ID: 1170907700

View in Genome Browser
Species Human (GRCh38)
Location 20:20530628-20530650
Sequence CGGCACTTACAGCTGACGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 39}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170907700_1170907708 16 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907708 20:20530667-20530689 ATGTGGCAGGGGGCACAGAAGGG 0: 1
1: 0
2: 3
3: 35
4: 363
1170907700_1170907705 5 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907705 20:20530656-20530678 ATTATAGCTGCATGTGGCAGGGG 0: 1
1: 0
2: 2
3: 15
4: 254
1170907700_1170907702 -1 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907702 20:20530650-20530672 GTTGCTATTATAGCTGCATGTGG 0: 1
1: 0
2: 2
3: 5
4: 113
1170907700_1170907703 3 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907703 20:20530654-20530676 CTATTATAGCTGCATGTGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 97
1170907700_1170907704 4 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907704 20:20530655-20530677 TATTATAGCTGCATGTGGCAGGG 0: 1
1: 0
2: 1
3: 9
4: 119
1170907700_1170907707 15 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907707 20:20530666-20530688 CATGTGGCAGGGGGCACAGAAGG 0: 1
1: 2
2: 2
3: 38
4: 403
1170907700_1170907706 6 Left 1170907700 20:20530628-20530650 CCAGGCGTCAGCTGTAAGTGCCG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1170907706 20:20530657-20530679 TTATAGCTGCATGTGGCAGGGGG 0: 1
1: 0
2: 1
3: 35
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170907700 Original CRISPR CGGCACTTACAGCTGACGCC TGG (reversed) Intronic
907880485 1:58545703-58545725 TGGCACTCACAGCTGAAGCCTGG + Intronic
907884038 1:58576990-58577012 CGGCACTGGCAGCGGCCGCCGGG + Exonic
908783868 1:67716001-67716023 CAGCACTTGCAGCTGACCGCAGG - Intronic
1069486584 10:68827630-68827652 CGGCCCGTGCAGCTGGCGCCGGG + Exonic
1069486671 10:68827966-68827988 CGGCCCGTGCAGCTGGCGCCGGG + Intronic
1081636637 11:44726589-44726611 GGGAACTTTCAGCTGACCCCGGG - Intronic
1096103166 12:48981421-48981443 CTGCACGTACAGCGGACGCCTGG + Exonic
1106081033 13:26500595-26500617 TGGCAGTCACAGCTGATGCCTGG + Intergenic
1143099800 17:4498842-4498864 CGGCTCTGACAGCTGCGGCCCGG - Exonic
1143348767 17:6271260-6271282 CAGCACCTACAGCTGGGGCCAGG - Intergenic
1150837253 17:68575844-68575866 TGGCAGTTACAGCTGCCACCGGG + Intronic
1152127639 17:78456844-78456866 GGGCACTCACAGCTGACAACTGG + Intronic
1153017428 18:596785-596807 CGGGACCTGCAGGTGACGCCGGG - Intergenic
1157643927 18:49247208-49247230 CTGCACTTACAGGTGTCACCTGG + Intronic
1160822496 19:1065049-1065071 CTGCGCTTCCAGCTGCCGCCGGG + Exonic
1162524478 19:11199435-11199457 CAGCACAGACAGCTGAGGCCCGG + Exonic
1168658902 19:58150742-58150764 CGGCACTTACGGTTGGCGGCCGG + Exonic
1169019298 20:2317112-2317134 CGGCACTTACACCGGTGGCCGGG + Exonic
1169543525 20:6627713-6627735 CAGTACTTACAGCTGATGCTGGG + Intergenic
1170907700 20:20530628-20530650 CGGCACTTACAGCTGACGCCTGG - Intronic
1174390920 20:50217830-50217852 GGGCACTTGCAGCTGAGGCAAGG - Intergenic
1178860192 21:36282574-36282596 CAGCACCTTCAGCTGAGGCCAGG + Intronic
1180054523 21:45351055-45351077 CGGGACTTACAGAAGACCCCAGG + Intergenic
1183392367 22:37552710-37552732 CGGCTCTGACAGCTGTCTCCTGG + Intergenic
1185259653 22:49854185-49854207 CGGCCCTGACAGCTGGCGCGGGG + Intronic
963054934 3:141178589-141178611 AGGCACTAACAGCTGGAGCCTGG - Intergenic
969135889 4:5028497-5028519 AGGCTCTTACAGCTGCTGCCTGG - Intergenic
971094506 4:23385406-23385428 GGGCACTTTCATCTGACGCTAGG + Intergenic
979557667 4:122068062-122068084 TGGAACTTACAGCTGACACAAGG - Intergenic
979737354 4:124104206-124104228 CGGCACTTACAGCTAAGAGCTGG + Intergenic
982278199 4:153658471-153658493 CGGCACCGACAGCTGGGGCCTGG + Intergenic
1001102966 5:168829327-168829349 TGGCACTTACTGCAGATGCCTGG - Intronic
1019357974 7:590883-590905 CGGCACTTTCTGCTGCCGACGGG - Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1035797674 8:2374300-2374322 CAGGACTTCCAGCTGACTCCAGG - Intergenic
1051498264 9:17749103-17749125 AGACTCTTACAGCTGAGGCCTGG + Intronic
1060799224 9:126533053-126533075 GGGCACCTACAGATGAGGCCTGG + Intergenic
1061825527 9:133256212-133256234 CAGCACTGACAGCTGCCGACCGG + Exonic
1188903448 X:35762617-35762639 GGGCACTTAGACCTCACGCCTGG + Intergenic
1190305575 X:49079812-49079834 CGGCACCGACAGCTGGGGCCCGG - Exonic
1197548768 X:127861922-127861944 CTCCACTTAGAGCTGCCGCCTGG + Intergenic
1199407443 X:147479096-147479118 CCGCACTGACAGCTGACAGCTGG - Intergenic