ID: 1170914142

View in Genome Browser
Species Human (GRCh38)
Location 20:20606149-20606171
Sequence CTGTGAAAATGGAAGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 817
Summary {0: 1, 1: 1, 2: 6, 3: 84, 4: 725}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170914142 Original CRISPR CTGTGAAAATGGAAGGAAAA GGG (reversed) Intronic
900271652 1:1793162-1793184 CTGTGAACATGGAGGAAATAAGG - Intronic
900893542 1:5466867-5466889 CAGAGAAGATGGAAGGCAAAAGG - Intergenic
901313239 1:8286053-8286075 CTTTGAAAATTCAAAGAAAATGG + Intergenic
901352100 1:8606570-8606592 TTCTTAAGATGGAAGGAAAAAGG - Intronic
901763568 1:11486167-11486189 GTGTCTACATGGAAGGAAAAGGG - Intronic
903763486 1:25716229-25716251 CTATGGAAATTGAAGGAGAATGG + Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
905523017 1:38614638-38614660 CAGTGAAATTGGCAGGCAAAAGG - Intergenic
905788215 1:40774777-40774799 AAGTGAAAAGGGAAGTAAAAGGG - Intergenic
906106758 1:43299410-43299432 CTTTGAATCTGGAATGAAAAAGG - Intergenic
906361004 1:45158942-45158964 AGGTGAAATTGGAAAGAAAAAGG + Intronic
906558511 1:46735376-46735398 GAGTGGAAATGGAAGGACAAGGG + Intergenic
906562586 1:46770136-46770158 CTTGGCAAATGGAAGGAGAAGGG - Intronic
907115050 1:51960721-51960743 CATTGAAAATGGGAGTAAAAGGG + Intronic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907764654 1:57397120-57397142 CTGAGAAAATTAAGGGAAAAGGG - Intronic
908486572 1:64600089-64600111 CTGTGAAATGGGTAGGAGAAAGG + Intronic
908734173 1:67258358-67258380 ATGAGAAAATGGAGGGAGAAAGG + Intronic
908951229 1:69566055-69566077 CTCTGAAAATGGCAAGGAAATGG - Intergenic
909117982 1:71564015-71564037 GCTTGGAAATGGAAGGAAAAAGG + Intronic
909440748 1:75692939-75692961 CTGAGAATAGTGAAGGAAAAAGG + Intergenic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
909864326 1:80648073-80648095 TGGTGAAAAAGGAAGGAGAAAGG - Intergenic
910481194 1:87660249-87660271 CAGTCATAATGGAAGGCAAAGGG + Intergenic
910874351 1:91864280-91864302 CTGTGGAAAAGAAAGGCAAATGG + Intronic
911299905 1:96159135-96159157 CTATGAAAATGGAGGAAAAATGG + Intergenic
911397290 1:97326472-97326494 ATGAGAAGATGGAAGGAAAAGGG + Intronic
911523989 1:98962564-98962586 CAGAGAAAATGGAAGCACAAAGG - Intronic
911665639 1:100548079-100548101 CTGAGAAAATCTAAGCAAAATGG - Intergenic
911681770 1:100724900-100724922 ATGTGAAAAAGGAATGATAAAGG + Intronic
911696912 1:100899373-100899395 CTTAGAAATTGGGAGGAAAATGG + Intronic
911844002 1:102725505-102725527 CTCTGAAAATGGAGGTATAATGG - Intergenic
911890236 1:103359639-103359661 GTGTGAAAATGAGAAGAAAAAGG + Intergenic
912111605 1:106349176-106349198 GTGTGAAAATGGAAAAAAAGAGG + Intergenic
913365975 1:118039347-118039369 TTGTGAAAAAGGAAGAGAAAGGG - Exonic
913558220 1:119991251-119991273 GTCTGAAAATGGAAAGATAAGGG - Intronic
913639622 1:120799201-120799223 GTCTGAAAATGGAAAGATAAGGG + Intergenic
914278826 1:146150742-146150764 GTCTGAAAATGGAAAGATAAGGG - Intronic
914539873 1:148601684-148601706 GTCTGAAAATGGAAAGATAAGGG - Intronic
914626773 1:149469536-149469558 GTCTGAAAATGGAAAGATAAGGG + Intergenic
914892309 1:151637104-151637126 ATGGTAAAATGGAAAGAAAATGG - Intronic
915670506 1:157485340-157485362 CTGAGAAAAAGGAAAGAATAGGG - Intergenic
916141633 1:161705063-161705085 CTGTCAATATGGAAGGCAAGGGG - Intergenic
916244509 1:162673915-162673937 GTGTAAAAAGGGAAGAAAAAGGG - Intronic
916319184 1:163483882-163483904 CTGTGAATATGTTAGGTAAATGG - Intergenic
916655239 1:166869498-166869520 TTGTGAGAATGGACTGAAAAAGG + Exonic
917412757 1:174776691-174776713 CCATTAAAATGGAGGGAAAAAGG - Intronic
917479474 1:175399321-175399343 CTTTGAAGAAGGAAGCAAAAAGG - Intronic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
917874700 1:179275645-179275667 CTGGGAAAATGGGTGGGAAAGGG - Intergenic
918124988 1:181575363-181575385 CTTGAAAAAGGGAAGGAAAAAGG - Intronic
918827655 1:189346454-189346476 CTTTGAAGATGGAAGAAGAAGGG - Intergenic
919509453 1:198442973-198442995 CACTAAAAATGGAAGAAAAAAGG + Intergenic
920446633 1:206023112-206023134 CTGAGAAAATGGGACGAGAATGG - Intronic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
920894555 1:210032498-210032520 TTCTAAAAATGGAAGTAAAAAGG + Intronic
921293373 1:213679274-213679296 CTGTGAGTATGGAAGGACATAGG - Intergenic
921418874 1:214923026-214923048 CTGTGGAAATACAAGAAAAAAGG + Intergenic
921888487 1:220329894-220329916 CTGGGAAGAGGGAAGGAGAAGGG + Intergenic
921997978 1:221442376-221442398 CTGAGAAAGTGGAAAGGAAAAGG + Intergenic
922248018 1:223819338-223819360 CTATGAAAATGAGAAGAAAATGG + Intronic
922948727 1:229539673-229539695 CTGTGACAGTTGAATGAAAAAGG - Intronic
923171210 1:231419637-231419659 ATATTAAACTGGAAGGAAAAGGG - Intronic
923227614 1:231953792-231953814 CTTTGAAAATGGAAGCCAAAGGG - Intronic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923429433 1:233905796-233905818 CTGTGACAATGGTAAGAAGATGG - Intronic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
923886917 1:238167896-238167918 CTTAGAAAATGAAATGAAAATGG + Intergenic
924172701 1:241357800-241357822 CTGTGAAAACCGCAGGCAAACGG - Intergenic
924598236 1:245465555-245465577 CTGTGTAAATGGGAAGGAAACGG - Intronic
924853110 1:247850645-247850667 CTGAGAAAATGGAGATAAAAGGG + Intergenic
1062958659 10:1557090-1557112 CTGAGGCAATGGAAGGAAAGAGG - Intronic
1063099860 10:2940714-2940736 CGGTCAAAATGGAAGAACAAGGG - Intergenic
1063238609 10:4145315-4145337 CTGTAAGAAAGGGAGGAAAATGG - Intergenic
1063426835 10:5956920-5956942 AAATGAAATTGGAAGGAAAATGG - Intronic
1064547947 10:16469495-16469517 CTGTGAGAATGAAGGGGAAAAGG + Intronic
1064784676 10:18880761-18880783 CTGTCAAAAGGGGAGGGAAAGGG - Intergenic
1065132913 10:22640704-22640726 CTGGGAAAATGGAATCTAAACGG + Intronic
1065179906 10:23114387-23114409 CTGTGAAAATGTGAGGGAAGTGG + Intronic
1065225858 10:23543260-23543282 ATGAGAAAAAGGAAGCAAAATGG - Intergenic
1065847759 10:29760518-29760540 CTTTGCAAATGGAAGGGGAAAGG + Intergenic
1066553291 10:36583216-36583238 CTGTGAAGAGGGAAGAAAATTGG - Intergenic
1067724573 10:48760284-48760306 CAGTGAAAATAGAAAGAAACTGG + Intronic
1068297006 10:55084122-55084144 CTGGGAAAAAGGAAGGAAACTGG + Intronic
1068800941 10:61139098-61139120 CTGTGAAAGTTAAAGGAACATGG - Intergenic
1069441755 10:68434993-68435015 CTGTGAAAGAGGAGGGAATATGG + Intronic
1070199151 10:74186282-74186304 CTGTGGAAAGGAAAGGAGAAGGG - Intronic
1070233407 10:74596099-74596121 TTGTGAATGTGGTAGGAAAATGG + Intronic
1070276711 10:75014085-75014107 ATGAGAAAATGAAAGTAAAAAGG - Intronic
1070694152 10:78549415-78549437 CTGAGAAACTGGAACCAAAATGG - Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1071810255 10:89172115-89172137 CTGAGAACATGGAAGGATCATGG - Intergenic
