ID: 1170909310

View in Genome Browser
Species Human (GRCh38)
Location 20:20548791-20548813
Sequence GTAATTACAGGTGTGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 410}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170909310_1170909315 13 Left 1170909310 20:20548791-20548813 CCTCAGCACACACCTGTAATTAC 0: 1
1: 0
2: 3
3: 43
4: 410
Right 1170909315 20:20548827-20548849 CATTGTGCTGGGACTTGTCTCGG 0: 1
1: 0
2: 0
3: 11
4: 163
1170909310_1170909314 2 Left 1170909310 20:20548791-20548813 CCTCAGCACACACCTGTAATTAC 0: 1
1: 0
2: 3
3: 43
4: 410
Right 1170909314 20:20548816-20548838 ACAGAGGTACTCATTGTGCTGGG No data
1170909310_1170909313 1 Left 1170909310 20:20548791-20548813 CCTCAGCACACACCTGTAATTAC 0: 1
1: 0
2: 3
3: 43
4: 410
Right 1170909313 20:20548815-20548837 CACAGAGGTACTCATTGTGCTGG No data
1170909310_1170909316 22 Left 1170909310 20:20548791-20548813 CCTCAGCACACACCTGTAATTAC 0: 1
1: 0
2: 3
3: 43
4: 410
Right 1170909316 20:20548836-20548858 GGGACTTGTCTCGGAATATCAGG 0: 1
1: 0
2: 0
3: 3
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170909310 Original CRISPR GTAATTACAGGTGTGTGCTG AGG (reversed) Intronic
900273306 1:1805810-1805832 GGAATTACAGGTGTGAGCCACGG + Intronic
901543286 1:9935857-9935879 GGGATTACAGGTGTGAGCTACGG - Intronic
902768723 1:18633408-18633430 GGCATCACTGGTGTGTGCTGGGG - Intronic
903084089 1:20839245-20839267 GGGATTACAGGTGTGAGCTACGG + Intronic
903221405 1:21871530-21871552 GGAATTACAGGTGTGGGCTCTGG + Intronic
904545279 1:31265551-31265573 TTAATTACAGCTGGGTGCAGTGG + Intronic
904720228 1:32501950-32501972 GGAATTACAGGTGTGAGCCGCGG + Intronic
904976048 1:34457506-34457528 GGGATTACAGGTGTGTGCCACGG - Intergenic
905218457 1:36426974-36426996 GGGATTACAGGTGTGTGCCATGG + Intronic
906754563 1:48297712-48297734 GGCTTCACAGGTGTGTGCTGGGG + Exonic
907179536 1:52557483-52557505 GTGATTACAGGTGTGAGCCATGG - Intergenic
908197621 1:61760880-61760902 GGGATTACAGGTGTGAGCCGTGG + Intronic
908368578 1:63455578-63455600 GTGATTACAGGTGTGAGCCATGG + Intronic
908662485 1:66452112-66452134 GGAATTACAGGTGTGAGCCATGG + Intergenic
908678273 1:66630534-66630556 GGAATTACAGGTGTGAGCCACGG - Intronic
909093544 1:71257533-71257555 GTAATTACAGTTTTATGCTTAGG + Intergenic
909955363 1:81772456-81772478 GGGATTACAGGTGTGAGCCGTGG - Intronic
910794014 1:91080064-91080086 GGGATTACAGGTGTGTGCCATGG - Intergenic
910838539 1:91539471-91539493 GTATTTGCAGGTGTGGGCTCTGG + Intergenic
911131258 1:94390571-94390593 GGGATTACAGGTGTGTGCCATGG + Intergenic
912012526 1:104985568-104985590 GGAATTACAGGTGTGAGCCACGG + Intergenic
913467586 1:119158468-119158490 GGGATTACAGGTGTGTGCCATGG + Intergenic
915380418 1:155434580-155434602 GGGATTACAGGTGTGAGCTACGG - Intronic
917190061 1:172406447-172406469 GGAATTACAGGTGTGAGCCATGG - Intronic
917875929 1:179287054-179287076 GGTATTACAGGTGTGAGCTATGG - Intergenic
918302309 1:183215646-183215668 GTAAATACAAGTGTTTGCTAAGG - Intronic
919666898 1:200301265-200301287 GGGATTACAGGTGTGAGCTGCGG - Intergenic
919889853 1:201963344-201963366 GGGATTACAGGTGTGAGCTATGG + Intronic
921835507 1:219774153-219774175 GTAATTAGAGAAGAGTGCTGGGG + Intronic
922870901 1:228901237-228901259 CTAGTTACAGTTGTGTGGTGGGG - Intergenic
923585968 1:235271357-235271379 GTGATTACAGGTGTGAGCCATGG - Intronic
924703252 1:246475370-246475392 GTGATTACAGGTGTGAGCCATGG - Intronic
1062783462 10:239067-239089 AGAATGACAGGTGTGTGCTTAGG + Intronic
1062799803 10:370482-370504 GTAGTCAGAGGTGTGTGCTGTGG - Intronic
1063080588 10:2763929-2763951 GAAATTACAGGTGTGAGCCACGG - Intergenic
1063263834 10:4422987-4423009 GGAATTACAGGTGTGAGCCACGG - Intergenic
1063452625 10:6161204-6161226 GGAATTACAGGTGTGAGCCACGG + Intronic
1063515598 10:6691786-6691808 GAAATTTTAGGTGTGTGTTGAGG + Intergenic
1063703824 10:8411205-8411227 GGGATTACAGGTGTGAGCAGTGG - Intergenic
1063810153 10:9695796-9695818 GTGGTCACAGGTGTGTGCTTAGG + Intergenic
1063988036 10:11528623-11528645 GTAATTAAAATTGTGGGCTGTGG - Intronic
1064029356 10:11874105-11874127 GGGATTACAGGTGTGAGCCGCGG - Intergenic
1064089551 10:12371935-12371957 GGGATTACAGGTGTGAGCCGTGG + Intronic
