364 11:109307487-109307509 CAAGTGTTAGGAAAGAGGTGGGG + Intergenic
1089806891 11:121098445-121098467 ACACTGGTAGGGATGAGGGGAGG - Intergenic
1089961380 11:122619756-122619778 TTACTGGTAGGAAAGTGAAGTGG + Intergenic
1090193925 11:124799626-124799648 CAATTGGCAAGAAAGAGGGGCGG + Intronic
1091308396 11:134555625-134555647 GAACTGGGAGGTAAAAGGGGTGG - Intergenic
1092210035 12:6640000-6640022 TAACTGGAAGGAATGGGGTGAGG + Intronic
1092759405 12:11795922-11795944 TAAATGTTAGCCAAGAGGGGAGG + Intronic
1092771760 12:11903388-11903410 TAGCAGGCAGGAAAGAGGGAAGG - Intergenic
1092818171 12:12329137-12329159 TCACTGATGGGAAAAAGGGGGGG + Exonic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1094267185 12:28572632-28572654 TAACAGTTAGGAAACAGGTGTGG - Intronic
1097231570 12:57515053-57515075 TGACAGGTAGGTAAGCGGGGAGG + Exonic
1097479307 12:60101281-60101303 TTACTGGTAGAAAAGGTGGGAGG - Intergenic
1097614900 12:61872161-61872183 AACCTGGAAGGAAAAAGGGGGGG + Intronic
1100617559 12:96242771-96242793 GAACTGGGAGGGAAGAGGGCAGG - Intronic
1101229301 12:102723399-102723421 AAACTAGTAGGAAAGAAGGTTGG + Intergenic
1101693846 12:107106193-107106215 TAACTGATAGGAAGGAGGTGAGG - Intergenic
1101774440 12:107780757-107780779 TAACTGGGAGGGCAGAGGGTTGG + Intergenic
1103230187 12:119323571-119323593 CAACTGGAAGGAAAGAAGGAAGG + Intergenic
1104268943 12:127264731-127264753 TGACTGGTGGGAAGGAGGGGTGG - Intergenic
1105572942 13:21621167-21621189 CAAGTGGTAGGAAAGAGTGGAGG - Intergenic
1107038071 13:35921218-35921240 AAAGTGGTAGGAAACAGGGTTGG - Intronic
1112777923 13:102865762-102865784 GAACTGGTAGGAACTAGGGAGGG + Exonic
1113554029 13:111216709-111216731 TCAGTGGTAGGGAAGAGGGGTGG + Intronic
1118680270 14:68234144-68234166 TGACTGGTTGGATACAGGGGTGG + Intronic
1118838767 14:69495560-69495582 TAACTGCTTGGAATGAGGTGTGG + Intronic
1119045858 14:71318317-71318339 TAACTATAAGGAAAGAGGGAGGG - Intergenic
1121821381 14:96970679-96970701 CAACAGGTGGGAAAGAGGGAAGG - Intergenic
1122199277 14:100112561-100112583 TAACTGGGATGAAGGAGGAGAGG - Intronic
1125350955 15:38767159-38767181 GACCAGGTAAGAAAGAGGGGCGG - Intergenic
1127380770 15:58428954-58428976 CTACTGGCAGGGAAGAGGGGAGG - Intronic
1128402430 15:67297152-67297174 TAACAGGGAGATAAGAGGGGAGG + Intronic
1128477521 15:68009944-68009966 TAACTGGGAGGAATCAGGGCAGG + Intergenic
1128862352 15:71084388-71084410 GAAGTGGTAGAAAGGAGGGGTGG + Intergenic
1131259677 15:90881973-90881995 CAGCTGGGAGGCAAGAGGGGTGG + Exonic
1131448445 15:92518969-92518991 TAACTGGTGGGGATGAGGGAAGG + Intergenic
1131637740 15:94255625-94255647 TATTTGGTAGGAGAGAGTGGAGG + Intronic
1132867470 16:2100564-2100586 TACCTGGGAGGCAAGAGGGAGGG + Exonic
1132890984 16:2204743-2204765 TAACCGGCAGGAAGGAGAGGAGG + Intronic