1073326905 10:102648455-102648477 CTCTGAAAATGCAAGGAACAGGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073610278 10:104936359-104936381 CTGTGAAAATGCTAGAAAAGTGG + Intronic
1073898770 10:108194414-108194436 CTGAGAAAATGCAGAGAAAAGGG + Intergenic
1074325938 10:112450833-112450855 CTGTGGGAAAGTAAGGAAAAGGG + Intronic
1074526553 10:114268080-114268102 CTTTTAACATGGAAGGAAACTGG + Intronic
1074671479 10:115796936-115796958 TTATGAAAATGGAAGAAAGAAGG - Intronic
1074835409 10:117287648-117287670 ATCTGAACAGGGAAGGAAAATGG - Intronic
1075239250 10:120763114-120763136 TTGAGAAACTGGCAGGAAAAAGG + Intergenic
1075239299 10:120763676-120763698 CTGTGAAAATAGAAGGCAAAAGG + Intergenic
1075274693 10:121082760-121082782 CTGTGAAATGGGGATGAAAATGG - Intergenic
1075428440 10:122361046-122361068 CTGGGAAGAGGGAGGGAAAATGG + Intergenic
1076565581 10:131396735-131396757 TTGTGAAAATGATGGGAAAAAGG - Intergenic
1076640317 10:131911530-131911552 CAGGGAAAAGGGAAAGAAAAAGG - Intronic
1077471584 11:2764032-2764054 ATGTTAAAAAGGTAGGAAAAGGG - Intronic
1077635258 11:3837811-3837833 CTGGGAACTTGGAAGCAAAAAGG - Intronic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1077838151 11:5943184-5943206 TAGAGAAAATAGAAGGAAAAAGG + Intergenic
1077872330 11:6272321-6272343 CTGTGAATGGGGATGGAAAATGG + Intergenic
1078081083 11:8205195-8205217 CTTAGCAAATGGAAGGAGAAGGG - Intergenic
1078151088 11:8760194-8760216 CTGAGAAGATAGAAGGAAAGGGG - Intronic
1078406418 11:11074039-11074061 CTCTGAGAGTGAAAGGAAAATGG + Intergenic
1078420045 11:11203342-11203364 ATGTGAAAATGAGAGGAGAAGGG - Intergenic
1078573392 11:12478420-12478442 ATGTGAAAATGTAAGGACAATGG + Intronic
1078827992 11:14950231-14950253 CTGAGAAACTAGAAGGACAAAGG - Intronic
1078848722 11:15144588-15144610 CTGTCAACATGGAAGGGACAGGG - Intronic
1079658555 11:23012605-23012627 CCTTAAAAAAGGAAGGAAAAGGG - Intergenic
1079689987 11:23406181-23406203 CTATGGAAATGGAAAGAAAGAGG - Intergenic
1080632828 11:34094880-34094902 CTCAAAAAATGAAAGGAAAAAGG - Intronic
1080697255 11:34613269-34613291 CTGCCAAACTGGAAAGAAAATGG + Intergenic
1080902538 11:36509883-36509905 CTGTGAAAAGCGAAGGGACAGGG + Intronic
1080930377 11:36803940-36803962 CTGTGAAAATAAAATGATAATGG + Intergenic
1080974284 11:37318099-37318121 CTAAGAAAAAGTAAGGAAAATGG - Intergenic
1080982063 11:37419862-37419884 CTGTGGAAATGGCAGCAACAAGG + Intergenic
1081338341 11:41896028-41896050 GCGAGAAAAAGGAAGGAAAACGG + Intergenic
1081622087 11:44624564-44624586 CTGGTAAAATGGAAGGAGAGAGG + Intergenic
1082071580 11:47943834-47943856 CTGTGAAAAAGCAAGAATAATGG - Intergenic
1083973569 11:66099045-66099067 CATTGAAAAGGGAAGGGAAAAGG - Intronic
1084323934 11:68388328-68388350 CTGTGAAAAAGGAAGGGATGGGG + Intronic
1087221876 11:95555094-95555116 CTGTGAAGAAGGAAGTAAAATGG - Intergenic
1087511268 11:99097843-99097865 CTGTATAAATTGAAGGTAAAAGG + Intronic
1088166769 11:106948047-106948069 ATGTGTAAATGGAATGGAAATGG + Intronic
1088174715 11:107039313-107039335 CTGTAAAAATGGAAGTCAGAGGG - Intergenic
1088358918 11:108970839-108970861 CTGGGAAAAAGCAAGTAAAAAGG + Intergenic
1088430921 11:109757862-109757884 TTGGGAGAATGGAAGGAAAATGG - Intergenic
1088446640 11:109937478-109937500 GTTCTAAAATGGAAGGAAAATGG + Intergenic
1089331983 11:117696075-117696097 CGGTGAAAGCTGAAGGAAAAGGG + Intronic
1089778591 11:120856989-120857011 CTGGGAACATGGAGGGATAAGGG - Intronic
1090569701 11:128032683-128032705 CTGGGAAAATTGAAGAACAAGGG + Intergenic
1090619964 11:128551658-128551680 CTGAGAAAATACATGGAAAAGGG - Intronic
1091204782 11:133812729-133812751 GTGTAAAAACAGAAGGAAAATGG + Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092034672 12:5322603-5322625 CTGGGAAAAGGGGAGGAAAGTGG + Intergenic
1092107687 12:5934288-5934310 CTGTGCAAAAGGAAGATAAATGG + Intronic
1092268133 12:6999391-6999413 CTGTGAGAAAGAAAGAAAAAGGG + Intronic
1092482105 12:8869016-8869038 CTGTGGAAAAGGTAGGAAAAGGG - Intronic
1092949961 12:13492626-13492648 CTTTGGAAATGGCAGGAAGAAGG + Intergenic
1094269087 12:28591124-28591146 CTATCAAAATGGCAGGAAGAGGG - Intergenic
1095604274 12:44048123-44048145 ATTTGAAAATGTAAAGAAAATGG - Intronic
1095799881 12:46260798-46260820 CTGTGAAACTGTAAGGAATAAGG - Intronic
1096909054 12:54963686-54963708 CTGTGAAAATCTAAAGGAAAAGG + Intronic
1097083389 12:56449477-56449499 TGGTGAAGAAGGAAGGAAAAGGG + Intergenic
1097108203 12:56637586-56637608 TTGTTAAAATGGAATCAAAAGGG - Intergenic
1097326155 12:58278735-58278757 CTATGAAAAGTAAAGGAAAATGG - Intergenic
1097559375 12:61183587-61183609 CTTTGACAATGCAAGGTAAATGG + Intergenic
1097835619 12:64270061-64270083 CTGTGAAAATGGTAGGATTTTGG - Intronic
1098662278 12:73110738-73110760 CTGTCCATATGGAATGAAAAGGG + Intergenic
1098870134 12:75808332-75808354 CTTCGAAGATGGAAGGAATATGG - Intergenic
1098978171 12:76926424-76926446 CGGGGTAAATGGAAGAAAAAGGG + Intergenic
1099815777 12:87645652-87645674 CTGGGAAAATCAAAGGGAAAAGG + Intergenic
1100631276 12:96391737-96391759 TAGTGAAAATGGAGAGAAAAGGG - Intronic
1101213175 12:102555005-102555027 CTGAGACAATGGAAGGAGAAAGG - Intergenic
1101588991 12:106109911-106109933 CTCTGAAAAAGAAAGGAAGAAGG - Intronic
1102244131 12:111344337-111344359 CTGTGAAACAGGAAGGAACAAGG + Intronic
1102510134 12:113409623-113409645 CTGTGAAATGGGAATGATAATGG + Intronic
1102796667 12:115694993-115695015 ATGGGAAAGTGGAAGGAACATGG - Intergenic
1103947109 12:124532776-124532798 CTTTGAAGTTGGAAGGAAAGCGG - Intronic
1104838255 12:131806561-131806583 CTCACAGAATGGAAGGAAAACGG + Intergenic
1105818489 13:24058413-24058435 CTGAGAAAATTGAGGCAAAATGG + Intronic
1105906703 13:24818209-24818231 CTATGACAATGAAAGGAAACTGG - Intronic
1105995526 13:25667792-25667814 CAGTGAAAAGGGAATCAAAAGGG - Intronic
1106165856 13:27245625-27245647 CTGTGAGGCTGGAAGCAAAATGG - Intergenic
1106363188 13:29051170-29051192 CTGGGAGGATGGAAGGAGAAAGG + Intronic
1106546781 13:30737687-30737709 CTGTGACAATGGAGGGACAGAGG - Intronic
1107010287 13:35663922-35663944 CTGAGAAAATGCAAATAAAACGG + Intronic
1107264958 13:38542591-38542613 GTGTGAATATAGAGGGAAAATGG - Intergenic
1107560657 13:41554281-41554303 TTCTGAGAATGAAAGGAAAAAGG - Intergenic
1107669631 13:42731507-42731529 GTGTGAATGAGGAAGGAAAAAGG + Intergenic
1108165693 13:47690622-47690644 TTGTCAAAATGGATGGATAATGG + Intergenic
1108224014 13:48269130-48269152 CTGTGCAACTGGAAAAAAAAAGG - Exonic
1108251929 13:48576344-48576366 ATATCAAAATGGAAGGTAAAGGG + Intergenic
1108258689 13:48635163-48635185 ATTTGAAACTGAAAGGAAAAAGG + Intergenic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108568776 13:51729007-51729029 CTGGGAAAATGGAAGGACCGCGG - Intronic
1109704358 13:66070590-66070612 TTGTAAAAATGGAGGGAAAATGG + Intergenic
1109916593 13:68995242-68995264 TTCTTAAGATGGAAGGAAAAAGG - Intergenic