1064405923 10:15063007-15063029 GGGATTACAGGTGTGAGCTGTGG + Intronic
1064437635 10:15325223-15325245 GGAATTACAGGTGTGAGCCCCGG - Intronic
1064811338 10:19202082-19202104 GGAATTACAGGTGTGAGCCACGG + Intronic
1065513012 10:26497995-26498017 GGAATTACAGGTGTGAGCCATGG + Intronic
1065718904 10:28605549-28605571 GGAATTACAGGTGAGTAGTGTGG - Intronic
1068530095 10:58175900-58175922 AGAATTGTAGGTGTGTGCTGAGG - Intergenic
1069062287 10:63906616-63906638 GGGATTACAGGTGTGAGCTACGG + Intergenic
1069468612 10:68665040-68665062 GGCATTACAAGTGTGAGCTGCGG + Intronic
1069778961 10:70943028-70943050 CTAATGACAGGCATGTGCTGAGG + Intergenic
1071013162 10:80963045-80963067 GGAATTACAGGTGTGAGCCATGG + Intergenic
1071049491 10:81429357-81429379 TTATTTACAAGTGTGTTCTGGGG - Intergenic
1071305718 10:84297345-84297367 GAAATTACAGGTGTGAGCCATGG + Intergenic
1071582846 10:86789440-86789462 GGAATTACAGGTGTGAGCCACGG - Intronic
1072544143 10:96421391-96421413 GGAATTACAGGTGTGAGCCATGG - Intronic
1072824896 10:98597392-98597414 GGGATTACAGGTGTGAGCCGTGG - Intronic
1072967402 10:99986019-99986041 GGAATTACAGGTGTGAGCCACGG + Intronic
1073285408 10:102384534-102384556 GGGATTACAGGTGTGTGCCATGG - Intergenic
1073754930 10:106571627-106571649 GTAATTAGAGGTGCTAGCTGGGG + Intergenic
1073958117 10:108895723-108895745 GGGATTACAGGTGTGAGCCGCGG - Intergenic
1074505655 10:114067992-114068014 GGGATTACAGGTGTGAGCTAAGG + Intergenic
1076397106 10:130147769-130147791 GGGATTACAGGTGTGAGCCGAGG - Intronic
1077029242 11:456445-456467 GGAATTACAGGTGTGAGCCACGG + Intronic
1079206094 11:18415963-18415985 GGAATTACAGGTGTGAGCTGCGG + Intronic
1080405640 11:31976449-31976471 GGGATTACAGGTGTGAGCTATGG - Intronic
1080681085 11:34476794-34476816 GGGATTACAGGTGTGTGCCACGG + Intergenic
1081727068 11:45337635-45337657 GGTATTACAGGTGTGAGCTGTGG + Intergenic
1081965832 11:47169041-47169063 GGAATTACAGGTGTGAGCCACGG - Intronic
1082286276 11:50321301-50321323 GGGATTACAGGTGTGAGCTACGG + Intergenic
1082965136 11:58959346-58959368 GTGATTACAGGCGTGAGCTACGG + Intronic
1083822279 11:65180103-65180125 GGGATTACAGGTGTGAGCTTTGG - Intronic
1084874288 11:72119346-72119368 GAAGCTTCAGGTGTGTGCTGCGG + Intronic
1085089674 11:73700328-73700350 GGAATTACAGGTGTGAGCCATGG - Intronic
1086352720 11:85959355-85959377 GGGATTACAGGTGTGAGCTATGG - Intronic
1086849254 11:91789919-91789941 GGAATTACAGGTGTGAGCCACGG + Intergenic
1088318236 11:108528971-108528993 GGGATTACAGGTGTGAGCCGTGG + Intronic
1088774820 11:113071872-113071894 GGAATTACAGGTGTGAGCCACGG - Intronic
1088860807 11:113797536-113797558 GCAATTGCCGGTGTCTGCTGAGG + Intergenic
1089058077 11:115603365-115603387 GGAACTACAGGTGTGTGCCATGG - Intergenic
1090214904 11:124953459-124953481 GTAAGTAAATGTGTGTGATGTGG - Intergenic
1090295252 11:125581925-125581947 GGAATTACAGGCGTGAGCCGTGG - Intronic
1092739773 12:11616438-11616460 GGGATTACAGGTGTGAGCTAGGG - Intergenic
1092751842 12:11726505-11726527 GGGATTACAGGTGTGAGCTACGG - Intronic
1093846134 12:23973427-23973449 GGGATTACAGGTGTGAGCTGCGG + Intergenic
1094129948 12:27064052-27064074 ATAATTAGAGCTCTGTGCTGAGG + Intronic
1094398242 12:30032068-30032090 GTAATTACAGGTTTGGGTAGTGG + Intergenic
1094613318 12:32014409-32014431 GAGATTACAGGTATGAGCTGCGG - Intergenic
1095531785 12:43195830-43195852 TTAATTACAGGTGTGAGCCAAGG - Intergenic
1095877419 12:47097270-47097292 GTAATTAAATGTGTGTTTTGAGG - Intronic
1096278798 12:50233810-50233832 ATAATAATAGCTGTGTGCTGTGG - Intronic
1096375154 12:51103010-51103032 GGGATTACAGGTATGAGCTGCGG - Intronic
1096403433 12:51325562-51325584 GGGATTACAGGTGTGAGCCGTGG - Intergenic
1096582937 12:52600124-52600146 AAAGTTACAGGTGTGTGCTGAGG - Intronic
1096886596 12:54725077-54725099 GTTATTACAGAAGTTTGCTGTGG - Intergenic
1097253529 12:57654864-57654886 GGGATTACAGGTGTGAGCTATGG - Intergenic
1097778827 12:63680129-63680151 GTAATGAAATATGTGTGCTGGGG - Intergenic
1097893510 12:64801819-64801841 GTAAATTCAGATGTGTTCTGAGG + Intronic
1097997512 12:65905568-65905590 GTGATGACATGTCTGTGCTGTGG - Intronic
1098692653 12:73507725-73507747 GTAAATACAGGTGGGAGCTTCGG + Intergenic
