ID: 1170909269

View in Genome Browser
Species Human (GRCh38)
Location 20:20548010-20548032
Sequence GTGGCAGACCACATATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 4, 2: 19, 3: 80, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170909269 Original CRISPR GTGGCAGACCACATATATGA TGG (reversed) Intronic
902990192 1:20182218-20182240 ATGACAGACCACACATACGATGG + Intergenic
905153510 1:35952576-35952598 ATTACAGACCACATGTATGATGG + Intronic
905153679 1:35954882-35954904 ATTACAGACCACATATATGATGG - Intronic
906030492 1:42716272-42716294 ATGACAGACTGCATATATGATGG - Intergenic
907042997 1:51280159-51280181 ATCACAGACCATATATATGACGG - Intergenic
907478227 1:54722388-54722410 GTGGCAAACCAGATAGATCAAGG - Intronic
907946683 1:59142154-59142176 GTGGCTGACTGCATATATGATGG - Intergenic
908925835 1:69253798-69253820 ATGGAAGACCCTATATATGATGG + Intergenic
909818362 1:80026320-80026342 ATGGTAGACCACAAAAATGAGGG - Intergenic
911206372 1:95095327-95095349 GTGGCAGAGCTGACATATGAAGG - Intergenic
911211256 1:95140389-95140411 ATGACAGACCACATATACAATGG - Intronic
911809633 1:102259236-102259258 GTCAATGACCACATATATGATGG + Intergenic
912942085 1:114053980-114054002 GTGGCAGAGCACAAATATAAGGG - Intergenic
913097217 1:115530019-115530041 GTGACAGACTGTATATATGATGG - Intergenic
916150777 1:161787149-161787171 TTGGCAGATAACATCTATGAAGG - Intronic
916991113 1:170246661-170246683 AAGACAGACCACATAGATGATGG + Intergenic
918278442 1:182978466-182978488 ATGATAGACCACATACATGACGG - Intergenic
919322463 1:196060320-196060342 ATGACAGACCACATATTAGATGG + Intergenic
921906427 1:220500254-220500276 GTGGCAGACCAACTCTAAGAGGG + Intergenic
923139505 1:231149076-231149098 ATGACAGACCACATATACAATGG + Intergenic
923248276 1:232155037-232155059 AAGACAGACCACATATGTGATGG - Intergenic
923620213 1:235572834-235572856 GCGACAGACTGCATATATGACGG - Intronic
923992442 1:239454138-239454160 GTGGCAGATCCCACAGATGAAGG + Intronic
1068741576 10:60479213-60479235 ATGATAAACCACATATATGATGG + Intronic
1069018611 10:63460974-63460996 GTGCCAGAACATATAGATGATGG + Intronic
1069104174 10:64362633-64362655 ATGACAGACCACATATACAATGG - Intergenic
1069497504 10:68918844-68918866 GTGATGGACCATATATATGATGG + Intronic
1070084647 10:73224938-73224960 ATGTTGGACCACATATATGATGG + Intronic
1070171069 10:73933005-73933027 GTGGCAGGCAACAGAGATGAAGG - Intergenic
1071364779 10:84888097-84888119 TTGTTTGACCACATATATGAGGG + Intergenic
1074473824 10:113751515-113751537 GTGGCAAGCCACAAGTATGAAGG + Intronic
1074652383 10:115538841-115538863 ATGACAGACCACATATATGATGG + Intronic
1078744439 11:14097867-14097889 GTGGGAGACCACAGAAATCATGG - Intronic
1078746567 11:14121086-14121108 GTGGGAGACCACTTATATCTTGG + Intronic
1079966487 11:26986572-26986594 ATGCCACACCACATATATGATGG - Intergenic
1080282427 11:30573143-30573165 ATGACAGACCACATATATGAAGG + Intronic
1080480632 11:32645862-32645884 GTGACAGACCACGTGTAAGATGG - Intronic
1080510735 11:32967551-32967573 ATGACAGACCACATATACAATGG - Intronic
1080650513 11:34219206-34219228 GTGACAGACAGCATATACGATGG + Intronic
1080724718 11:34885335-34885357 ATGTCAGACCACAGATATGATGG + Intronic
1080789476 11:35509022-35509044 ATGACAGACTGCATATATGATGG - Intronic
1080976277 11:37344595-37344617 ATGACAAACCACATATATGATGG - Intergenic
1081378158 11:42384243-42384265 GTGGCAGACAAGATCCATGATGG + Intergenic