1110397641 13:75049973-75049995 ATGTGCCAGTGGAAGGAAAAGGG + Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1111607797 13:90563482-90563504 ATGTAAACATGGAAGGAAAATGG - Intergenic
1111670384 13:91322206-91322228 CAGTGCAAGTGGAAAGAAAAAGG + Intergenic
1111704130 13:91726800-91726822 CTGTGCAGATGGAGGAAAAAGGG - Intronic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1112639443 13:101256306-101256328 ATGTGGAAATGGGAGGAGAATGG - Intronic
1112722072 13:102256954-102256976 ATGTGAAAAGTGAAGGAAAATGG - Intronic
1114683709 14:24507919-24507941 CAGAGCAAGTGGAAGGAAAAGGG - Intronic
1114822471 14:26038208-26038230 CAGAGAAAATGGAAAGAGAAAGG - Intergenic
1114887287 14:26869486-26869508 CAGTCACAATGGAAGGAAACTGG + Intergenic
1115002768 14:28441820-28441842 CTGTAAAAATGAAAGAAAATGGG - Intergenic
1115047731 14:29017108-29017130 CTGTGAAAATGTGTGGTAAAAGG + Intergenic
1115091159 14:29577548-29577570 CTGTTAGAGTGGAAGGAGAAGGG - Intronic
1115159939 14:30382480-30382502 CTTTAAAAATGGAAATAAAATGG + Intergenic
1115528990 14:34308746-34308768 CTGTGTGAAGGAAAGGAAAAAGG - Intronic
1115785250 14:36818207-36818229 CAGAGACAATGGAAGGGAAAGGG + Intronic
1115892241 14:38044311-38044333 CTGTGAAGGTGAAAGGAAAATGG + Intergenic
1116595853 14:46844277-46844299 CTGTTAAAATGGCTGGCAAAAGG + Intronic
1116676269 14:47910049-47910071 CAGTGAAATAGGAAGAAAAATGG - Intergenic
1116868837 14:50052826-50052848 CACTGAAAATGGAAGAAAGATGG - Intergenic
1117214423 14:53535900-53535922 TTTGGAAAATGAAAGGAAAATGG - Intergenic
1117370024 14:55069629-55069651 TTGTCAAAAAGGAAGAAAAAAGG + Exonic
1117848247 14:59936862-59936884 CAGTAAAAATGGAATGGAAAAGG - Intronic
1117925675 14:60776758-60776780 TTGTGATCATGGCAGGAAAAAGG + Intronic
1117974516 14:61283899-61283921 GTGTGGAAAGGGAAGGAGAAAGG + Intronic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1118878725 14:69808295-69808317 CTGTCAAAATTAAAGCAAAATGG + Intergenic
1119552180 14:75522952-75522974 CTTGGAAAATGGAGAGAAAAAGG - Intronic
1119595749 14:75931851-75931873 CTGTTACAATGGAAGGCAAAGGG - Intronic
1120089462 14:80314160-80314182 GTGTGAAAATTGAGAGAAAAGGG - Intronic
1120147292 14:80992445-80992467 CAATGAAAATGGAAAGAAGAAGG - Intronic
1120786444 14:88541885-88541907 CTGTGACAAGGGGAGAAAAAGGG + Intronic
1121288464 14:92755162-92755184 CTGTGCAACTGGAAGGGGAAAGG - Intergenic
1121583932 14:95050064-95050086 GTGGAAAAATGGAAGGAAAAGGG + Intergenic
1121967278 14:98322136-98322158 GAGAGGAAATGGAAGGAAAAGGG - Intergenic
1122095064 14:99364440-99364462 CTCTGCAAGTTGAAGGAAAAGGG + Intergenic
1122111375 14:99505517-99505539 CTCTGGAAATAAAAGGAAAAAGG - Exonic
1122251647 14:100444210-100444232 CCGTGAAAATGGAAGGAAATTGG + Intronic
1122510226 14:102260581-102260603 ATGTTAAAATGTAAGGAGAATGG - Intronic
1122546003 14:102523262-102523284 CTGTCAAAAAGAAAGGAAAGAGG + Intergenic
1123199560 14:106649598-106649620 CTGTGAATATTGTAGGAGAAGGG - Intergenic
1123221542 14:106861735-106861757 CTGTGAATATTGTAGGAAAAGGG - Intergenic
1202831181 14_GL000009v2_random:32989-33011 CATTGAAAATGAGAGGAAAAAGG + Intergenic
1123692282 15:22848240-22848262 AAGTGAAAATGCAAGGAAAATGG - Intronic
1124012285 15:25848659-25848681 CTGTAAAAGTGGAAGAAAAGCGG - Intronic
1125764286 15:42122924-42122946 CTGTGAATGAGGAAGGAAAGGGG - Intergenic
1126840801 15:52715582-52715604 CTGTGACGAAAGAAGGAAAAGGG + Intergenic
1126856160 15:52841401-52841423 CAGGGAAAGAGGAAGGAAAAGGG - Intergenic
1127039629 15:54960382-54960404 AAGTGAAAATGGGATGAAAATGG - Intergenic
1127364686 15:58276929-58276951 CTGTGAAAATGAAATCAAAGTGG + Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1127731982 15:61810108-61810130 TATTGAAAATGGAAAGAAAAAGG + Intergenic
1128010952 15:64295488-64295510 CTCTGAAAATGGAAGTGAGATGG - Intronic
1129271841 15:74423067-74423089 CTCTGAAAATGGCAGGAATGTGG + Intronic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129980792 15:79868236-79868258 CATTGAAATTGGAAAGAAAAAGG - Intronic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130199859 15:81814992-81815014 CTGTGAAAAAAGAAAAAAAAGGG + Intergenic
1130563918 15:84979411-84979433 CTGTGACAGTGGACTGAAAATGG - Intergenic
1130602629 15:85287069-85287091 CAGTGAAAATGGCAAGAAAGAGG - Intergenic
1130850109 15:87784582-87784604 CTGTGCCCATGGAAGGAAAGTGG - Intergenic
1131263071 15:90899414-90899436 GTGTGAAGATGGAGGGGAAAAGG + Intergenic
1131323040 15:91414586-91414608 TGGTGAAAATGGGAAGAAAAGGG - Intergenic
1131400739 15:92123753-92123775 CTGTGCAAATGGAATCAAAATGG - Intronic
1131493224 15:92880991-92881013 GGGGAAAAATGGAAGGAAAAGGG + Intergenic
1131783691 15:95887940-95887962 CTTTGAAAATGGGAGAGAAAAGG - Intergenic
1131858291 15:96623355-96623377 CTGTCAAAATTGAGAGAAAAAGG + Intergenic
1132037571 15:98499502-98499524 CTGGGAAAAGAGAAGGGAAAAGG - Intronic
1133665833 16:7966841-7966863 CTGAGAAAAAGTAAGGAACACGG - Intergenic
1134102789 16:11464225-11464247 CTGTAAAAAGGGAAGGAGAAGGG - Intronic
1135580126 16:23618399-23618421 CTGAGAGATGGGAAGGAAAAAGG + Intronic
1135591769 16:23710306-23710328 CTGAGAAATTGGAAGGAATTTGG - Intronic
1137956107 16:52831531-52831553 TTGTAAAAATGGAAGGAGGAAGG + Intergenic
1138158705 16:54731905-54731927 CTGTGGCAATGGGATGAAAAAGG - Intergenic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1138424930 16:56925235-56925257 ATGTGGAAATGAAAGGAACATGG - Intergenic
1138718678 16:59053332-59053354 CTGGGAAACTGGATGGAAAGAGG + Intergenic
1138753873 16:59458444-59458466 CTTTTGGAATGGAAGGAAAAAGG - Intergenic
1138918174 16:61493813-61493835 GTATGAAAATGGAAGGTAATAGG - Intergenic
1139620719 16:68139505-68139527 ATGTGAAAATGGAAAGTAGAAGG + Intronic
1139819085 16:69705614-69705636 ATGTTTAAATGAAAGGAAAAAGG + Intergenic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1140614026 16:76637821-76637843 TGGTGTAAATGGAAGGACAAAGG - Intergenic
1140787880 16:78361441-78361463 ATGTGAAAGTTTAAGGAAAACGG - Intronic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141477007 16:84280794-84280816 CTGTGAAAGCAGAAGGGAAAAGG - Intergenic
1143370009 17:6433748-6433770 ATGTGAAGATGGAGGGAACAAGG - Intronic
1144558216 17:16300344-16300366 CTGTGAAAATGCTTGGTAAAAGG - Intronic
1144827236 17:18112367-18112389 ATGTGAAAATGGAAAAAAAAAGG - Intronic
1146394307 17:32450683-32450705 GTATGAAAGTGGAAGGAAACAGG + Intronic
1146409140 17:32566984-32567006 CTGTGAACATGGATGGAGCACGG - Intronic
1146560575 17:33865331-33865353 TTGTGAAAAAGGAAGGAAACAGG - Intronic
1146621165 17:34399004-34399026 CTGTGACAATGGGAGAAAAGGGG + Intergenic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147156977 17:38548933-38548955 CAGAGAACATGGAAGGAAAGAGG - Intronic
1147318105 17:39630436-39630458 CTGTGCAAATGGGATGCAAATGG - Intronic