1099063445 12:77942577-77942599 TTAATTACAGTTGTTTTCTGAGG + Intronic
1099077225 12:78124722-78124744 GGGATTACAGGTGTGAGCCGTGG + Intronic
1099521351 12:83667930-83667952 ATAATTACAGGTGTGTTGAGGGG - Intergenic
1100294324 12:93246697-93246719 GTGATTACATGTGTGGGCTCAGG - Intergenic
1100444382 12:94647842-94647864 GTAATTTCAAGTCTGTCCTGAGG - Intronic
1100603675 12:96133508-96133530 GGAATTACAGGTGTGAGCCATGG + Intergenic
1102275136 12:111576171-111576193 GGAATTATAGGTGTGAGCCGTGG - Intronic
1102929408 12:116850962-116850984 GTCATTACAGGTATATGGTGGGG - Exonic
1102949413 12:117020072-117020094 GTGCGCACAGGTGTGTGCTGGGG - Intronic
1102955776 12:117057947-117057969 GGGATTACAGGTGTGAGCTACGG - Intronic
1103694129 12:122800308-122800330 GCAATTACAGGTGTGAGCCATGG - Intronic
1103793092 12:123485417-123485439 GGAATTAAAGGTGTGAGCTCTGG + Intronic
1105350555 13:19611378-19611400 GGGATTACAGGTGTGTGCCCTGG + Intergenic
1107365457 13:39668516-39668538 GGGATTACAGGTGTGAGCTACGG - Intronic
1107546834 13:41441461-41441483 GGGATTACAGGTGTGTGCCATGG - Intergenic
1107734694 13:43386285-43386307 GTCCTTACAGGGATGTGCTGAGG + Intronic
1107870546 13:44742626-44742648 GGAATTACAGGTGTGAGCCACGG + Intergenic
1107917119 13:45164043-45164065 GGAATTACAGATGTGTGCTGAGG - Intronic
1107996065 13:45862310-45862332 CAGATTACAGGTGTGAGCTGGGG - Intergenic
1110457236 13:75703156-75703178 TAAATTTCAGGTGTGTGTTGGGG - Intronic
1111921997 13:94422072-94422094 GGAATTACAGGTGTGAGCCCTGG - Intergenic
1114949048 14:27724098-27724120 GGGATTACAGGTGTGAGCTAAGG - Intergenic
1115532985 14:34344046-34344068 GGGATTACAGGCGTGAGCTGCGG - Intronic
1116016679 14:39415935-39415957 GGAATTACAGGTGTGAGCCATGG + Intronic
1116117220 14:40670155-40670177 GCCATCACAGGTGTGTGATGGGG - Intergenic
1116689671 14:48089402-48089424 GGGATTACAGGCGTGAGCTGCGG - Intergenic
1116818366 14:49604030-49604052 GGGATTACAGGTGTGAGCTATGG - Intronic
1117141856 14:52797311-52797333 GGGATTACAGGCGTGAGCTGTGG - Intergenic
1117613153 14:57504688-57504710 GTACATCCAGGTGTGTCCTGGGG + Intergenic
1118417533 14:65558194-65558216 GAGACTACAGGTGTCTGCTGTGG - Intronic
1119338315 14:73853089-73853111 GGAATTACAGGTGTGAGCCACGG + Intronic
1120613703 14:86675267-86675289 GAAATAAGAGGTGTGTGCTCAGG + Intergenic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1122483000 14:102059847-102059869 GCAATTACAGGTGTGAGCCACGG + Intergenic
1123148482 14:106157699-106157721 GTAATAACTGATGTGTGCTGAGG - Intergenic
1123407300 15:20028744-20028766 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1123516627 15:21035400-21035422 GCATTTACAGGTGTGTGCCAAGG + Intergenic
1124386223 15:29210140-29210162 GTAGTTCGAGGTGTGGGCTGTGG - Intronic
1125789520 15:42353238-42353260 ATAAGAAGAGGTGTGTGCTGAGG - Exonic
1126755399 15:51920775-51920797 GGAATTACAGGCGTGAGCTATGG - Intronic
1129002630 15:72346959-72346981 GTAATACCAGCTGTGAGCTGAGG + Intronic
1129191128 15:73938142-73938164 GGGATTACAGGTGTGTGCTCTGG - Intronic
1130943662 15:88533749-88533771 GGGATTACAGGTGTGTGCTATGG - Intronic
1131072728 15:89476336-89476358 GGAATTACAGTTGTGAGCTACGG + Intronic
1131165983 15:90142437-90142459 GGGATTACAGGTGTGAGCCGCGG - Intergenic
1131439563 15:92448612-92448634 TTAATTACATGTGTCTTCTGCGG - Intronic
1132048616 15:98587815-98587837 GGGATTACAGGTATGAGCTGTGG - Intergenic
1132161162 15:99544115-99544137 GTAATTACAGGTGTGAGCCACGG - Intergenic
1132174902 15:99704893-99704915 GTAATTACAGATGTACTCTGAGG - Intronic
1134483025 16:14634556-14634578 GGGATTACAGGCGTGAGCTGCGG - Intronic
1134935435 16:18241352-18241374 GGGATTACAGGTGTGAACTGTGG - Intergenic
1135134832 16:19879861-19879883 GGGATTACAGGTGTGAGCTACGG - Intronic
1135568150 16:23527945-23527967 GTATTCACAGGTGTGGGCTTTGG + Intronic
1135886490 16:26313752-26313774 GTAATGAGAGGTGTGTGAGGGGG + Intergenic
1135983620 16:27167782-27167804 GGGATTACAGGTGTGTGCCATGG - Intergenic
1136342782 16:29655798-29655820 GGAATTACAGGTGTGTGCCACGG - Intergenic
1136681728 16:31969941-31969963 GTAATAACTGATGTGTGCTGAGG + Intergenic
1136782034 16:32911443-32911465 GTAATAACTGATGTGTGCTGAGG + Intergenic
1136887755 16:33942408-33942430 GTAATAACTGATGTGTGCTGAGG - Intergenic