1081471580 11:43377329-43377351 ATGGCAGACTGCATATGTGATGG - Intronic
1081822766 11:46016185-46016207 ACAACAGACCACATATATGATGG - Intronic
1086293867 11:85342820-85342842 ATGCCAGAGCACTTATATGATGG - Intronic
1086953037 11:92910002-92910024 CTTGCAGACCACATATCTCATGG - Intergenic
1086993748 11:93333370-93333392 ATGGCAGAGCACACTTATGATGG - Intronic
1087101223 11:94367150-94367172 GTGGCAGACTACAGATTTTAAGG + Intergenic
1088944630 11:114496755-114496777 ACAACAGACCACATATATGATGG + Intergenic
1090712349 11:129399081-129399103 ATGACAGACTACCTATATGATGG + Intronic
1091069238 11:132547760-132547782 GTGGCAGACAACATTCTTGATGG - Intronic
1091328325 11:134709621-134709643 ATGACCGACCACATATATGACGG + Intergenic
1091372807 11:135074962-135074984 ATGTCATACCACATATATGATGG - Intergenic
1093345503 12:18035333-18035355 GTGCCTGACCAAATAGATGAGGG - Intergenic
1093680881 12:22001534-22001556 ATGACGGACCACATATAAGATGG - Intergenic
1094397447 12:30023775-30023797 GTGACAGACCACATGTATGATGG + Intergenic
1095116234 12:38355611-38355633 CTGGTAGAGAACATATATGAGGG - Intergenic
1096972312 12:55677552-55677574 ATGACAGAGCACATATATGATGG - Intergenic
1097574810 12:61378663-61378685 GAAGAAGACCACTTATATGAGGG - Intergenic
1097649443 12:62278592-62278614 ATGACAAACTACATATATGATGG - Intronic
1097671727 12:62547677-62547699 ACAACAGACCACATATATGATGG + Intronic
1098663317 12:73127483-73127505 ATGATGGACCACATATATGACGG + Intergenic
1099575598 12:84376753-84376775 GTAACAGACCACATATAGAATGG + Intergenic
1100340585 12:93675911-93675933 ATGACAGACTGCATATATGATGG - Intergenic
1101050496 12:100858381-100858403 ATGACGGACCACATATATGATGG - Intronic
1101177590 12:102171427-102171449 GCAACAGACCACATATATGATGG - Intronic
1101744100 12:107524998-107525020 ATGACAGACTACATATATGATGG + Intronic
1101747823 12:107557395-107557417 GTAACAGACCTCATATATGATGG - Intronic
1101924255 12:108958021-108958043 ACAACAGACCACATATATGATGG + Intronic
1101938521 12:109080701-109080723 ATGACAAACCACATATATGATGG + Intronic
1102032290 12:109747735-109747757 GTGGAAGGTCACTTATATGAAGG + Intronic
1103041585 12:117700171-117700193 GTGACAGACTGCATATACGATGG - Intronic
1104191765 12:126488507-126488529 ATGACAAACCACATATATAATGG - Intergenic
1105471521 13:20699546-20699568 AAAACAGACCACATATATGATGG + Intergenic
1106049509 13:26177169-26177191 GTGAGAGAACACATCTATGATGG + Intronic
1106084896 13:26532621-26532643 ATGACAGACCACATATAACATGG + Intergenic
1111854394 13:93619082-93619104 TTGACAGATCATATATATGATGG - Intronic
1114286209 14:21246147-21246169 ATGACAGACCACATATATTATGG - Intronic
1114757087 14:25271528-25271550 GTGACAGAGAACATATTTGAAGG + Intergenic
1114857279 14:26464200-26464222 ATGACAGGCCACATATATGGTGG + Intronic
1114919084 14:27304068-27304090 GTTGAAGACCAGATATGTGAGGG + Intergenic
1117167034 14:53045817-53045839 GTGCCAAACAACATATATGAAGG - Exonic
1117775322 14:59178133-59178155 ATGATAGACCACCTATATGATGG - Intergenic
1117863303 14:60116436-60116458 ATGACAGACCACATATACAACGG + Intronic
1118163056 14:63310152-63310174 ATGGCAGACGGCACATATGATGG + Intergenic
1118518704 14:66556162-66556184 ATGATGGACCACATATATGATGG - Intronic
1119108258 14:71945026-71945048 GTGATGGACCACATACATGAAGG - Intronic
1119847943 14:77844648-77844670 GGAGCTGACCACATAGATGATGG + Intronic