1147533869 17:41305434-41305456 CTGTGAAGATGACTGGAAAATGG - Intergenic
1148127147 17:45242715-45242737 GTGGGAAAGTGGAAGGAAAGAGG - Intronic
1148357801 17:46987493-46987515 TTTTGAAAAAGAAAGGAAAATGG + Intronic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1148552435 17:48558537-48558559 CTCTGAGAATGGAAGAAAAAAGG - Intronic
1149968832 17:61195358-61195380 CTGGGAAAATAAAAGGAAATAGG - Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151183832 17:72349379-72349401 TTGTGAGAATGCAAGGGAAAGGG - Intergenic
1151237083 17:72728435-72728457 CTGTCAAAAAGAAAGGGAAAGGG + Intronic
1152280195 17:79380592-79380614 CTTTGGAAATGGGAGAAAAATGG + Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1153549717 18:6249211-6249233 CTGACAAAATGCAATGAAAAAGG + Intronic
1153760914 18:8331101-8331123 CTGTGAAAAGGAATGCAAAAAGG - Intronic
1153772519 18:8426844-8426866 CTGAGATAGTGCAAGGAAAAGGG - Intergenic
1155306741 18:24485940-24485962 CTGTGAGAATGGAAGAGGAAGGG + Intergenic
1156266489 18:35493262-35493284 CTGTTAAAGTGAAAGGAATAAGG - Intronic
1156971884 18:43166781-43166803 ATGTAAAGATGGAAGGAAAGAGG + Intergenic
1157009773 18:43633193-43633215 CAGTAAAAATGGAGAGAAAAGGG - Intergenic
1157363029 18:47035764-47035786 CTGCGAACATGGAAGGTCAACGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157887449 18:51382845-51382867 TTGTGAAGATGAAAGGAAAAGGG - Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158363654 18:56706192-56706214 CTGGTAAAATGAAATGAAAATGG + Intronic
1158842980 18:61408317-61408339 GTGTGAGAATTGAAGGACAAAGG + Intronic
1158894700 18:61901773-61901795 TTGTGGAGATAGAAGGAAAAGGG - Intergenic
1159023151 18:63159513-63159535 TTGTAAAAATGGAAAGTAAAAGG - Intronic
1159297703 18:66517681-66517703 CAGAGAAAATGGCAGGTAAAAGG - Intronic
1159685115 18:71409615-71409637 CTGTGAAAAAGCAATGAGAATGG - Intergenic
1159698624 18:71593675-71593697 CTGTGAAACTGTAAGGTGAATGG + Intergenic
1159975347 18:74704397-74704419 CGGGGAAAATGAAGGGAAAAAGG + Intronic
1160513854 18:79467731-79467753 CCCTGAAAAGGAAAGGAAAAGGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1162873771 19:13605752-13605774 CTGTGAAATGGGAAGAAGAATGG - Intronic
1164207736 19:23071889-23071911 AGATGAAAAAGGAAGGAAAAAGG + Intergenic
1164563524 19:29310082-29310104 CTGTGAGGATTGAAGGAGAAAGG - Intergenic
1165350182 19:35270835-35270857 GTGTTGAAATGGAAGGAAGAGGG + Intronic
1165455623 19:35908856-35908878 CTGTAAAATTGGGAGTAAAATGG + Intergenic
1165765755 19:38350000-38350022 GAGAGAAAATGGAAGGAACAAGG - Intronic
1166582972 19:43918963-43918985 CTGTGAAAAGGCAAGGACATAGG + Intronic
1168202002 19:54822233-54822255 TTTTGAAAATGAAAAGAAAAGGG - Intronic
1168331239 19:55570421-55570443 CTGTAAAAAAGGAATGAAGAGGG + Intergenic
1168568798 19:57446886-57446908 CTGTAAAAATGTATGAAAAATGG + Intronic
1202641509 1_KI270706v1_random:94767-94789 CATTGAAAATGTGAGGAAAAAGG - Intergenic
925234133 2:2263250-2263272 CTTTGAAAATGGAAGAGAAGGGG + Intronic
925494706 2:4434488-4434510 CAATTAAAATGGAAGGTAAAGGG + Intergenic
926096148 2:10081495-10081517 CTAAGAAAATGGAATAAAAATGG + Intergenic
926203261 2:10816413-10816435 CTGTAAAAAAGAGAGGAAAATGG - Intronic
926394868 2:12430558-12430580 CTGAGAAAAGGGAAGGGAAAAGG + Intergenic
926889420 2:17626493-17626515 CTATGAGAATGGCAGGAAATGGG - Intronic
927964223 2:27259122-27259144 CTCTGTGTATGGAAGGAAAAGGG - Intronic
928220589 2:29399793-29399815 ATGTGAAAATGCAAGGAAGAAGG - Intronic
928389627 2:30899198-30899220 CTGGGATGAAGGAAGGAAAATGG - Intergenic
928407126 2:31023381-31023403 CTTTGACAATGTAAGGAAAGAGG - Intronic
928752332 2:34485522-34485544 CTTTCACAATGGAAGAAAAATGG - Intergenic
929160408 2:38826515-38826537 CTGGGAAAATGAAAGAAAAGAGG - Exonic
929967764 2:46548377-46548399 ATGAGAAAAGGGAAGGAGAAAGG + Intronic
930975547 2:57455173-57455195 CAGAGAAAATGGAAGGAGAGAGG - Intergenic
931165766 2:59745969-59745991 CTCTGAAAATGGAAGTGAAAAGG - Intergenic
931443620 2:62308512-62308534 CTGAGAGAGAGGAAGGAAAAGGG + Intergenic
931723436 2:65084456-65084478 CTGTCAATAGTGAAGGAAAAAGG + Exonic
931889384 2:66654115-66654137 CTGTGGAAATAGAAGGTAGATGG + Intergenic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
932090706 2:68803810-68803832 ATTTGATAATGGAAGGAAAGAGG + Intronic
932958362 2:76383004-76383026 CTTGGAAAATGGAAATAAAAGGG - Intergenic
933213298 2:79596538-79596560 CAATGACAGTGGAAGGAAAAGGG + Intronic
934099535 2:88640276-88640298 CTTTTTAAATGGAGGGAAAATGG + Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934600725 2:95655950-95655972 CTGTGAGAAAGGAAGGAATGGGG - Intergenic
937173155 2:119897637-119897659 CTATGAAAAAAGAAAGAAAATGG - Intronic
937318394 2:120946598-120946620 GTGTGGAAATGGAAGAAGAAAGG + Intronic
937377824 2:121349705-121349727 CCCTAAAAATGGAAGGCAAAGGG - Intronic
937705682 2:124918181-124918203 CTGAGAAAAGGGAAGGAGAGGGG - Intergenic
937750575 2:125472200-125472222 TTGTGAAAATGGAACAGAAAAGG + Intergenic
937787832 2:125923125-125923147 TTGTGACAATGGACGGGAAAAGG + Intergenic
938120435 2:128629189-128629211 TTGTGAAGAAGGAAGGCAAAGGG - Intergenic
938566583 2:132524202-132524224 CTGTGAAGAGGGAACGAAGAGGG + Intronic
938990918 2:136628934-136628956 CTATTAAAATGGAAGGACAAAGG + Intergenic
939222661 2:139322518-139322540 CTGTGAAAATGGAAGCCAGATGG - Intergenic
939625562 2:144473115-144473137 CTATGAGAATGGAAAGGAAAGGG + Intronic
939704199 2:145431721-145431743 CATTGAAATTGGAAGGTAAACGG + Intergenic
939764294 2:146226986-146227008 CTGATAAAATGGAAAGTAAAAGG + Intergenic
940153418 2:150628051-150628073 CTGATATAATGGAATGAAAAGGG + Intergenic
940487734 2:154317572-154317594 ATATTAAAATGGAAAGAAAATGG + Intronic
941026518 2:160461989-160462011 CTATGATAATGGAAGGCAAGTGG + Intronic
941060100 2:160837242-160837264 CTGCCAAAATGGAAGGAACTGGG - Intergenic
941358648 2:164523972-164523994 CTGTCAAAATGTTAGGTAAATGG - Intronic
941422615 2:165301416-165301438 ATTTGAAAATGGTAGGAAAATGG + Intronic
941479245 2:165985350-165985372 GTAAGAAAAAGGAAGGAAAAAGG + Intergenic
941746886 2:169096242-169096264 CTTTGAAAAGGACAGGAAAAGGG + Intergenic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
942033335 2:171986190-171986212 GTGTGAGAAGGGAGGGAAAAAGG + Intronic
942429800 2:175898553-175898575 GTGTGAAGAAGGAAGGGAAAAGG - Intergenic
942766206 2:179460277-179460299 CTGTGAGAATAGAAGCAAGATGG - Intronic
943078527 2:183228502-183228524 GTGGGAAAATTGAAGGGAAATGG - Intergenic
943235629 2:185315311-185315333 CAGTGAAAATGATAGGAAAATGG - Intergenic
943271339 2:185809722-185809744 GTGTGTAAGTGGAAAGAAAATGG - Intronic
943340982 2:186681974-186681996 TTGTGAAAATGCAAGAAAAGGGG + Intergenic
943748383 2:191486065-191486087 CTGGGAAATTGGAAGGAAAATGG + Intergenic