1137376864 16:47959154-47959176 GAGATTACAGGTGTGAGCTGTGG + Intergenic
1137615311 16:49842703-49842725 GGAATTACAGGCGTGAGCTACGG - Intronic
1137654105 16:50145539-50145561 GGAATTACAGGTGTGAGCTATGG + Intergenic
1138182514 16:54951454-54951476 GAGATTACAGGTGTGAGCTACGG + Intergenic
1138334980 16:56245976-56245998 GTAATTATGGGTGTGGGCTCTGG - Intronic
1138385127 16:56631371-56631393 GGGATTACAGGTGTGGGCCGCGG + Intergenic
1138499559 16:57431138-57431160 GTAAGAACTGGTGAGTGCTGGGG - Exonic
1139157054 16:64456121-64456143 GGAATTACAGGTGTGAGCCACGG - Intergenic
1139371626 16:66472747-66472769 GAAATTACAGGTGTGAGCCATGG - Intronic
1140640898 16:76971415-76971437 TAAAGTACAGGTATGTGCTGAGG + Intergenic
1141090746 16:81128756-81128778 GGAATTACAGGTGTGAGCCACGG + Intergenic
1141245033 16:82298038-82298060 TGCATTACAGCTGTGTGCTGGGG + Intergenic
1203084695 16_KI270728v1_random:1175430-1175452 GTAATAACTGATGTGTGCTGAGG + Intergenic
1143126322 17:4642960-4642982 GGAATTACAGGTGTGAGCCACGG + Intergenic
1143429400 17:6869228-6869250 GGAATTACAGGTGTGAGCCACGG + Intergenic
1143682184 17:8484396-8484418 CTGATTACAAGTGTGAGCTGCGG + Intronic
1144061695 17:11588673-11588695 GGGATTACAGGTGTGAGCTACGG - Intergenic
1144116871 17:12103315-12103337 GGAATTACAGGTGTGAGCCATGG + Intronic
1144134849 17:12283901-12283923 GTACTTTCTGGTGTGTGCCGTGG + Intergenic
1145040521 17:19574759-19574781 GGGATTACAGGTGTGTGCGGTGG + Intronic
1145067953 17:19775957-19775979 GAAATTCCATGTGTTTGCTGAGG - Exonic
1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG + Intronic
1145126452 17:20303999-20304021 GGGATTACAGGTGTGAGCTATGG - Intronic
1145757935 17:27406405-27406427 GAGATTACAGGTGTGAGCCGTGG - Intergenic
1145919020 17:28596395-28596417 GGGATTACAGGTGTGAGCTATGG - Intronic
1146182046 17:30704717-30704739 GGGATTACAGGTGTGAGCCGTGG - Intergenic
1146437259 17:32861745-32861767 GGAATTACAGGTGTGAACCGTGG - Intronic
1147731004 17:42602044-42602066 GGGATTACAGGTGTGAGCTACGG - Intronic
1148396891 17:47315548-47315570 GGAATTACAAGTGTGAGCTACGG + Intronic
1149455051 17:56780994-56781016 GTACTTACAGGGTTGTGATGAGG - Intergenic
1149907384 17:60538653-60538675 GCAATTTCAGGTGTGTGCCACGG - Intergenic
1150180846 17:63119192-63119214 GGGATTACAGGTATGAGCTGTGG + Intronic
1150180876 17:63119742-63119764 GGAATTACAGGTGTGAGCCATGG - Intronic
1150303659 17:64066409-64066431 GGAATTACAGGTGTATGCCATGG + Intronic
1151430256 17:74057570-74057592 TTATTTACAGGTGTGTCCTCAGG + Intergenic
1151699307 17:75734394-75734416 GTGATTACAGATGTGTACTTTGG - Intronic
1152397915 17:80046258-80046280 GGGATTACAGGTGTGAGCTGGGG - Intronic
1152836487 17:82536146-82536168 GGGATTACAGGTGTGAGCTACGG + Intronic
1152850905 17:82634835-82634857 GGGATTACAGGGGTGAGCTGCGG + Intronic
1153062239 18:1006209-1006231 GTGAGCACAGGTGTGTGCTGAGG + Intergenic
1153705492 18:7740688-7740710 GGAATTACAGTTGTGAGCTGTGG + Intronic
1154134923 18:11768328-11768350 GGAATTACAGGTGTGAGCCACGG - Intronic
1154148188 18:11884090-11884112 ATAATCCCAAGTGTGTGCTGGGG + Exonic
1156793836 18:41015480-41015502 GTAATTAATGGTGTCTTCTGGGG - Intergenic
1157627639 18:49063897-49063919 GGAATTACAGGTGTGAGCCACGG + Intronic
1158045238 18:53147654-53147676 ATAATAACAGGTGTGTGAGGTGG - Intronic
1158454487 18:57594121-57594143 GGGATTACAGGTGTGTGCCTCGG - Intergenic
1159147551 18:64473516-64473538 GTGATTTCAGGTGTCTGCTTTGG - Intergenic
1159803338 18:72926611-72926633 GTATTTACGGATGAGTGCTGGGG + Intergenic
1160972137 19:1774308-1774330 GGGATTACAGGTGTGTGCCATGG - Intronic
1161477363 19:4494048-4494070 GCAGTGACAGGTGGGTGCTGGGG + Exonic
1161565764 19:5001292-5001314 GGAATTACAGGTGTGAGCCACGG + Intronic
1161776397 19:6264632-6264654 AGGATTACAGGTGTGAGCTGTGG - Intronic
1161810568 19:6468806-6468828 ATAATTCCAGGTGTGTGCATGGG + Intronic
1162464909 19:10833897-10833919 GGGATTACAGGTGTGAGCTACGG - Intronic
1163139828 19:15339864-15339886 GCAATTACAGGTGTGAGCCACGG - Intergenic
1163753139 19:19090555-19090577 GGGATTACAGGTGTGTGCCACGG - Intronic
1163838417 19:19590737-19590759 GGAATTACAGGTGTGAGCCATGG + Intronic