1120106733 14:80504371-80504393 CTTGAAGACCACATATAGGAAGG + Intronic
1124796820 15:32789492-32789514 AAGACAGACCTCATATATGATGG + Intronic
1125455110 15:39850312-39850334 GCGATGGACCACATATATGATGG - Intronic
1127191421 15:56534842-56534864 ATGCCAGACTGCATATATGATGG + Intergenic
1128238551 15:66084156-66084178 GTGACTGACCGCATATACGATGG - Intronic
1128808286 15:70550900-70550922 ATGACAGACCACATATATGGTGG - Intergenic
1130242118 15:82203690-82203712 GTTGCAGACCACTTATATAAAGG - Intronic
1131179104 15:90228164-90228186 GTGGCAGACCAAACAGATGAGGG + Exonic
1135379185 16:21979841-21979863 ATGATGGACCACATATATGATGG - Intronic
1136712319 16:32249405-32249427 TTGACAGACTATATATATGAGGG - Intergenic
1136755596 16:32680024-32680046 TTGACAGACTATATATATGAGGG + Intergenic
1136812517 16:33190346-33190368 TTGACAGACTATATATATGAGGG - Intergenic
1136818993 16:33300426-33300448 TTGACAGACTATATATATGAGGG - Intronic
1136825556 16:33356961-33356983 TTGACAGACTATATATATGAGGG - Intergenic
1136830622 16:33455732-33455754 TTGACAGACTATATATATGAGGG - Intergenic
1137029631 16:35509517-35509539 TTGACAGACCATATATATGAGGG - Intergenic
1138526544 16:57611114-57611136 ATGACAGACCACATAGATGACGG + Intronic
1139016647 16:62697375-62697397 ATGACAGACCACATATGTAATGG - Intergenic
1139173647 16:64662241-64662263 GTGGGAAAACACATATATAACGG + Intergenic
1140397972 16:74645677-74645699 ATGACAGACCACATGTATGATGG - Intronic
1140861178 16:79019505-79019527 ATGACAGACTGCATATATGATGG - Intronic
1141325497 16:83053932-83053954 ATGACGGACCACATATGTGATGG + Intronic
1202991094 16_KI270728v1_random:13316-13338 TTGACAGACTATATATATGAGGG - Intergenic
1203057738 16_KI270728v1_random:940363-940385 TTGACAGACTATATATATGAGGG + Intergenic
1142797001 17:2316048-2316070 ATGACAGACCACCTATATGATGG + Intronic
1143339354 17:6197578-6197600 ATGGCGGACCAAGTATATGATGG + Intergenic
1144060488 17:11579751-11579773 GTGGCAGACGAGATATACCAAGG - Intergenic
1148174588 17:45552584-45552606 ACAGTAGACCACATATATGATGG - Intergenic
1148274681 17:46292869-46292891 ACAGTAGACCACATATATGATGG + Intronic
1148296782 17:46510443-46510465 ACAGTAGACCACATATATGATGG + Intergenic
1148361336 17:47014930-47014952 ACAGTAGACCACATATATGATGG + Intronic
1149052014 17:52316619-52316641 ATGTCAGACCACATATACGACGG + Intergenic
1150405806 17:64899495-64899517 ACAGTAGACCACATATATGATGG - Intronic
1150673166 17:67220119-67220141 CTGGCAGAGAACATATATGTAGG - Intronic
1150832761 17:68539141-68539163 ATGACAGACTGCATATATGACGG - Intronic
1151166756 17:72210293-72210315 AGGACAGACCACATAAATGATGG + Intergenic
1153084031 18:1262608-1262630 GTGACAGACCACATATACAATGG - Intergenic
1153714293 18:7830523-7830545 GTGACAGACCATATATATGATGG - Intronic
1153874287 18:9352951-9352973 ATGGCAGACAACATATATGATGG + Intronic
1155230748 18:23772442-23772464 GTGGCAAACAACAGATTTGAGGG + Intronic
1155445285 18:25905177-25905199 ATGACAGACCGCATATATGATGG - Intergenic
1156528882 18:37795942-37795964 ATGATAGACCACATATATGATGG + Intergenic
1158111622 18:53946377-53946399 ATGGTGGACCACATGTATGACGG - Intergenic
1159085635 18:63787843-63787865 ATGATGGACCACATATATGAGGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161718217 19:5889400-5889422 CTGACGGACCACATATGTGAAGG - Intronic
1163081577 19:14947436-14947458 AAGACAGACCACATATATTATGG + Intergenic