1134038643 16:11051117-11051139 TCACTGGAAGGACAGAGAGGAGG + Intronic
1134603039 16:15548581-15548603 TAACTGGCTGGAAGCAGGGGAGG - Intronic
1135922477 16:26663569-26663591 GAACTGGAAGGAAGGAGGGAAGG + Intergenic
1137554743 16:49463440-49463462 TAACTGGCAGGAGGGAGGGATGG + Intergenic
1137605412 16:49783559-49783581 AAATGGGTGGGAAAGAGGGGGGG + Intronic
1138819354 16:60240244-60240266 TAATTGGAAGGAAGGAAGGGAGG - Intergenic
1139052393 16:63141959-63141981 TAAGTCTTAGGTAAGAGGGGAGG - Intergenic
1139145386 16:64318225-64318247 TAAATGGTAGGAACTAGGAGAGG + Intergenic
1139312976 16:66042763-66042785 TAACAGGAAAGAAAGAGGGCAGG + Intergenic
1139535987 16:67574175-67574197 TGACTGGTAGGAAGGACAGGTGG - Intronic
1140048764 16:71461405-71461427 TAAGTGGTAGGAAAGAAAAGGGG + Intronic
1144623235 17:16831562-16831584 TAACTGGCAGGACAGAGGTCAGG + Intergenic
1144883196 17:18441154-18441176 TAACTGGCAGGACAGAGGTCAGG - Intergenic
1145149034 17:20503232-20503254 TAACTGGCAGGACAGAGGTCAGG + Intergenic
1147367668 17:39970072-39970094 GAATGGGGAGGAAAGAGGGGGGG + Intronic
1147367686 17:39970124-39970146 GAATGGGGAGGAAAGAGGGGGGG + Intronic
1147976130 17:44249163-44249185 GAAGTGGTAGAAAAGAGAGGAGG - Exonic
1148013307 17:44503232-44503254 AAACTGGAAGGAAAGAGGGCTGG + Intronic
1149008085 17:51826615-51826637 AAACAGGTGGGAAAGAGTGGAGG - Intronic
1149253401 17:54796114-54796136 AAAATGGAAGGAAAGAGGGTAGG + Intergenic
1149539804 17:57460429-57460451 TCTTTGGAAGGAAAGAGGGGAGG + Intronic
1150767647 17:68014866-68014888 TCACTGGAAAGATAGAGGGGAGG - Intergenic
1151542862 17:74773683-74773705 TACCTGCTGGGACAGAGGGGTGG + Exonic
1156891699 18:42197863-42197885 AAACTGGTAGGAGAGTAGGGAGG - Intergenic
1157056044 18:44230045-44230067 TCACTGTGAGAAAAGAGGGGAGG + Intergenic
1157173103 18:45426133-45426155 TGACTGCTAGATAAGAGGGGTGG - Intronic
1157545816 18:48545684-48545706 TTGCTGGTAGGATAGTGGGGTGG + Intronic
1158570335 18:58592453-58592475 TGGCTGGGTGGAAAGAGGGGAGG + Intronic
1160901868 19:1432791-1432813 TACCTGGTGGGAAAGGGGAGAGG + Intronic
1161091233 19:2361028-2361050 TCACGGGTAGAAAAGAAGGGAGG - Intergenic
1161238470 19:3209216-3209238 CAACCTGGAGGAAAGAGGGGTGG - Exonic
1163492630 19:17625728-17625750 TAAATGGTTGGACAGATGGGGGG - Intronic
1164531234 19:29049847-29049869 TCACTGCTCGGAAAGAGGAGAGG - Intergenic
1164603462 19:29579102-29579124 TCATTGGAAGGAAGGAGGGGTGG - Intergenic
1165715872 19:38045615-38045637 TAACAGGCAGGAAGGAGGTGGGG + Intronic
1165809192 19:38600457-38600479 GAACTGGGGAGAAAGAGGGGAGG - Intronic
1166352005 19:42203680-42203702 TCAATGCAAGGAAAGAGGGGAGG + Intronic
925500918 2:4503763-4503785 TAACTGGTAGGAAATACAGAAGG + Intergenic
926364692 2:12122307-12122329 AGACTGGTAGGACAGAAGGGTGG - Intergenic
927596385 2:24401662-24401684 GAAAAGGTAGGAGAGAGGGGAGG - Intergenic