943759118 2:191589305-191589327 CTGTGAAAATGTATGTCAAATGG - Intergenic
943976463 2:194484722-194484744 CTGAGAAAATGGAAGGAAAAAGG - Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944789351 2:203108725-203108747 GTGTAAAAGTGAAAGGAAAAAGG + Intronic
944987469 2:205193831-205193853 CTGTGACACTGGAGGGGAAAAGG + Intronic
945064980 2:205940743-205940765 CACAGAAATTGGAAGGAAAAGGG + Intergenic
945071048 2:205989324-205989346 AAGTAAAAATGGAAGGAAAGGGG - Intergenic
945155078 2:206829700-206829722 TTGTGAAGATAGAAGGAAAAAGG + Intergenic
945584594 2:211643547-211643569 CAGTTAAAATGCAAGAAAAAAGG - Intronic
945644918 2:212479211-212479233 CTGTCAACATGGCAGGAAGATGG - Intronic
945683854 2:212945738-212945760 CTGAGAAATTGGTAGGAAGACGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946151127 2:217771770-217771792 CTATGAAAATGGTGGGGAAATGG - Intergenic
946873494 2:224106129-224106151 ATTTGAAAGAGGAAGGAAAATGG - Intergenic
947022730 2:225699375-225699397 CTGTGACAATGGAAGGAACAAGG + Intergenic
947675342 2:231974067-231974089 CTTTGCATATGAAAGGAAAAAGG - Intronic
947781931 2:232775016-232775038 CTGTGAACAGGGAAGTCAAAAGG + Intronic
948989419 2:241545144-241545166 CTGTGAATATGGGACCAAAAGGG - Intergenic
1168763588 20:366633-366655 TTGTTAAATAGGAAGGAAAAAGG + Intronic
1169294270 20:4379449-4379471 ATGTAAAAATGAAAGGAAAAAGG - Intergenic
1169673380 20:8129419-8129441 CTGTGAACGTGGACGTAAAAAGG - Intergenic
1169788779 20:9387594-9387616 CTGTGAAAATGCAGGAAATAGGG + Intronic
1169873495 20:10271864-10271886 CTGTGAAAAGGAAAGGTCAATGG + Intronic
1169886693 20:10406947-10406969 ATTTGAAAATGGATAGAAAAAGG - Intronic
1169901640 20:10558524-10558546 CTGTTAAAATGGAATCAAATTGG - Intronic
1170337888 20:15291152-15291174 TTCTGAAAATGGAAGTGAAAAGG - Intronic
1170555711 20:17513228-17513250 CTCTGAGAAGGGGAGGAAAAGGG - Intronic
1170654418 20:18272834-18272856 CTAGGAAAATCGAAGGAAGAGGG + Intergenic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171095963 20:22332494-22332516 GGGTTGAAATGGAAGGAAAATGG - Intergenic
1171129160 20:22632839-22632861 ATGTGAAAATCAAAGTAAAACGG - Intergenic
1171206556 20:23286308-23286330 CAGTAAAAATTTAAGGAAAAAGG + Intergenic
1171474512 20:25397818-25397840 AAGTGAAAAGGGAAGGGAAAGGG + Intergenic
1171888628 20:30684976-30684998 CATTGAAAATGTGAGGAAAAAGG - Intergenic
1171951269 20:31424668-31424690 GTGTGAAAAGGCATGGAAAATGG + Intergenic
1172944681 20:38677997-38678019 CAGTGGAAATGGAAGAAAAGAGG + Intergenic
1173962021 20:47081476-47081498 CTGTGAAAATTGAAATAAAAAGG + Intronic
1174282955 20:49452597-49452619 CCCTGAAGATGGAAGGGAAAAGG + Intronic
1174285222 20:49468078-49468100 CTCTGTAAATGGAAGGCAAAAGG + Intronic
1174427086 20:50439414-50439436 CTATGAGATTAGAAGGAAAATGG + Intergenic
1176291822 21:5049852-5049874 CTGTGCAAATGGCAGGCCAAAGG + Intergenic
1176610369 21:8877819-8877841 CATTGAAAATGAGAGGAAAAAGG + Intergenic
1176665920 21:9687650-9687672 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
1177149081 21:17436595-17436617 CTGGGAAACTGGAATGAAATGGG - Intergenic
1177276909 21:18923742-18923764 CTGTGAAAGTGGAATGAGAATGG - Intergenic
1179029127 21:37704521-37704543 CTGTGAAAGCGGACGGATAATGG - Intronic
1179208691 21:39307786-39307808 CTGTGAAAATTAAATGATAATGG - Intronic
1179865434 21:44213789-44213811 CTGTGCAAATGGCAGGCCAAAGG - Intergenic
1180360441 22:11887107-11887129 CATTGAAAATGTGAGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
1181874956 22:25933171-25933193 CTCTGAAATTGGAAAGAAATAGG - Intronic
1182100223 22:27652579-27652601 ATGTGAGAATAGAAGGGAAAAGG + Intergenic
1183141191 22:35941518-35941540 CTGGAAAAATGGAAAGAACAGGG - Intronic
1183843797 22:40523102-40523124 CTTTGAAAAATGAAGAAAAATGG + Intronic
1184144353 22:42600183-42600205 CAGTGAAAATGACAGGAAAATGG + Intronic
1184775871 22:46622394-46622416 TTTTGAAAATGGAAGGAAGTAGG + Intronic
1185072417 22:48663735-48663757 GTGTGAATATGCCAGGAAAAGGG - Intronic
949203020 3:1403358-1403380 CAATGACAATGGAAAGAAAATGG - Exonic
949342115 3:3041405-3041427 TTATGAAAATGAGAGGAAAAGGG + Intronic
949531352 3:4958765-4958787 CTGTGAAAAAGCAAGAAAATAGG + Intergenic
949561078 3:5203194-5203216 CAGAGAAGATGAAAGGAAAAGGG - Intronic
949714116 3:6908556-6908578 CTGTGAAAAGGCAAGCAAATAGG - Intronic
949789740 3:7779939-7779961 TGGTGAGAATGGAAGGAAAAAGG - Intergenic
950514977 3:13459226-13459248 CTGTGAAAATGGCAGAGAACAGG - Intergenic
950622271 3:14215404-14215426 CTGTGAAAATGGGATAATAATGG + Intergenic
950994113 3:17476035-17476057 ATATGAAAATGGCATGAAAAAGG - Intronic
951400869 3:22230287-22230309 CTATAAAAAAAGAAGGAAAATGG + Intronic
951417109 3:22438213-22438235 CTGTGAGAATGTGAAGAAAAAGG - Intergenic
952207227 3:31192026-31192048 CAGTGAAAATGGAAGCCATAAGG + Intergenic
952655411 3:35779823-35779845 GTGAGAAAAGGGAGGGAAAAAGG - Intronic
952736335 3:36695142-36695164 GAGTGAAAAAGGAAGGAGAAAGG - Intergenic
952753654 3:36846968-36846990 GTCTGAAAACGGAAGGAGAAGGG - Intronic
953252403 3:41258173-41258195 CTGAGAAAATAGAAGGTTAAAGG - Intronic
953569416 3:44059231-44059253 CAGTGAGATTGGAAGGAGAAGGG + Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953775684 3:45815038-45815060 TTGTGAAGATTGATGGAAAAGGG + Intergenic
954071318 3:48144844-48144866 CTGTGAGAATCAAATGAAAATGG + Intergenic
954402952 3:50328547-50328569 CTGTGAAAATAGAAGCCAGATGG - Intergenic
954897655 3:53990457-53990479 CTGTGGAACTGGAAGTAAATGGG + Intergenic
955102868 3:55869214-55869236 ATGTGAAAATGGAGGAAAAAGGG + Intronic
955119917 3:56047741-56047763 CTGTGGAAATGTAAGCATAAAGG - Intronic
955186883 3:56722833-56722855 ATTTGAAAATGGAAAGCAAATGG + Intergenic
955436758 3:58908349-58908371 ATGAGAGAAGGGAAGGAAAACGG - Intronic
955498526 3:59561566-59561588 CTTTGAAACTGAAAGGCAAAAGG + Intergenic
955601910 3:60654427-60654449 CTGTCCAAATGGGAGCAAAATGG + Intronic
956211767 3:66808998-66809020 CTGTGAACAGGGAAGGAGAGCGG - Intergenic
956214619 3:66835680-66835702 CTGTGTAAAGGGAAGAAAATGGG + Intergenic
956949366 3:74263086-74263108 ATGTGAAATTGGTAGGAAAGAGG + Exonic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
957544578 3:81621369-81621391 ATATGAAAATGTAAGGGAAATGG + Intronic
957660207 3:83140431-83140453 CTGTGTTAATGGAAGATAAAGGG + Intergenic
957666278 3:83233137-83233159 CTGGGAGAATGAAAGTAAAAGGG - Intergenic
958031919 3:88121886-88121908 CTGTGTAAATGGAAGCACTATGG - Intronic
958053281 3:88376666-88376688 ATGAGAAAATGGCAGGAACAAGG - Intergenic
959465207 3:106677944-106677966 ATGAGAGAATGGAAGGAAAGAGG - Intergenic
960155651 3:114295104-114295126 CAGTGAATGTGAAAGGAAAAGGG + Intronic
960183116 3:114606525-114606547 CTGCTAAAATGGAAGAGAAAAGG + Intronic
960347501 3:116552452-116552474 ATGATAAAAGGGAAGGAAAATGG - Intronic