1165262469 19:34632348-34632370 CTGGCAAATCACATATCTGAAGG + Intronic
1166973338 19:46586713-46586735 GTGATGGACCACATACATGATGG - Intronic
1168635520 19:57993432-57993454 GAGGCAGAACAGATAGATGAAGG + Intronic
925314133 2:2908269-2908291 CTGGTTGACCACAGATATGAAGG + Intergenic
926278900 2:11428903-11428925 ATGGCAGACCACATACACAATGG + Intergenic
927383797 2:22509352-22509374 ATGACGGACTACATATATGATGG + Intergenic
928355288 2:30607428-30607450 GTGGCAAACCACATATATGATGG + Intronic
931505080 2:62917367-62917389 ATGACAGATTACATATATGATGG - Intronic
932309817 2:70730712-70730734 ATGACAGACCACATATGTGATGG + Intronic
932639632 2:73430576-73430598 GTGACAGACTGCATATATGATGG + Intronic
933300353 2:80533660-80533682 TATGCAGCCCACATATATGAAGG + Intronic
934544330 2:95202154-95202176 ATGGCCGACCACATATGTGATGG + Intergenic
935080455 2:99787946-99787968 ATGACAGACTGCATATATGAGGG + Intronic
935505669 2:103899161-103899183 TTGGCAGGCAACATACATGAAGG + Intergenic
936001668 2:108837450-108837472 ATGGTAGACCGTATATATGATGG + Intronic
936756709 2:115722700-115722722 GTAACAGACCACATACATAAGGG - Intronic
937180111 2:119987573-119987595 GTAGAAGACCACATATCTGATGG - Intergenic
937253134 2:120536596-120536618 GTGGCAGAGCTCTTGTATGAGGG - Intergenic
938003869 2:127771438-127771460 ATGCTGGACCACATATATGATGG - Intronic
938113360 2:128586486-128586508 ATGAGAGACCATATATATGATGG - Intergenic
938703390 2:133898868-133898890 GTGGCAGACAGGATATATGAGGG + Intergenic
939246941 2:139637088-139637110 GTGGCAAACTGCATATGTGAGGG + Intergenic
940360980 2:152795296-152795318 ATGACAGACTACATATACGATGG - Intergenic
940428400 2:153557090-153557112 GCAGCAGAGCATATATATGATGG + Intergenic
940804803 2:158174862-158174884 AAGACAGACCACATATATGTTGG - Intronic
940887995 2:159007052-159007074 ATGACAGACCACATATACAATGG + Intronic
942239245 2:173944055-173944077 GCAGCGAACCACATATATGATGG - Intronic
942420264 2:175799790-175799812 ATGTTAGACCACATATATGAGGG - Intergenic
943036359 2:182750861-182750883 ATGGTGGACCACATATATGATGG - Intronic
943573150 2:189598340-189598362 AAGACAGACCACATATATGATGG - Intergenic
943614037 2:190070971-190070993 TCAGCAGACCACATAGATGAGGG + Intronic
943667149 2:190621421-190621443 ATGACAGACCACATATATAATGG - Intergenic
943677958 2:190735372-190735394 ATGACAGATCACGTATATGACGG - Intergenic
943779302 2:191804219-191804241 ATGATAGACCACATATATGACGG + Intergenic
944329546 2:198449185-198449207 ATGACAGACTGCATATATGATGG + Intronic
944593001 2:201235773-201235795 ATGACCGACCACATATATGATGG + Intronic
945900290 2:215529796-215529818 ATGGTGGACCACAAATATGATGG - Intergenic
946113570 2:217441676-217441698 ATGATGGACCACATATATGATGG - Intronic
947560533 2:231146121-231146143 GTGACACACTGCATATATGATGG - Intronic
948330086 2:237157656-237157678 GTGACAGACCACATATAGGGAGG + Intergenic
948439806 2:237979382-237979404 GTTGCAGACCTCATATAGGAAGG - Intronic
948756749 2:240163872-240163894 GTGGCAGTGCACATGTATGTAGG - Intergenic
1169684497 20:8255862-8255884 GCGACGAACCACATATATGATGG + Intronic
1170055248 20:12195175-12195197 TTGCCAGACCAAATATATCATGG - Intergenic
1170909269 20:20548010-20548032 GTGGCAGACCACATATATGATGG - Intronic
1172159090 20:32852919-32852941 GTGCCAGACCAGAAAAATGACGG - Intergenic
1172616480 20:36289608-36289630 ATGACAAACCACATATATGAAGG + Intergenic
1172982307 20:38952795-38952817 ATGACAGACCACGTATATGTTGG + Exonic