1164278525 19:23746834-23746856 GGAATACCAGGTGGGTGCTGTGG + Intronic
1164835717 19:31353953-31353975 CTAGGAACAGGTGTGTGCTGTGG + Intergenic
1164911342 19:32014654-32014676 GTAAGGACAGCTGGGTGCTGTGG + Intergenic
1165081914 19:33311776-33311798 GAGATTACAGGTGTGAGCTGAGG - Intergenic
1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG + Intronic
1166527067 19:43518244-43518266 GTAATTATAGGTGTGAGCCACGG - Intronic
1167145313 19:47678049-47678071 GTAATTACAGATAAGTGTTGTGG + Intronic
1167279727 19:48559848-48559870 GGGATTACAGGCGTGAGCTGTGG - Intronic
1167585919 19:50375823-50375845 GGGATTACAGGCGTGAGCTGCGG - Intronic
1167700927 19:51045103-51045125 GTGATTACAGGTGTGAGCCACGG + Intergenic
1168038693 19:53740686-53740708 GGAATCACAGGTGTGAGCCGTGG - Intergenic
1168380349 19:55915308-55915330 GTAATTACAGCCATGTGCGGTGG + Intronic
1168500984 19:56893119-56893141 GGCATTACAGGTGTGAGCCGCGG - Intergenic
926192289 2:10737959-10737981 GAAATTACAGGTGTGAGCCCCGG + Intronic
926242191 2:11096877-11096899 GAAATGGCAGGTCTGTGCTGGGG - Intergenic
926578728 2:14611520-14611542 GAAAATACAAGTGTGTGTTGAGG + Intergenic
926610153 2:14938615-14938637 GTCATTAAAGGTGTGTGATTGGG - Intergenic
928010658 2:27604508-27604530 GGGATTACAGGTGTGAGCTAAGG - Intronic
928518737 2:32067330-32067352 GGGATTACAGGTGTGAGCCGCGG + Intronic
930077931 2:47422420-47422442 GGGATTACAGGTGTGAGCTCAGG + Intronic
930817383 2:55612445-55612467 GGGATTACAGGTGTGAGCAGTGG - Intronic
931287681 2:60846438-60846460 GGAATTACAGGTGTGAGCCACGG + Intergenic
931595688 2:63940024-63940046 GGAATTACAGGTGTGAGCCATGG + Intronic
931802300 2:65770468-65770490 GTTAATACAGGTGTTGGCTGGGG + Intergenic
932698119 2:73973977-73973999 GCAATTACAGGTGTGAGCCATGG + Intergenic
933672916 2:85026405-85026427 GGAATTACAGGTGTGAGCTATGG + Intronic
934046303 2:88175392-88175414 GTGTTTGGAGGTGTGTGCTGAGG + Exonic
934535761 2:95131870-95131892 GTGATTACAGGTGTGAGCCACGG - Intronic
935936632 2:108192247-108192269 GTAATTAAGGTTGTGTGCTGTGG + Intergenic
936461729 2:112719304-112719326 GCAAGCACAGTTGTGTGCTGCGG - Intergenic
937398029 2:121555945-121555967 GAAATTACAGGTGTGAGCCACGG + Intronic
940024569 2:149192557-149192579 GTAATTAAGGGTGTCTGCAGGGG - Intronic
940899166 2:159110583-159110605 GGGATTACAGGTGTGTGCCATGG + Intronic
940916114 2:159257656-159257678 GGGATTACAGGTGTGAGCCGCGG + Intronic
942119610 2:172763978-172764000 GTGATTACAGGTGTGAGCCATGG - Intronic
943257071 2:185608642-185608664 GTAATTAGAGGAATGTACTGGGG - Intergenic
943404283 2:187460844-187460866 GAAATTTCATGTGTGTGCAGAGG + Intergenic
943527877 2:189040256-189040278 AGAATTACAGGTGTGTGCCAAGG + Intronic
944155031 2:196598668-196598690 GTGATTACAGGCGTGAGCTACGG - Intergenic
945147484 2:206753416-206753438 GGAATTACAGGTGTGAGCCATGG + Intronic
945494018 2:210488020-210488042 CAACTTACAGGTCTGTGCTGGGG + Intronic
946859640 2:223988440-223988462 GGAATTACAGGTGTGTGCCATGG + Intronic
947548969 2:231032968-231032990 GCCAGTACAGGTGTGTCCTGGGG + Intergenic
1169447693 20:5686303-5686325 GGAATTACAGGTGTGAGCCACGG - Intergenic
1170909310 20:20548791-20548813 GTAATTACAGGTGTGTGCTGAGG - Intronic
1171160052 20:22913667-22913689 GGGATTACAGGTGTGAGCTACGG + Intergenic
1172056854 20:32160090-32160112 GTACTTCCAGCTGTGTGCAGAGG + Exonic
1172190210 20:33057457-33057479 GGGATTACAGGCGTGAGCTGGGG + Intronic
1172513785 20:35518502-35518524 GTAATTAAAGGTGTGTGTTGAGG - Exonic
1174527929 20:51188699-51188721 GGAATTACAGGTGTGAGCCACGG - Intergenic
1174708930 20:52684865-52684887 GTGATGAAAGGTGTGTGTTGGGG + Intergenic
1175139284 20:56847858-56847880 GGGATTACAGGTGTGAGCTACGG - Intergenic
1175147514 20:56908055-56908077 GGGATTACAGGTGTGTGCAATGG + Intergenic
1175374820 20:58516782-58516804 GGGATTACAGGTGTGTGCCACGG - Intergenic
1175439308 20:58979718-58979740 GGGATTACAGGTGTGAGCCGCGG + Intergenic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1176894719 21:14363211-14363233 GTGATTACAGGTGTGAGCCACGG + Intergenic
1177974301 21:27827984-27828006 TTGATTCCAGGAGTGTGCTGAGG - Intergenic
1178431594 21:32522656-32522678 GGGATTACAGGTGTGAGCTACGG - Intergenic
1178732589 21:35118236-35118258 GAAAATACCTGTGTGTGCTGAGG + Intronic