960799701 3:121525892-121525914 TTGTGAAAATGGCAAAAAAAAGG - Intronic
961499913 3:127324956-127324978 CTGTCAAGGTGGAAGGAAATTGG + Intergenic
962059294 3:131908258-131908280 TTGTAAAAATAGAAGGAAAATGG - Intronic
962698066 3:137970580-137970602 CATTGAAAGTGGAAGGAACAGGG - Intergenic
962897346 3:139728312-139728334 CTGTGAGAAAGCAGGGAAAATGG + Intergenic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
963323112 3:143831103-143831125 CTCTTAAAATGGAAAAAAAAAGG + Intronic
963333048 3:143937825-143937847 CACTGAAAAGGGAAGAAAAAGGG - Intergenic
963512501 3:146266009-146266031 CTGTGTGAATATAAGGAAAATGG + Intergenic
963790329 3:149576670-149576692 ATTTGAAAATGGAACAAAAAAGG + Intronic
963888783 3:150610265-150610287 TTGTCAAAATGAAAAGAAAAGGG - Intronic
964231290 3:154471456-154471478 CTCAGAAAATGGAAGCAAAGAGG + Intergenic
964389440 3:156182548-156182570 TTAAGAAAATGGAAGGAAATTGG - Intronic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
964629735 3:158797568-158797590 CTGTGAAACTGGGAGAAAAAGGG + Intronic
964986626 3:162749296-162749318 CTGAAAAAAAGGATGGAAAAAGG - Intergenic
965410220 3:168320838-168320860 CAATGAAAATGGGAAGAAAATGG + Intergenic
965422395 3:168478023-168478045 TAGTGATAATGGAAGGAACATGG + Intergenic
965680288 3:171243751-171243773 CTCTGAAAATGGAACCAACAGGG - Intronic
966645829 3:182245592-182245614 GTAAGAACATGGAAGGAAAAGGG + Intergenic
967010990 3:185433487-185433509 ATGGGAAAATGGCAGAAAAAAGG - Intronic
967728740 3:192886779-192886801 CTGTGAAAATTGAATTAAATTGG - Intronic
967968341 3:194981211-194981233 TTGTGAAAATATGAGGAAAATGG + Intergenic
968140813 3:196254896-196254918 CTCAGAGAAAGGAAGGAAAAGGG - Intronic
968257014 3:197284509-197284531 CCATGAAAATGTAAAGAAAATGG + Intronic
1202737051 3_GL000221v1_random:12604-12626 CATTGAAAATGAGAGGAAAAAGG + Intergenic
968817195 4:2828270-2828292 CAGGGAAAATGGAAGGATCAAGG - Intronic
968832829 4:2942007-2942029 TTTTGAAAATGAAAAGAAAAAGG + Intronic
968841964 4:3014167-3014189 CTGTGATAAGGGAAAGGAAAGGG - Intronic
969164931 4:5299293-5299315 CAGTGAAAAGGGAAGGAAACAGG + Intronic
969400954 4:6955165-6955187 CTTTGAAAATGCAAGGGAAAAGG - Intronic
969449152 4:7263268-7263290 CTGGTGTAATGGAAGGAAAATGG + Intronic
970529490 4:16967567-16967589 GTGTTAAAATGGAAGGAGAAAGG - Intergenic
970573357 4:17404278-17404300 CTTTAAAAAGGGAAGGAAGAAGG + Intergenic
970727837 4:19067899-19067921 CTCTGAAAAAGGAAGGATCATGG - Intergenic
970970400 4:21976538-21976560 CTGAGAATATGTAAAGAAAAGGG - Intergenic
970991329 4:22216835-22216857 CTGTTAAATTGAAACGAAAAGGG + Intergenic
971060366 4:22961733-22961755 AAGTGAAAATGGAAATAAAAAGG - Intergenic
971144238 4:23959682-23959704 CTATGAAGATGGAAGGAGAAAGG + Intergenic
971340537 4:25764888-25764910 ATGTGAAAATGGATGAACAATGG + Intronic
971495031 4:27255131-27255153 CTGGCAAAATGGGAGGAAACTGG - Intergenic
971936130 4:33150063-33150085 CTGTGAAAAGGCATGTAAAAGGG + Intergenic
972257258 4:37370552-37370574 CTGTGAAAATGGATGTTAATTGG + Intronic
972577400 4:40364461-40364483 GTGTGAATCTGGAAGGACAAAGG + Intergenic
972623511 4:40772908-40772930 CTGTGAAAATGCTATGAATATGG + Intronic
972998709 4:44917923-44917945 ATGTGAAAATGGAAGGTTATAGG + Intergenic
973104802 4:46322174-46322196 CTGTGAAAAAGGCATGGAAAAGG + Intronic
973385019 4:49505294-49505316 CATTGAAAATGTGAGGAAAAAGG - Intergenic
973595780 4:52488010-52488032 CTGTCAAAAAAGAAGAAAAAAGG + Intergenic
974558885 4:63491616-63491638 CTGTAGAAATGGCAAGAAAATGG + Intergenic
974566570 4:63584364-63584386 CAGTAATAATGGAAGGCAAAGGG - Intergenic
974756317 4:66212745-66212767 CTTTGAAAATGTAACGCAAAGGG - Intergenic
974996828 4:69171110-69171132 CTGTGAAGAGGAAAGGAACACGG + Intronic
975340947 4:73239592-73239614 GTGTGAAAATGCACAGAAAAAGG + Intronic
976259071 4:83128528-83128550 CTCAAAAAATGAAAGGAAAAGGG - Intronic
976391754 4:84512809-84512831 CTGAGAAATTGGATGGATAATGG + Intergenic
976448309 4:85157275-85157297 TTCTAAAAATGAAAGGAAAATGG + Intergenic
976542158 4:86290781-86290803 ATTTAAAAATGAAAGGAAAAAGG - Intronic
976895160 4:90100398-90100420 CTGTGAAATTAGAAGCAAGATGG + Intergenic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977199310 4:94097074-94097096 CCATGAAAATGGAAGCCAAAAGG - Intergenic
977441978 4:97079413-97079435 CTTTGAAAATGGAAGAAGGAGGG - Intergenic
977711558 4:100132537-100132559 CAGTGAAACTGAAAGGAAATAGG - Intergenic
977751228 4:100612225-100612247 TTTTGAAAAAGTAAGGAAAATGG - Intronic
978279397 4:106991952-106991974 ATGTTAAAATGGAAGCAAAAAGG - Intronic
978609137 4:110517793-110517815 GTTTGAAGATTGAAGGAAAAGGG - Intronic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979164752 4:117514698-117514720 CTGTGAAAAAGAAAGAAAACTGG + Intergenic
979665423 4:123305552-123305574 CTGTGAAACTGAAAAGAACATGG + Intronic
979744136 4:124188755-124188777 CTGTGGAATTGAAAGGAAAATGG - Intergenic
979851184 4:125573124-125573146 CTTTGGAAAGGGGAGGAAAAAGG - Intergenic
979894055 4:126135504-126135526 CAGTTATAATGGAAGGCAAAGGG - Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980269271 4:130563416-130563438 CAGGAAAAATTGAAGGAAAATGG - Intergenic
980439949 4:132829361-132829383 CTGAGCAACTGGAAGGATAAAGG - Intergenic
981207519 4:142060828-142060850 CTGTACAACTGGAAGGAAAAAGG + Intronic
981489683 4:145326420-145326442 CTTTGAAAATAGGATGAAAAAGG - Intergenic
981775405 4:148361712-148361734 TTGTAAGAATGGAAGGAGAAGGG - Intronic
982357192 4:154483863-154483885 CTGTGAAAGTGTCAGGATAATGG - Intronic
982397867 4:154931844-154931866 TGGTGAAGATGTAAGGAAAAGGG - Intergenic
982495138 4:156081591-156081613 CTCTGAAAATGAAAAGTAAATGG - Intergenic
982912379 4:161160704-161160726 CTGAGAAATTGGAGAGAAAAAGG - Intergenic
983146518 4:164222581-164222603 TAGTGAAAATGGAAAGAGAAAGG + Intronic
983272526 4:165579578-165579600 GGGTGAAAATGTCAGGAAAAAGG - Intergenic
983393679 4:167166648-167166670 TTATGACAATGGAAGGTAAATGG + Intronic
983518857 4:168686017-168686039 CTAAAAAAAAGGAAGGAAAAAGG - Intronic
983671926 4:170247297-170247319 CTGTGAGAAAGGAAAGAAAGTGG - Intergenic
984230791 4:177096352-177096374 CAGTGAGAATGCAAGGACAATGG + Intergenic
984475729 4:180232024-180232046 CTGAGAAAATCAAAGGTAAATGG - Intergenic
984579699 4:181497612-181497634 CTGTTCAAATCGAAAGAAAAAGG + Intergenic
984964717 4:185129734-185129756 CTGTGAAAAAAGAAAGAAAAGGG - Intergenic
985168536 4:187123844-187123866 GAGTGACAAGGGAAGGAAAAAGG - Intergenic
985411650 4:189691909-189691931 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
1202768880 4_GL000008v2_random:180629-180651 CATTGAAAATGTGAGGAAAAAGG - Intergenic
985798142 5:1980117-1980139 CAATAAAAAAGGAAGGAAAAAGG + Intergenic
986186917 5:5451577-5451599 ATGTGAAAATGTAAGTAGAATGG + Intronic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