1175030031 20:55943317-55943339 ATGACTGACCACATATATGATGG - Intergenic
1175167052 20:57051701-57051723 ATGACAGATTACATATATGATGG - Intergenic
1175309345 20:58000730-58000752 AGGACAGACCACCTATATGATGG + Intergenic
1178225091 21:30707387-30707409 ATGACAGATCACCTATATGATGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183721026 22:39561434-39561456 GAGGCAGACCTCAGAGATGAAGG - Intergenic
1183741610 22:39671546-39671568 GTTGCAGACCAGGTATGTGAGGG + Intronic
1183783740 22:40017136-40017158 ATGGCAGAGCACACATGTGAAGG + Intronic
950435447 3:12976528-12976550 GAGACAGACCTCATACATGAAGG + Intronic
950439091 3:12997869-12997891 ATGACACACCACATATATGATGG - Intronic
950536837 3:13583726-13583748 GTGATAGACCCCATATATAAAGG + Intronic
950809648 3:15638932-15638954 ATGACAGACCACATATGTGATGG - Intronic
950884253 3:16348854-16348876 GTGGCAGGACACAGAGATGATGG - Intronic
950973319 3:17212232-17212254 ATGACAGACCACATACATGATGG + Intronic
951252911 3:20415262-20415284 ATGACAGACCACATATATGATGG + Intergenic
951561732 3:23974438-23974460 ATGGCAGACCACATATAAAAGGG - Intronic
951960679 3:28315671-28315693 ATGACAGACTACATATATGATGG + Intronic
952677860 3:36054386-36054408 ATGACAGACCACATATATGATGG - Intergenic
952801226 3:37294026-37294048 ATGACGGACCACACATATGACGG - Intronic
953495967 3:43387264-43387286 ATGACGGACCACATATATGATGG - Intronic
953570506 3:44067747-44067769 GTGGCAGAAGACAGAGATGAGGG + Intergenic
953763586 3:45714904-45714926 GTGACAGACCACATATATGAAGG + Intronic
955705638 3:61724880-61724902 TTTGCAAACCACATATCTGATGG - Intronic
956271154 3:67448314-67448336 GTCACAGAATACATATATGATGG + Intronic
956987617 3:74720921-74720943 ATGACAGCCCACATATAAGATGG - Intergenic
958546442 3:95558417-95558439 GCAACAGATCACATATATGATGG - Intergenic
960252910 3:115476382-115476404 ATGACAGACTGCATATATGATGG + Intergenic
960601710 3:119465239-119465261 ATGAAAGACCACATAAATGATGG + Intronic
960675063 3:120185631-120185653 GTAGCAAAGCACATAAATGAGGG - Intronic
960839659 3:121944100-121944122 ATGACAGACCAAATATGTGATGG - Exonic
960881485 3:122349872-122349894 ATGACAGACCACATATACAATGG + Intergenic
961098675 3:124179753-124179775 ATGACAGACCATATATATGATGG - Intronic
961920764 3:130423541-130423563 TTGGAAGAGCAAATATATGAGGG - Intronic
961974224 3:131005982-131006004 GTGGCATACCACATAGCTTAAGG + Intronic
962500209 3:135983614-135983636 GTGGAAGAACACAAATATCAGGG - Intronic
962748269 3:138413681-138413703 AGGGCAGACCACATATACAAAGG + Intergenic
962899294 3:139744754-139744776 GGGGCAAAGCACATGTATGAGGG + Intergenic
963347904 3:144117977-144117999 GTGGCTGACCACATTCAAGATGG - Intergenic
963403291 3:144829746-144829768 GTGATGGACCACCTATATGATGG + Intergenic
964465834 3:156991058-156991080 GTGGCAGAGAACATTTATAATGG + Intronic
965479623 3:169201903-169201925 GTGGGTGACCACATAGAAGAAGG - Intronic
966035057 3:175401714-175401736 ATGGCAGACCACATATATGATGG - Intronic
966229356 3:177634329-177634351 ATGATGGACCACATATATGATGG - Intergenic
967127737 3:186440304-186440326 ATGGCAGACCACATATACAATGG - Intergenic
967420504 3:189267051-189267073 GTCACAGACCACATATATGATGG + Intronic
968749207 4:2378382-2378404 GTGACAGGCCACATATACAATGG - Intronic
970380252 4:15500273-15500295 ATGGCAGACCCCATATACAAAGG - Intronic
970420517 4:15901693-15901715 GTGGAAGATAACATATATGTAGG + Intergenic