928142342 2:28740666-28740688 GAAGTGGTAGGAAATAGGGTGGG - Intergenic
930774429 2:55158582-55158604 TAACTGGAGTGACAGAGGGGTGG - Intergenic
931702030 2:64917154-64917176 TGACTGGAAGGACAGAGTGGTGG + Intergenic
933932499 2:87167927-87167949 TCACTGATATGAAAGAGGTGAGG + Intergenic
934540747 2:95172409-95172431 TAACAGGAAGGAAAGAAGGGTGG - Intronic
936027632 2:109045733-109045755 TACCTTGGCGGAAAGAGGGGAGG + Intergenic
936360613 2:111797514-111797536 TCACTGATATGAAAGAGGTGAGG - Intronic
936938012 2:117856948-117856970 AGAGTGGTAGGATAGAGGGGTGG + Intergenic
937502407 2:122493989-122494011 TTACTGACAGGGAAGAGGGGAGG - Intergenic
941721769 2:168820143-168820165 TCAGAGGTAGGAAAGAGGTGTGG + Intronic
942745919 2:179232922-179232944 GAAGTGGTAGAAAAGATGGGAGG + Intronic
943228673 2:185215408-185215430 GAAGCAGTAGGAAAGAGGGGAGG - Intergenic
943721123 2:191204548-191204570 TTCTTTGTAGGAAAGAGGGGAGG - Intergenic
944386076 2:199166180-199166202 TCACTGCTGGGAGAGAGGGGTGG - Intergenic
944853767 2:203746585-203746607 GAACTGGAAGGAAGGAAGGGAGG - Intergenic
944902142 2:204226394-204226416 TAAGTGGGAGGATAGAGGAGAGG - Intergenic
947303824 2:228721005-228721027 TAAGTAGTAGAAAAGAGGGCTGG + Intergenic
947686486 2:232090234-232090256 TTACTTGTAAGAAAGAGGGAGGG - Intronic
948525270 2:238567367-238567389 GAGCTGGTAGGGAAGAAGGGCGG + Intergenic
948737254 2:240017071-240017093 TATCTGGGAGGAAATTGGGGTGG - Intronic
1170907046 20:20525760-20525782 TAACTGGTAGGAAAGAGGGGCGG - Intronic
1171464438 20:25317800-25317822 CAACTGGAAAGAAAGAGGGAAGG - Intronic
1173395989 20:42680201-42680223 TAATTGCTATGAAACAGGGGTGG + Intronic
1174408520 20:50318781-50318803 TGGCTGGTAGGTTAGAGGGGAGG - Intergenic
1174912405 20:54621353-54621375 CAACTGGTAAGAGAGAGGGAGGG + Intronic
1179772606 21:43634041-43634063 GACCAGGTAGGAAAGATGGGAGG + Intronic
1179819149 21:43926368-43926390 TAACACGTAGGACAGCGGGGTGG + Intronic
1181106241 22:20577410-20577432 GAACTGGTGGGAAGGAGGGAGGG - Intronic
1181747847 22:24968185-24968207 TAAAAGGTAGGGAAGGGGGGCGG + Intronic
1182401527 22:30081157-30081179 CAGCTGGTAGAAATGAGGGGTGG + Intronic
1182645546 22:31806174-31806196 AAACTGGCAGGAAAGAAGGTAGG + Exonic
1183698859 22:39438329-39438351 TACCTGGAAGGAAGGAAGGGAGG - Intergenic
1184158418 22:42683982-42684004 TGACTGTGTGGAAAGAGGGGTGG + Intergenic
1184640145 22:45866406-45866428 GACATGGAAGGAAAGAGGGGAGG - Intergenic
1184754640 22:46508968-46508990 CCACTGGTTGGAAAGAGGTGAGG - Intronic
949868975 3:8570829-8570851 TAACAGGAAGGAAGGAGGGTTGG - Intergenic
950586106 3:13893707-13893729 TAACAGGAAGGAAAGAAGAGAGG - Intergenic
950904260 3:16523458-16523480 GGAATGGCAGGAAAGAGGGGCGG - Intergenic
951891940 3:27575754-27575776 TGACTGGTGGGAAGGAGAGGGGG - Intergenic