1179830394 21:43992842-43992864 GTAATTACAGCTGTGTGAGTTGG - Intergenic
1180986359 22:19906357-19906379 GGGATTACAGGTGTGAGCTACGG - Intronic
1182668615 22:31977157-31977179 GCAATTACAGGTGTGAGCCATGG + Intergenic
1182832654 22:33316155-33316177 GGAAGTACAGGTGGGTGCGGTGG + Exonic
1183564854 22:38606753-38606775 GTAATTACTGGTTTCTGGTGGGG + Intronic
1184568590 22:45308542-45308564 GTGGTTACATGTGTGGGCTGAGG + Intergenic
949258225 3:2076047-2076069 GAAATTATGCGTGTGTGCTGGGG + Intergenic
949971859 3:9414043-9414065 GGAATTACAGGTGTGAGCCACGG + Intronic
950370306 3:12523808-12523830 GGAATTACAGGCGTGAGCCGTGG + Intronic
950396189 3:12735995-12736017 GGAATTACAGGCGTGTGCCCTGG + Intronic
950902046 3:16506472-16506494 GTAAGTAGAGGTGTGAGCAGTGG + Intronic
951134261 3:19084882-19084904 GGGATTACAGGTGTGAGCTATGG - Intergenic
953273209 3:41467255-41467277 GGAATTACAGGTGTGAGCCACGG - Intronic
953996330 3:47522770-47522792 GTACTTACAAGGGTGTGCTCAGG - Intergenic
957911188 3:86621668-86621690 GTTTTTACAGGGGAGTGCTGAGG - Intergenic
957950200 3:87115340-87115362 ATAGTTACAAGTGTGGGCTGTGG + Intergenic
957960892 3:87250459-87250481 GTAACTACATCTGAGTGCTGTGG - Intronic
958108053 3:89103617-89103639 TTAAATACAGGTGTATGCTAGGG + Intergenic
958420484 3:93924937-93924959 GGAATTACAGGTGTGAGCCAAGG + Intronic
958455485 3:94325994-94326016 ATATTCACATGTGTGTGCTGAGG - Intergenic
964360038 3:155886089-155886111 GGGATTACAGGTGTGAGCTATGG + Intronic
964758422 3:160110242-160110264 GGGATTACAGGTGTGAGCCGTGG - Intergenic
964763566 3:160157240-160157262 GAAATCACAGGTGTGGGCAGTGG - Intergenic
964837477 3:160955279-160955301 GTGATTACAGGTGTGAGCTACGG + Intronic
966790189 3:183660785-183660807 GGTATTACAGGCGTGAGCTGCGG - Intronic
967064482 3:185902701-185902723 GGGATTACAGGTGTGAGCTACGG + Intergenic
967882057 3:194308381-194308403 GTAATTATAAGTGTGGGGTGGGG + Intergenic
968882574 4:3309080-3309102 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882586 4:3309133-3309155 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882598 4:3309186-3309208 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882610 4:3309239-3309261 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882622 4:3309292-3309314 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882698 4:3309558-3309580 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882753 4:3309770-3309792 GGAATGGCAGGTGTCTGCTGAGG + Intronic
968882858 4:3310140-3310162 GGAATGGCAGGTGTCTGCTGAGG + Intronic
969174932 4:5391228-5391250 GGAATTACAGGTGTGAGCCACGG + Intronic
969310589 4:6351032-6351054 GGGATTACAGGTGTGAGCTCTGG - Intronic
969391330 4:6893077-6893099 GGGATTACAGGTGTGAGCCGTGG - Intergenic
970399067 4:15700675-15700697 GTGATTACAGGTGTGAGCCACGG + Intronic
970485967 4:16525159-16525181 TTAAAGACAGCTGTGTGCTGGGG + Intronic
970969597 4:21966210-21966232 GAGATGACAGGTGTGTGTTGGGG - Intergenic
971289272 4:25321641-25321663 GGGATTACAGGTGTGTGCCACGG + Intronic
971340694 4:25766166-25766188 GGAATTACAGGTGTGAGCTACGG - Intronic
972293038 4:37708970-37708992 GGGATTACAGGTGTGAGCTACGG + Intergenic
972342376 4:38163424-38163446 GTGATTACAGGTGTGAGCCATGG + Intergenic
975097765 4:70477137-70477159 GGAATTACAGGTGTGAGCCACGG - Intronic
975126357 4:70786911-70786933 GGAATTACAGGTGTGAGCCATGG - Intronic
975549037 4:75591323-75591345 GGAATTACAGATGTGAGCTATGG - Intronic
975563469 4:75729064-75729086 GGAATTACAGGTGTGAGCCACGG + Intronic
975708501 4:77135205-77135227 GGGATTACAGGTATGAGCTGTGG + Intergenic
975775892 4:77786745-77786767 GTGATTACAGGTGTGAGCCAAGG + Intronic
977667849 4:99661604-99661626 GGGATTACAGGTGTGAGCCGTGG + Intergenic
978153797 4:105467122-105467144 GTCATTCCTGGTGTGTGTTGAGG + Intronic
978391553 4:108231597-108231619 GGGATTACAGGTGTGAGCTACGG + Intergenic
980057286 4:128090206-128090228 GGGATTACAGGTGTGTGCTATGG + Intronic
981761694 4:148201972-148201994 GTATTTGTAGGTGTCTGCTGTGG - Intronic
982105664 4:152009866-152009888 TTACTTACGAGTGTGTGCTGAGG + Intergenic
982246075 4:153352601-153352623 GGAATTACAGGTGTGAGCCGTGG - Intronic