971287170 4:25301943-25301965 GTGACTGACCATATATACGATGG + Intergenic
971578700 4:28307070-28307092 GTGCCTGACCAAATAGATGAGGG - Intergenic
971985084 4:33811596-33811618 GTGGGAGAGTACAAATATGATGG + Intergenic
972091948 4:35297778-35297800 GTGGAAAATAACATATATGATGG - Intergenic
972434705 4:39021553-39021575 GTTGCAAACCATATATATAAGGG - Intronic
972645178 4:40961105-40961127 GTAGCAGTCCACTAATATGATGG - Intronic
972968939 4:44548554-44548576 CTTGCAGACCACATAAATGGTGG - Intergenic
973128864 4:46624397-46624419 TAAACAGACCACATATATGATGG + Intergenic
973945722 4:55952944-55952966 ACGACAGACCACATATAGGAAGG - Intronic
974174745 4:58308403-58308425 GTGCCTGACCAAATAGATGAGGG - Intergenic
974195153 4:58564751-58564773 ATGACAGACCACGTATATGATGG - Intergenic
975706284 4:77115221-77115243 ATGACAGACCACATATAGGATGG - Intergenic
975759438 4:77604444-77604466 ATGGCAATCCAAATATATGAAGG - Intronic
976347398 4:84020526-84020548 GTGTCAGACCTCATAAAGGAAGG - Intergenic
976883429 4:89958388-89958410 GTGGCAGCAAACATAAATGAGGG - Intergenic
977595754 4:98877750-98877772 GCAGCAGACCATATATAGGATGG - Intronic
978624807 4:110672900-110672922 ATGGCAGACCGCATGTACGATGG + Intergenic
979393875 4:120162320-120162342 ATGATAGACCACCTATATGATGG - Intergenic
979554193 4:122026148-122026170 ATGACAGACCACATATATGATGG - Intergenic
979625358 4:122838898-122838920 ATTGCAGACCTCATGTATGATGG + Intronic
980199049 4:129630641-129630663 ATGACAGACCACATATATGGTGG + Intergenic
980761936 4:137245965-137245987 GTGACAGATCACATATATGAAGG - Intergenic
981008971 4:139904961-139904983 ACGACAGGCCACATATATGATGG - Intronic
982772752 4:159413125-159413147 ACTACAGACCACATATATGATGG + Intergenic
983373258 4:166891917-166891939 GTGGTATAACACATCTATGAAGG - Intronic
983992938 4:174144202-174144224 TTGACAGGCCAGATATATGATGG + Intergenic
984496856 4:180509103-180509125 ATGACAGGCCACATGTATGACGG - Intergenic
984749710 4:183260450-183260472 AGGGCAGACTGCATATATGATGG + Intronic
986095705 5:4552134-4552156 ATGACAAACCACATATGTGAAGG + Intergenic
987818097 5:22930164-22930186 GTGCCTGACCAAATACATGAGGG - Intergenic
988293504 5:29323005-29323027 TTGACAGACTACACATATGATGG - Intergenic
989177978 5:38547977-38547999 GTAACAGACCATATATATGATGG - Intronic
989202683 5:38780727-38780749 ATGACAGACCACATATACAAGGG - Intergenic
989683333 5:44055446-44055468 ATGACAGACAGCATATATGACGG + Intergenic
990338523 5:54799759-54799781 ATAACAGACCACATATATGGTGG - Intergenic
990544589 5:56810047-56810069 ATGAGGGACCACATATATGATGG - Intergenic
990727133 5:58768448-58768470 GAGGCAGACAACAAATAAGAAGG + Intronic
991478131 5:67045523-67045545 ACAACAGACCACATATATGAAGG + Intronic
992306179 5:75441115-75441137 ATGACAGACCACATATATGATGG + Intronic
994264459 5:97698893-97698915 ATGATGGACCACATATATGATGG + Intergenic
996289748 5:121838562-121838584 GTGGTAAACCACATCTTTGATGG + Intergenic
996646838 5:125827232-125827254 GGGGCAGACCAACTAGATGAGGG + Intergenic
998794790 5:145807202-145807224 ATGGCAGACCGCATATATTAAGG - Intronic
998820085 5:146050081-146050103 GTGGCAGCTCACCTAAATGAAGG - Intronic
999676048 5:154003898-154003920 ACAGCAGACCACATATATAATGG + Intronic
1000287808 5:159842620-159842642 ATCACAGACCACATATATAAGGG + Intergenic
1000778554 5:165449805-165449827 ATGACAGATCACCTATATGATGG + Intergenic
1005228913 6:23676415-23676437 ATGATAGACCACATATATGATGG - Intergenic