987237339 5:15956177-15956199 CTGTGAAAGTGTAAGGACTAAGG + Intergenic
987245631 5:16045612-16045634 ATGAGAAAATGGAAGAAAAAGGG + Intergenic
987876169 5:23684447-23684469 CTCTGACAAGGGAAGGAAAAGGG + Intergenic
987970413 5:24936864-24936886 CTGTTAAAAAGGAAAGAAAAAGG + Intergenic
988658333 5:33237103-33237125 CTGGCAAAATGGAGGAAAAATGG + Intergenic
988846639 5:35134319-35134341 CTGTGATAATCCAAGGAAAGAGG - Intronic
989071193 5:37513471-37513493 AAGTGAAGATGGAAGGAACATGG + Intronic
989442033 5:41484028-41484050 GTAAGAAAATGGAAGCAAAAAGG + Intronic
990010743 5:50994646-50994668 TGGTGAAAGTGGAAGGAGAAGGG - Intergenic
990558204 5:56957076-56957098 CTCAGAAAAGGGAAGGAAAATGG + Intronic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
990952585 5:61312727-61312749 CAGTGTAAATGCAAGGACAAGGG - Intergenic
991123748 5:63046073-63046095 CTGTGAAATAGGAATGAAATGGG + Intergenic
991476792 5:67029786-67029808 ATGTGAAAAAGGTAGGAGAAAGG + Intronic
992155338 5:73950040-73950062 AGGACAAAATGGAAGGAAAATGG - Intergenic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993339750 5:86708762-86708784 ATCTGGAAATGGAAGGAACATGG + Intergenic
993388581 5:87290151-87290173 CTGTAAAAATGGAATACAAATGG - Intronic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
994181960 5:96777295-96777317 CTGTGAAAATTTATGGGAAAAGG - Intronic
994640922 5:102408711-102408733 GAATGAAAATGCAAGGAAAAGGG + Intronic
995241636 5:109891256-109891278 CTTTGGAAAGGAAAGGAAAAAGG - Intergenic
995385563 5:111585092-111585114 CTGTGAGAATGCAGGGAAATAGG + Intergenic
995798466 5:115965109-115965131 CTGTGAGAATTAAATGAAAAAGG + Intronic
996200753 5:120669265-120669287 CTCTGAAAACCGTAGGAAAAGGG + Intronic
996408785 5:123133130-123133152 CTGTGAATATGAAAGTAAAAAGG + Intronic
996838875 5:127824241-127824263 CTGTTAGAAAGGAAAGAAAAAGG + Intergenic
997120506 5:131168154-131168176 CTTTGAAAATGGAAGGAGTTGGG + Intronic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997819719 5:137054086-137054108 CATTAAAAAAGGAAGGAAAATGG + Intronic
998239790 5:140430007-140430029 ATGTCAAAATGGAATAAAAATGG + Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998682543 5:144486354-144486376 CTGAAAAAATGGAAGGAATTGGG + Intergenic
998786842 5:145720647-145720669 CTGTGAAAATTTAGGTAAAAGGG + Intronic
998801023 5:145869339-145869361 CAAAGAAAATGGAAGGGAAAAGG - Intronic
999019021 5:148142685-148142707 ATTCTAAAATGGAAGGAAAAAGG + Intergenic
999165901 5:149549554-149549576 CTGAGAAAAGGGCAGGAATATGG + Intronic
999257521 5:150217831-150217853 GTGGGAAAATGCAAGGGAAATGG + Intronic
999966346 5:156813848-156813870 GTGTGGAAATGGTATGAAAATGG + Intergenic
1000470718 5:161637803-161637825 CTGTGAACTTGAAAAGAAAATGG + Intronic
1000811683 5:165870726-165870748 AGGTGAAAATGAGAGGAAAAAGG - Intergenic
1001744800 5:174084120-174084142 TGGAGGAAATGGAAGGAAAAAGG - Intronic
1002761855 6:208691-208713 GTGTGGAAATGGAAGCAAACAGG + Intergenic
1003494669 6:6653722-6653744 CTGAGCAACTGGAAGGAGAAAGG - Intronic
1003822717 6:9917920-9917942 CTGAGAGTAGGGAAGGAAAATGG - Intronic
1004999286 6:21224566-21224588 CTTTGAAAATGGAAAAAAAAGGG + Intronic
1005095635 6:22112033-22112055 CTTTGAAAATAAAAGTAAAAGGG - Intergenic
1005190541 6:23216777-23216799 ATGGGAAAATAGAATGAAAAAGG + Intergenic
1005324942 6:24690843-24690865 AAGTGAAAATGGCAGGCAAATGG - Intronic
1005353373 6:24959114-24959136 ATGTGAAGATGGAAGCAGAAGGG - Intronic
1005848078 6:29798160-29798182 CTTTGAAAATGGAGGGATCATGG + Intergenic
1005963956 6:30713289-30713311 CTGTTCAAATTGAAGGCAAAAGG + Exonic
1006266522 6:32929975-32929997 CTATAAAAATGAAAGGAAAAAGG + Intergenic
1006630452 6:35426828-35426850 GTGTGAAGATGGAAGGACACTGG - Exonic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1007205821 6:40149749-40149771 CTGGCAAAAGGGAAGGAATATGG + Intergenic
1007495045 6:42254072-42254094 TTGTGAAAAGTGAAGGAAATAGG - Intronic
1007873965 6:45073778-45073800 CTATGAAAAGGGCAAGAAAAAGG + Intronic
1008028154 6:46662453-46662475 AGATGCAAATGGAAGGAAAAAGG + Exonic
1008455215 6:51702811-51702833 CTGTTAAAAGAGAAAGAAAAAGG + Intronic
1008457976 6:51733906-51733928 CTGGGAAAATGAAAGGTAAAGGG + Intronic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1008969586 6:57351494-57351516 CTGTGAGAATGGAAAGAAGTGGG + Intronic
1008983330 6:57512243-57512265 CTGAGGACATGTAAGGAAAAAGG + Intronic
1009158558 6:60253331-60253353 CTGTGAGAATGGAAAGAAGTGGG + Intergenic
1009197804 6:60708351-60708373 CTGTGAAAATGGCGGGAAAGAGG - Intergenic
1009418016 6:63437030-63437052 CTGTCAAAAAAGAAAGAAAAGGG + Intergenic
1009423917 6:63493382-63493404 TTGGGAAAAGGGAAAGAAAATGG - Intergenic
1010333829 6:74657426-74657448 CTGTTAAAATGGAGGGCACATGG - Intergenic
1010343058 6:74780042-74780064 CTATGAAAATGGAAGTCAATGGG + Intergenic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1010977674 6:82334548-82334570 ATGTGGAAATGAAAGGAAAAGGG - Intergenic
1011058445 6:83233185-83233207 CAGTGAAAAGAGAATGAAAAGGG - Intronic
1011436098 6:87338800-87338822 GTGTGAACATGCAAAGAAAAGGG + Intronic
1011914243 6:92483254-92483276 ATCTGAAAAAGGAATGAAAAAGG - Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1012977415 6:105794871-105794893 CTGGGAAAAGGGAAGGGAACTGG + Intergenic
1013438624 6:110139037-110139059 CTATGAGCATGGGAGGAAAATGG - Intronic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014302407 6:119698970-119698992 TTTTGAACATGGAAGAAAAAAGG - Intergenic
1014332254 6:120083988-120084010 CAGGGTAAATGGAAGTAAAATGG + Intergenic
1014693906 6:124595353-124595375 CTGTGAAAATGGCCAGATAAGGG - Intronic
1015391873 6:132691524-132691546 TTGTGAACATATAAGGAAAATGG + Intronic
1016447926 6:144151687-144151709 CAGTGAAAATGACAGCAAAATGG - Intronic
1016508553 6:144813516-144813538 CTTTACCAATGGAAGGAAAATGG - Intronic
1017404293 6:154101385-154101407 CTTTGGAAATAGAAGGGAAATGG + Intronic
1017727450 6:157285424-157285446 TTCTGAAAAAGGAAGGAAACAGG + Intergenic
1018276431 6:162137012-162137034 GTGTGAAAATGTATAGAAAAAGG + Intronic
1018358041 6:163038365-163038387 ATGTGAAGCTGGAAAGAAAATGG + Intronic
1018359643 6:163054649-163054671 GGGTGAAAAAGGAAGAAAAAGGG + Intronic
1019224288 6:170497524-170497546 CTGTTAAAAAGGAGGGATAATGG - Intergenic
1019833291 7:3355588-3355610 CCGTGAAGATGGAGGGAACAGGG - Intronic
1020503902 7:8959152-8959174 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020504005 7:8960471-8960493 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020599743 7:10257853-10257875 CTCTGAAAATTGAAGTAAAGTGG + Intergenic
1020645923 7:10814163-10814185 CTTTGAAAATTAAAGCAAAAAGG - Intergenic
1020676812 7:11193184-11193206 TCCTGAAAAAGGAAGGAAAAAGG - Intergenic
1020732241 7:11894959-11894981 ATGTGAAAATGGCTAGAAAATGG - Intergenic