982707987 4:158731360-158731382 GGGATTACAGGTGTGGGCCGTGG - Intergenic
983200413 4:164854913-164854935 GTAATAACAGCTGGGTGCGGTGG + Intergenic
983575960 4:169262394-169262416 GGGATTACAGGCGTGAGCTGCGG - Intronic
985001360 4:185487174-185487196 GCCATTACAGGTGTGAGCAGTGG - Intergenic
985077706 4:186233198-186233220 GTAATTACCGCTGGGTGCGGTGG - Intronic
985216828 4:187662376-187662398 GAAATTACAGTTGTCTGCTTGGG - Intergenic
986594042 5:9402131-9402153 GTAATTACATGAATGTTCTGTGG - Intronic
988364164 5:30274195-30274217 AGAATTACATCTGTGTGCTGAGG - Intergenic
989817037 5:45749224-45749246 GTACTTAAAGGTATGTACTGTGG + Intergenic
990734658 5:58846647-58846669 GGGATTACAGGTGTGAGCTATGG + Intronic
992007710 5:72494761-72494783 GTAATTAGAGGTGTTTGGTTTGG + Intronic
992851202 5:80810668-80810690 GTAATTACAGTAGTGTGATTTGG - Intronic
994926691 5:106125067-106125089 GGAATTACAGGTGTGAGCCATGG + Intergenic
996226893 5:121010334-121010356 GTAATTTGAGGTGTGAACTGTGG + Intergenic
997753984 5:136377391-136377413 GGGATTACAGGTGTGAGCCGTGG + Intronic
998331767 5:141333820-141333842 GATATTACAGGTGTGAGCTGTGG + Intronic
998628666 5:143874475-143874497 GTAATTTCAAGTGTGGGGTGAGG - Intergenic
1000309789 5:160031339-160031361 GGGATTACAGGTGTGAGCTAAGG - Intronic
1000635598 5:163640609-163640631 GTAGTTACAGGTGTGAGCCACGG - Intergenic
1000645539 5:163756574-163756596 GTAATGACAGCTCTGGGCTGTGG + Intergenic
1002424800 5:179168604-179168626 GTCATTCCTGTTGTGTGCTGGGG + Intronic
1002647703 5:180669162-180669184 GTTCTGCCAGGTGTGTGCTGTGG - Intergenic
1002701654 5:181128955-181128977 GGAATTACAGGTGTGAGCCAGGG - Intergenic
1002863872 6:1104036-1104058 GTAATTACACGTGGCTTCTGAGG - Intergenic
1003012968 6:2443303-2443325 GGGATTACAGGTGTGAGCTATGG + Intergenic
1004181761 6:13386651-13386673 GAAAGTAAAGGTGTGTGTTGAGG - Intronic
1004639689 6:17503336-17503358 GGTATTACAGGTGTGAGCTATGG - Intronic
1004926837 6:20424055-20424077 GTAATTTCGGCTGTGTGCAGTGG - Intronic
1006080631 6:31563876-31563898 GGGATTACAGGTGTGAGCTACGG + Intergenic
1006297334 6:33175693-33175715 GGAAGGACAGGTGAGTGCTGGGG + Intronic
1006426395 6:33965779-33965801 GGAATTACAGGTGTGAGCCACGG + Intergenic
1006631663 6:35434642-35434664 GGGATTACAGGTGTGAGCTGTGG + Intergenic
1006732462 6:36246470-36246492 GGAATTACAGGTGTGAGCCATGG + Intronic
1006784479 6:36656542-36656564 ATAAATCCAGGTGTGGGCTGAGG - Intergenic
1006974851 6:38090121-38090143 GGGATTACAGGTGTGCTCTGTGG + Intronic
1007121694 6:39387558-39387580 GGAACTTCAGGAGTGTGCTGAGG + Intronic
1007380411 6:41486828-41486850 GCAAGTGCATGTGTGTGCTGGGG + Intergenic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009279027 6:61722977-61722999 GGAATTACAGGCATGAGCTGCGG + Intronic
1009442635 6:63699857-63699879 GGCATTACAGGCGTGAGCTGCGG + Intronic
1010158994 6:72829871-72829893 GTAATTCCAAATGTGGGCTGAGG + Intronic
1010756609 6:79672653-79672675 GTCATTTCAGGTGTCTTCTGGGG + Intronic
1011088947 6:83573089-83573111 GTAATTCCAAATGTGGGCTGAGG + Intronic
1012701441 6:102461660-102461682 GGAATTACAGGTGTGAGCCATGG - Intergenic
1013664832 6:112336999-112337021 TTAATTACAGTTGTATGCTTTGG + Intergenic
1015201332 6:130584739-130584761 GTCAGTACGGGTGTGGGCTGTGG - Intergenic
1016285638 6:142469655-142469677 TTTATTACAGGTGCGTCCTGTGG + Intergenic
1016778666 6:147934555-147934577 GTAATGACAGGTGGGTGACGTGG + Intergenic
1017866149 6:158445082-158445104 GGGATTACAGGTGTGAGCCGTGG + Intronic
1018159046 6:161019677-161019699 GGGATTACAGGCGTGAGCTGTGG + Intronic
1019843105 7:3469150-3469172 GGGATTACAGGTGTGTCCTTTGG - Intronic
1020389436 7:7642427-7642449 GGAATTACAGGTGTGAGCCTTGG + Intronic
1020672862 7:11140143-11140165 GTATGTACAGGTGTGTGCAGGGG - Intronic
1021008400 7:15429628-15429650 GTCATCACAGGTGTATGGTGTGG + Intronic
1022937760 7:35197791-35197813 GTAATGAAATATGTGTGCTGGGG - Intergenic
1025773904 7:64541431-64541453 GTCATTACAGGTGTGAGCCATGG - Intronic
1025998639 7:66544241-66544263 GGAATTACAGGTGTGAGCCACGG - Intergenic
1026116347 7:67498984-67499006 GGAATTACAGGTGTGAGCCAAGG - Intergenic
1026612359 7:71871474-71871496 GGGATTACAGGAGTGAGCTGTGG - Intronic
1027973268 7:85114550-85114572 GGAAGTATGGGTGTGTGCTGAGG + Intronic