1005427549 6:25718664-25718686 ATGCCAGACCACATATATAACGG + Intergenic
1006021605 6:31120974-31120996 GGGGCAGAACTCATATTTGAAGG - Intronic
1006354003 6:33542942-33542964 ATGACAGACCACATATACGATGG - Intergenic
1006953992 6:37850472-37850494 GTGACAGACCACAAATACGAAGG + Intronic
1008487226 6:52049369-52049391 GTGATGGACCAAATATATGATGG - Intronic
1009873001 6:69472180-69472202 GTGCCTGACCAAATAGATGAGGG - Intergenic
1011186261 6:84679605-84679627 ATGATGGACCACATATATGATGG - Intergenic
1011648775 6:89486180-89486202 GTGACAGACCATCTATAGGAAGG + Intronic
1012226598 6:96710705-96710727 GCAACAGACCACATGTATGATGG + Intergenic
1012340091 6:98110283-98110305 GTGATGGACTACATATATGATGG + Intergenic
1012489290 6:99762819-99762841 ATGACAGACCACACATATGATGG - Intergenic
1012659965 6:101875438-101875460 TTGGCTGAGCAGATATATGATGG - Intronic
1013411037 6:109883729-109883751 ATCACAGACCACATATACGATGG - Intergenic
1013440883 6:110166993-110167015 GTGATGGACCACATATATGTTGG + Intronic
1014218099 6:118772595-118772617 AAGGCAGACCATGTATATGACGG - Intergenic
1014226348 6:118852219-118852241 GTGATGGACCACATATATGATGG - Intronic
1015099501 6:129459291-129459313 ATGACAGATCACATATATGATGG - Intronic
1015315854 6:131815255-131815277 GTGGCAGTCGGCATGTATGAAGG + Intronic
1015840168 6:137468190-137468212 ATGACAGACCACATATACAATGG + Intergenic
1017586049 6:155924379-155924401 GTGACTAACCACATATATGATGG - Intergenic
1018305966 6:162455563-162455585 ATGAGGGACCACATATATGATGG - Intronic
1018562878 6:165120494-165120516 AAGGCAGACCACACATATGAGGG + Intergenic
1019829778 7:3316223-3316245 GTGACAGACTGCATATATAAGGG + Intronic
1020388713 7:7635386-7635408 ATGACAGACTGCATATATGATGG - Intergenic
1021345889 7:19528110-19528132 ATGACTGACTACATATATGATGG + Intergenic
1022337517 7:29435658-29435680 ATGACAGACCACATATACCATGG - Intronic
1022685591 7:32593351-32593373 GTGACAGACAGCATATACGATGG - Intergenic
1023766549 7:43517009-43517031 ATGACAGACCACATATACAACGG - Intronic
1024627884 7:51223957-51223979 CTGACAGACCACATATATAAAGG + Intronic
1027475341 7:78623802-78623824 CTGACAGACCACATATATCATGG + Intronic
1027855319 7:83503794-83503816 GTGGCAGACAACTTATATGAGGG - Intronic
1028115401 7:86991470-86991492 CTGGTAGACCACATCTATGATGG - Intronic
1028478426 7:91276791-91276813 ATGACAGACCACATATATGATGG + Intergenic
1028866933 7:95724466-95724488 ATGGCAGACCGCATATAGGATGG + Intergenic
1030431307 7:109452501-109452523 GTGGCAGACCACTTCCAAGATGG - Intergenic
1031191865 7:118563224-118563246 GTGACAGATGACATATATGATGG + Intergenic
1031281023 7:119799272-119799294 GCAGCAGACCACATATGAGATGG - Intergenic
1031368669 7:120936784-120936806 ATGACAGACCACATATGCGATGG + Intergenic
1031412062 7:121451246-121451268 GTGACAGACTACATATACAATGG + Intergenic
1031476282 7:122226555-122226577 GTGGCAGGCCTCAGATATTATGG - Intergenic
1031731998 7:125311878-125311900 GTGCCTGACCAAATAGATGAGGG - Intergenic
1033759018 7:144420868-144420890 GTGCCTGACCAAACATATGAGGG + Intergenic
1036718477 8:11149402-11149424 ACAGCAGACCACATATACGACGG - Intronic
1036759696 8:11499100-11499122 ATCACAGACTACATATATGATGG + Intronic
1037560573 8:20070856-20070878 ATGACAGACCACATATACGATGG - Intergenic
1037739553 8:21596689-21596711 GTGATAAATCACATATATGATGG + Intergenic
1038035818 8:23685763-23685785 GTGACAGACAGCATATATGACGG + Intergenic