953232853 3:41079929-41079951 GCACTTGTAGGTAAGAGGGGAGG + Intergenic
953390676 3:42532004-42532026 GAACTGGTAGGACAGGGGTGGGG - Intronic
953572446 3:44081956-44081978 TAACTGCCAGAGAAGAGGGGAGG + Intergenic
955754055 3:62210053-62210075 TAGGTGGTGGGAAAGTGGGGAGG - Intronic
960903187 3:122572455-122572477 TAAATGGGAGGAAAAAGGGTTGG + Exonic
961223485 3:125218589-125218611 CCACTGGAAGGAAAGAGGTGAGG - Intergenic
961944469 3:130671641-130671663 TACCTGCTAGGAAAGAGGTCTGG + Intronic
964120089 3:153174212-153174234 TATTTGTTAGGAAAGATGGGAGG - Intergenic
964499523 3:157333344-157333366 TACCTGGTAGGAAAAAGTTGAGG - Intronic
966800452 3:183758765-183758787 TAAATAGTGCGAAAGAGGGGAGG + Intronic
967121034 3:186383192-186383214 TAACAGCTAGGCTAGAGGGGAGG + Intergenic
969230235 4:5825477-5825499 TATCAGGTAGGAAAGAGTGGTGG - Exonic
976117589 4:81744346-81744368 TAAAAGGAAGGAAAGAGAGGGGG - Intronic
978383949 4:108161418-108161440 TAAAGTGTAGGAAAGAGGTGTGG - Intronic
980798079 4:137711321-137711343 TAACTGGGAGGCCAGAGGGTAGG - Intergenic
982102636 4:151983155-151983177 AAAGTAATAGGAAAGAGGGGTGG + Intergenic
983550239 4:169010101-169010123 AAACTCGGAGGAAAGAGGGTAGG + Exonic
984676966 4:182560554-182560576 TAACTGGTAGGAAAGAAAAAGGG - Intronic
987195403 5:15520731-15520753 TAACTGGTAGGAAAAAACTGAGG - Intronic
987808328 5:22800031-22800053 TAAATGCTAGGAAAGAGGTCTGG + Intronic
988573089 5:32391552-32391574 GAACTGGGAGGGCAGAGGGGAGG - Intronic
990088735 5:52013652-52013674 CAATTTGTAGGAGAGAGGGGAGG - Intronic
990411913 5:55549631-55549653 TAGCTGGAAGGAAAGAGGGAGGG + Intergenic
991083783 5:62629389-62629411 TGACTAGTAGGAGAGAGAGGAGG - Intergenic
992668386 5:79034117-79034139 TGACTGGTAGGAAACACGGTGGG + Intronic
993179967 5:84540122-84540144 TAACAGGAAGGAAAGAAAGGAGG + Intergenic
998108878 5:139486177-139486199 TAGCAGGTAGGGCAGAGGGGAGG - Intergenic
999242631 5:150136608-150136630 TAACGGGCAGGAGTGAGGGGTGG + Intronic
1001102794 5:168828065-168828087 TAACTGCTCGGAAAGAAGAGGGG + Intronic
1001686637 5:173598549-173598571 TAAGTGGAAAGAGAGAGGGGGGG - Intergenic
1002957061 6:1876509-1876531 TGGCTGGTAGAAAAGAGAGGAGG + Intronic
1003124391 6:3344396-3344418 AAAGGGGAAGGAAAGAGGGGAGG - Intronic
1005808604 6:29499136-29499158 TAGCTAGTAGAGAAGAGGGGTGG - Intergenic
1006655867 6:35592421-35592443 GAGCTGGTAGGAATGAGGAGCGG + Intronic
1006969037 6:38021341-38021363 GAAGAGGTAGGAAAGAAGGGAGG + Intronic
1010298669 6:74232124-74232146 TAAAAGGAAGGAAAGAGGGAGGG - Intergenic
1010707065 6:79127673-79127695 TAACTGGGAAGGAAGAGGTGAGG - Intergenic
1011497204 6:87948857-87948879 GAAGTGGTAGGAATGAGGTGAGG - Intergenic
1014331086 6:120064372-120064394 GAACTTGGAGAAAAGAGGGGTGG - Intergenic
1015320802 6:131871740-131871762 TAACTGGATGGAAAGATGGTTGG + Intronic