1028198863 7:87937226-87937248 GGGATTACAGGTGTGAGTTGTGG + Intronic
1028478319 7:91275769-91275791 ATTATTACAGGAGTGTTCTGAGG + Intergenic
1029355947 7:100051563-100051585 GGAATTACAGGTGTGAGCCACGG + Intronic
1029389089 7:100263001-100263023 GGGATTACAGGTGTGAGCTACGG - Intronic
1029416420 7:100446020-100446042 GGGATTACAGGTGTGAGCTATGG - Intergenic
1030008833 7:105145275-105145297 GTACTTACAGGTTTCTGCTGTGG + Exonic
1031022247 7:116640822-116640844 GGGATTACAGATGTGTGCTATGG - Intergenic
1032393470 7:131572125-131572147 GGGATTACAGGTGTGAGCTACGG + Intergenic
1032929305 7:136647978-136648000 GTATTTACAAGAGTGTGGTGGGG + Intergenic
1035729603 8:1844794-1844816 GGCATTACAGGTGTGAGCTGAGG - Intronic
1036146788 8:6261457-6261479 GGGATTACAGGCGTGAGCTGTGG - Intergenic
1036557484 8:9872973-9872995 GGAATTACAGGCGTGAGCTATGG + Intergenic
1038147228 8:24909576-24909598 GAAATTTCATGTGTGTGGTGGGG - Intergenic
1038713400 8:29970390-29970412 GGAATTACAGGTGTGGGCTATGG - Intergenic
1038823794 8:30978518-30978540 GTAGTCACAGGTGTGAGCTGAGG + Intergenic
1039128305 8:34230048-34230070 GGGATTACAGGTGTGAGATGTGG + Intergenic
1041099946 8:54386003-54386025 GGGATTACAGGTGTGTGCCGTGG + Intergenic
1041231120 8:55752999-55753021 GGAATTACAGGTGTGAGCCATGG + Intronic
1041487989 8:58399869-58399891 GTAAGCACTGGTGTGTGCAGGGG + Intergenic
1041718571 8:60954558-60954580 GACATTACAGGTGTGAGCTGAGG + Intergenic
1044439867 8:92210198-92210220 GGGATTACAGGTGTGAGCTATGG + Intergenic
1045139119 8:99259760-99259782 GTAAGTACAAGTATTTGCTGTGG + Intronic
1046408873 8:113812700-113812722 GAAATTACAGGTGTGAACTGTGG + Intergenic
1046442167 8:114271493-114271515 GGAATTACAGGTGTGAGCCAGGG - Intergenic
1047496933 8:125415234-125415256 GGGATTACAGGTGTGAGCAGTGG + Intergenic
1048339331 8:133526621-133526643 GTAATTACAGGGTTTTGCAGTGG - Intronic
1048422748 8:134293640-134293662 GTAATTATAGTAGTTTGCTGGGG - Intergenic
1049128149 8:140810836-140810858 GTAAGCATAGGTGTTTGCTGTGG - Intronic
1051655217 9:19374765-19374787 GGAACTACAGGTGTGCACTGCGG - Intergenic
1054806017 9:69396365-69396387 GGAATTACAGGTGTGAGCCATGG - Intergenic
1054915692 9:70493563-70493585 GGGATTACACGTGTGTGCTACGG - Intergenic
1055095254 9:72406599-72406621 GGGATTACAGGTGTGAGCTATGG + Intergenic
1055393456 9:75848033-75848055 GGGATTACAGGTGTGAGCTATGG + Intergenic
1056214544 9:84394830-84394852 GGGATTACAGGTGTGAGCTGAGG + Intergenic
1056321552 9:85440074-85440096 GCAGTTACAGATGTTTGCTGGGG - Intergenic
1056487000 9:87069130-87069152 CTACTTACAGGTTTGTGGTGAGG - Intergenic
1056930541 9:90872591-90872613 ATGATTACAGGACTGTGCTGTGG - Intronic
1058006045 9:99915826-99915848 GGGATTACAGGTGTGAGCCGTGG + Intronic
1058599349 9:106652726-106652748 GGGATTACAGGTGTGAGCTATGG - Intergenic
1059347492 9:113639550-113639572 GGGATTACAGGTGTGAGCCGCGG - Intergenic
1060831595 9:126721125-126721147 GCAATTACAGGTGTGAGCCATGG - Intergenic
1061173207 9:128974494-128974516 GGGATTACAGGTGTGAGCTATGG + Intronic
1061605505 9:131707217-131707239 GTAAATACCGGTGTCTGCTAAGG + Intronic
1061736895 9:132667649-132667671 GTGATGACAGGTGTCTGCGGTGG - Intronic
1187075661 X:15931834-15931856 GGAATTACAGGCGTGCACTGTGG + Intergenic
1190093667 X:47462013-47462035 GTTTTTACAGCTGGGTGCTGTGG - Intronic
1193833387 X:86314244-86314266 GTAATTAAATGTGTGAGCTAAGG - Intronic
1193977085 X:88134379-88134401 GGAATTACAGGTGTGAGCCACGG - Intergenic
1194678180 X:96818247-96818269 GGGATTACAGGTGTGAGCCGCGG + Intronic
1194795089 X:98201290-98201312 GGGATTACAGGTATGAGCTGTGG + Intergenic
1195305325 X:103576491-103576513 GGGATTACAGGCGTGAGCTGCGG - Intronic
1196203005 X:112907487-112907509 GGGATTACAGGTGTGAGCTACGG - Intergenic
1196852259 X:119948588-119948610 GAACTTGCAGGTGTGTTCTGAGG + Intergenic
1197237608 X:124085516-124085538 GGGATTACAGGTGTGAGCCGCGG - Intronic
1197704911 X:129627952-129627974 GGAATTACAGGTGTGAGCCATGG - Intergenic
1199892581 X:152101701-152101723 GGAATTACAGGTGTGAGCCATGG - Intergenic
1200160978 X:154009004-154009026 GGGATTACAGGTGTGAGCCGTGG - Intergenic
1200952011 Y:8906613-8906635 GGAATTACAGGTGTGAGCCACGG + Intergenic