1040380756 8:46869240-46869262 GTGGCAGACTCCAAATATCAAGG + Intergenic
1040382702 8:46888242-46888264 GAGTCATACCACCTATATGATGG + Intergenic
1040392128 8:46959339-46959361 ATGATAGACCACATATGTGATGG - Intergenic
1042772127 8:72392003-72392025 GTGCCTGACCAAATAGATGATGG - Intergenic
1043195281 8:77285514-77285536 ATGACAGACTGCATATATGATGG + Intergenic
1044265019 8:90171816-90171838 ATAACAGACCACGTATATGATGG + Intergenic
1044296513 8:90534146-90534168 ATGGCAGACTGCATACATGACGG - Intergenic
1044644104 8:94419889-94419911 ACCACAGACCACATATATGATGG + Intronic
1044843258 8:96355990-96356012 GTGACAGACCGCATATACAATGG + Intergenic
1045642923 8:104271719-104271741 ATGACAGACCACAAATACGATGG - Intergenic
1046233746 8:111393645-111393667 ATGGTGGACCACATATATAATGG + Intergenic
1047923652 8:129660773-129660795 ATGACAGACCACATATACAACGG - Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048501201 8:134976796-134976818 TAGGCAGGCCACATAAATGAGGG - Intergenic
1048784010 8:138031210-138031232 ATGACAGACCACATATAAGATGG - Intergenic
1050652759 9:7791082-7791104 GTGGGATGCCACATACATGAAGG + Intergenic
1050952467 9:11615506-11615528 GTGACATACCACATATATGATGG - Intergenic
1051826643 9:21229042-21229064 ATGGCAGCCCAAATATATGCAGG + Intronic
1052361727 9:27568599-27568621 ATGGTAGACTGCATATATGATGG + Intronic
1052729496 9:32268580-32268602 ATGACAGACCACATATACGATGG + Intergenic
1055247304 9:74262374-74262396 GTGATGGACCACATATATGATGG - Intergenic
1056526167 9:87444933-87444955 GTGATAGACTGCATATATGATGG + Intergenic
1056566874 9:87780833-87780855 AGGACAGACCACATATATCATGG - Intergenic
1059526643 9:114997417-114997439 ATGACGGACCACATACATGATGG + Intergenic
1062660785 9:137631548-137631570 GTGGCAGACCACATACATGAAGG + Intronic
1186294729 X:8136573-8136595 GTGACAGACCACATATTTGATGG + Intergenic
1186296507 X:8154684-8154706 ATGGCAGACTGCATATATGGAGG - Intergenic
1187395293 X:18914227-18914249 ATGGCAGACCGCATATATGGCGG - Intronic
1187750654 X:22460605-22460627 ATGACAGACCACATATATGGCGG - Intergenic
1189027621 X:37413771-37413793 ATGACAGACCACATATATGAAGG + Intronic
1189454543 X:41173929-41173951 GTGATAGACCACATATACAATGG + Intronic
1190616689 X:52240953-52240975 ATGACAGACCACATATATAATGG + Intergenic
1191011539 X:55764480-55764502 ATGACAGACCACATATATGATGG + Intergenic
1193317862 X:80084840-80084862 GTGACAGACTGAATATATGATGG + Intergenic
1193800983 X:85935682-85935704 ACAACAGACCACATATATGATGG - Intronic
1194473573 X:94330357-94330379 ATGACAGACCACACATAAGATGG + Intergenic
1195070191 X:101271789-101271811 ATGACAGACTGCATATATGATGG - Intronic
1195168693 X:102245343-102245365 ATGATAGACCACATATATGATGG - Intergenic
1195190164 X:102441744-102441766 ATGATAGACCACATATATGATGG + Intronic
1198067803 X:133116866-133116888 ATGATGGACCACATATATGAAGG - Intergenic
1199020729 X:142874596-142874618 ATGACAGACCACATCTATGATGG - Intergenic
1200175293 X:154110538-154110560 ATGACAGACCACATATATGATGG - Intergenic
1200355475 X:155545596-155545618 GTAACAGACCACATATATGATGG + Intronic
1200368739 X:155698325-155698347 GTGGCAAACCACATAAAAAATGG + Intergenic
1200870613 Y:8094147-8094169 GAGTCACATCACATATATGATGG + Intergenic
1200905578 Y:8478946-8478968 GTGGCAGACTCCAAATATCAAGG - Intergenic
1201603026 Y:15751384-15751406 ATGACAGAGCACATATTTGATGG - Intergenic