1015536408 6:134271569-134271591 TTTCTTGGAGGAAAGAGGGGAGG - Intronic
1019986480 7:4660016-4660038 TACCTGGTAGGGATGAGTGGAGG - Intergenic
1020595695 7:10204816-10204838 TAACTGGTAGAAAAGGGGCTGGG + Intergenic
1020987754 7:15157293-15157315 CAACTAGTAAGAAAGAGGGTAGG + Intergenic
1021135229 7:16957403-16957425 TAGCTGGTTGGCAAGAGGGCAGG - Intergenic
1021973338 7:25986158-25986180 TTAGCGGTAGGAGAGAGGGGTGG - Intergenic
1034105001 7:148482748-148482770 TAACGGGGAGGAGAGAGGAGTGG - Intergenic
1034122965 7:148644113-148644135 TAACTGGGAGGAAAAAAAGGAGG - Intergenic
1035066248 7:156107225-156107247 GAAAAGGTAGGAAAGAAGGGAGG + Intergenic
1035347602 7:158214618-158214640 TACCTGGTAGGCCTGAGGGGAGG - Intronic
1036192212 8:6680679-6680701 TAACTGGGGGGAAAGAAGGAAGG - Intergenic
1036192235 8:6680750-6680772 TAACTGGGGGGAAAGAAGGAGGG - Intergenic
1036192261 8:6680825-6680847 TAACTGGGGGGAAAGAAGGAAGG - Intergenic
1038482782 8:27913218-27913240 TAACTGGGAAGAAGGTGGGGTGG + Intronic
1039712219 8:40067370-40067392 TAACTGGAAGGAAAGGGATGGGG - Intergenic
1040688647 8:49909044-49909066 TTACTGGCAGGACAGAGGGAGGG + Intergenic
1040960875 8:53031727-53031749 CAAGGGGTAGGAAGGAGGGGTGG + Intergenic
1042997180 8:74713938-74713960 TATCTGGGAGAAAAGATGGGGGG + Intronic
1048167594 8:132077143-132077165 TAAGTGGAAGGAAAGAGGTGAGG + Intronic
1048391860 8:133974509-133974531 TCACTGTGAGGGAAGAGGGGAGG - Intergenic
1057187252 9:93063701-93063723 TAACTGGTAGGAGGGAGGGTAGG - Intronic
1058432788 9:104933633-104933655 TAGCTTGAAGGAAAGAGGGTTGG - Intergenic
1059160409 9:112029312-112029334 CAACTGGCTGGAAAGAGTGGTGG + Intergenic
1059511965 9:114856799-114856821 TAACTTGGAGGAAAGTAGGGTGG + Intergenic
1061702484 9:132426483-132426505 TAACTGGCGGGAAACAGGGAGGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1188576851 X:31662018-31662040 TACATGGTAGAAAAGAGAGGAGG + Intronic
1189219871 X:39362313-39362335 TCCCTGGTAGGAAAGAGGAGAGG + Intergenic
1190642303 X:52492494-52492516 TAAAAGGTAGGAAAGAAGGAAGG - Intergenic
1190645370 X:52520373-52520395 TAAAAGGTAGGAAAGAAGGAAGG + Intronic
1190862500 X:54358037-54358059 GGACGGGTAGGAGAGAGGGGCGG + Intronic
1191182407 X:57577683-57577705 TAAGTGGTAGTAGAGAGAGGAGG + Intergenic
1191215181 X:57925988-57926010 TAAGTGGTAGTAGAGAGAGGAGG - Intergenic
1193336573 X:80296788-80296810 CATCTGGTAGGAAAGAGGGATGG + Intergenic
1195263192 X:103154048-103154070 TAAGTGGAAGGAAAGAAGTGAGG - Intergenic
1195941439 X:110171219-110171241 TAAGTGGCAGGACAGAGGGCAGG + Intronic
1196715760 X:118809588-118809610 TACCTGTTAGGAACGAGGGAGGG - Intergenic
1197991452 X:132322566-132322588 TAATTGCTAGGAGAGACGGGAGG + Intergenic
1200088775 X:153624752-153624774 TAACTGCAAGGAAGGAGGGAAGG + Intergenic