1021278387 7:18684920-18684942 ATTTGAAATTTGAAGGAAAATGG + Intronic
1022052413 7:26690319-26690341 CAGTGAAAGTGGAAGAACAAAGG - Exonic
1022410185 7:30134461-30134483 CTGAGAAAATCTAAGGAAAAGGG - Intergenic
1023167276 7:37355244-37355266 CTGTGAAACTGGAATGACAGAGG + Intronic
1023574565 7:41612510-41612532 CTGTAAAAAGTGAATGAAAACGG + Intergenic
1023614212 7:42002422-42002444 CTGTTAAAATAGGAGGAATATGG + Intronic
1024218296 7:47266507-47266529 CTGTGAAAATGCAGGGCAAAGGG + Intergenic
1024581978 7:50808044-50808066 CTGTAAAAATAGAAGTGAAATGG + Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1026276314 7:68880260-68880282 CTGTGAAAAGGCAAGGCATAGGG - Intergenic
1026791516 7:73335546-73335568 CTGGGAAAATGGAACCAAAGAGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027648552 7:80836277-80836299 CTGTCAAAAAGCAAAGAAAAGGG - Intronic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028621197 7:92831533-92831555 TTGTGATATTGGAGGGAAAAGGG - Intronic
1029974987 7:104825348-104825370 CTGTGAAAAGAGAAGCAACATGG + Intronic
1030333143 7:108294640-108294662 TTGTGCAATGGGAAGGAAAATGG + Intronic
1030375964 7:108754059-108754081 GTGGGACAATGGAATGAAAAGGG + Intergenic
1030409451 7:109157191-109157213 CTGTGACAATGCATTGAAAAAGG + Intergenic
1030419457 7:109289532-109289554 CTTTGAAAATCAGAGGAAAAAGG - Intergenic
1031358734 7:120821444-120821466 CTGTAAAAATGGAAGAACATAGG + Intronic
1031672613 7:124568553-124568575 CTCTGAAAATGCATGGTAAAGGG - Intergenic
1033092207 7:138396309-138396331 AAGTGCAAAGGGAAGGAAAATGG - Intergenic
1033166303 7:139041369-139041391 CAGTGAACACTGAAGGAAAAGGG + Intergenic
1033590691 7:142805843-142805865 TTGGGAAATTGGAAGAAAAAGGG + Intergenic
1033793884 7:144824345-144824367 TTTTGAAAATGGAATTAAAATGG - Intronic
1034301621 7:150020681-150020703 TTTTGAAAATGAAAAGAAAATGG - Intergenic
1034568536 7:151935464-151935486 CTGAGTAATTGCAAGGAAAACGG - Intergenic
1034804427 7:154076585-154076607 TTTTGAAAATGAAAAGAAAATGG + Intronic
1035174836 7:157043018-157043040 CTGTGAAAATGTGAGGCATATGG + Intergenic
1036095577 8:5721529-5721551 CTGTGAAACTTGTAGAAAAAAGG + Intergenic
1036414503 8:8534687-8534709 CAGTGAAAATGAAAGGAAATGGG - Intergenic
1036787032 8:11694749-11694771 CTGTGATCATGGAAGAAAAATGG - Intronic
1037629379 8:20639593-20639615 CTGAGAAACTGCAAGGACAATGG - Intergenic
1037793480 8:21969460-21969482 CTGTGAAAAGAGAGGGAAAAAGG - Intronic
1037975070 8:23203375-23203397 GGAGGAAAATGGAAGGAAAAAGG + Intronic
1038379709 8:27081122-27081144 ATGTGTATATGGAAGGGAAAAGG + Intergenic
1038909612 8:31948311-31948333 CCAGGTAAATGGAAGGAAAATGG + Intronic
1039939139 8:42074229-42074251 TTTTGAAAAAGGAAGGAAAGGGG - Intergenic
1040445840 8:47492553-47492575 CAGTGAAAATGGAAAAGAAAAGG - Intronic
1040446208 8:47496953-47496975 ATGAGAAAATGGAAGTAAAATGG - Intronic
1040731122 8:50448187-50448209 CTGTGAAATAGTGAGGAAAAGGG + Intronic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041545577 8:59038849-59038871 CTGATAAAATGGCAGCAAAAAGG + Intronic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041744108 8:61187456-61187478 ATGTGATAATAAAAGGAAAAAGG + Intronic
1041875622 8:62683735-62683757 CTGAGAAGATGGAATGAAAGGGG + Intronic
1042198995 8:66261006-66261028 CTGTAAAAATGAAAGACAAAGGG + Intergenic
1043220747 8:77660458-77660480 CTCTGATAATAGAAGGAAAATGG - Intergenic
1043413402 8:80023889-80023911 TTTTAAAAATGGAGGGAAAATGG + Intronic
1043526888 8:81106771-81106793 CAGTCAAAATGGAGGGTAAAAGG - Intronic
1043651155 8:82594266-82594288 TTGTGGAAATGAAAGTAAAAAGG + Intergenic
1043661396 8:82746765-82746787 CTGTGCTAATGAAAGGTAAAAGG - Intergenic
1043679450 8:83003880-83003902 TTCTTAAAATGGAAGAAAAAGGG + Intergenic
1044566352 8:93664918-93664940 CTGTGATATTAGAAGGAATATGG - Intergenic
1044644032 8:94419207-94419229 CTGTTAAAATTAAAGCAAAAAGG + Intronic
1044738494 8:95302315-95302337 CTGTGAAATGGGAATGGAAAGGG + Intergenic
1045135848 8:99217296-99217318 CTGTTAAAAAGGAATGACAATGG - Intronic
1045763546 8:105639593-105639615 CTGTGAAAATGGAATAGCAATGG + Intronic
1046212293 8:111092706-111092728 CTGTGGATATGGAAGCAAAAGGG - Intergenic
1046741485 8:117833812-117833834 ATTTGAAAAAGGAAGAAAAAAGG + Intronic
1047020086 8:120766106-120766128 CTGTGAAAATGACAAGAAGAGGG + Intronic
1047225794 8:122954630-122954652 CTTTGAAAAAAGAAGAAAAATGG + Intronic
1047617148 8:126572011-126572033 TGGGGATAATGGAAGGAAAAGGG - Intergenic
1047981322 8:130186047-130186069 CTTAGAAAATGGAAGGACAAAGG - Intronic
1047987349 8:130248633-130248655 TGGTGGAAATGGAAGGTAAAGGG + Intronic
1048618927 8:136110035-136110057 ATGTGATAATGGTTGGAAAAGGG + Intergenic
1050017853 9:1254278-1254300 ATGTGAAGATGGAAAGTAAAAGG + Intergenic
1050298891 9:4236426-4236448 ATGTGGAAAAGGGAGGAAAAGGG - Intronic
1050334755 9:4579890-4579912 GTGTCAAAATGGAAAAAAAAAGG + Intronic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050762317 9:9087775-9087797 TTGTGAAAATGAAAGGAATGTGG - Intronic
1050908371 9:11034949-11034971 CAGATAAAATTGAAGGAAAAAGG + Intergenic
1051021667 9:12552267-12552289 CTGTTAAAAAGTAATGAAAAAGG + Intergenic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051385096 9:16499469-16499491 CAGTGCAAATGGAAAGATAAGGG - Intronic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1052812172 9:33071166-33071188 TTGTCAAAATAGGAGGAAAAAGG - Intronic
1052830135 9:33208403-33208425 CTGTGAGGCTGGAAGCAAAAGGG + Intergenic
1054360818 9:64114986-64115008 CATTGAAAATGTGAGGAAAAAGG + Intergenic
1054820301 9:69515406-69515428 ATGTGAAAGTGGCATGAAAAGGG - Intronic
1054998017 9:71414403-71414425 CTTTGTGAAAGGAAGGAAAAAGG - Intronic
1055200808 9:73658976-73658998 ATGTGAAGAAGGAAGCAAAATGG + Intergenic
1055851018 9:80629935-80629957 ATGTTAAAATGGAAAGAAACTGG + Intergenic
1056534441 9:87515829-87515851 CTCTGAGAATGGGAAGAAAACGG - Intronic
1056959808 9:91113172-91113194 CTCTGAAAATGACAGGAAGATGG + Intergenic
1057123234 9:92595860-92595882 TTTTAAAAATGGAAGGAAATAGG - Intronic
1057194485 9:93109274-93109296 GTGTGAAAATGGCAGGCAGATGG - Intronic
1057939978 9:99273390-99273412 CTGTGAAATAGAAAGGAAAAAGG - Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059866134 9:118515903-118515925 CTGTTAAAATTGAAGAGAAACGG + Intergenic
1060176121 9:121498945-121498967 GTTTGGAAATGGCAGGAAAACGG - Intergenic
1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG + Intronic
1061600746 9:131668560-131668582 CTGTGAAAATGGGAGGGGAGGGG - Intronic
1062515917 9:136935653-136935675 CTATAAAAAGAGAAGGAAAAAGG - Intronic
1203705774 Un_KI270742v1:43052-43074 CATTGAAAATGAGAGGAAAAAGG + Intergenic
1203660178 Un_KI270753v1:34111-34133 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1203670946 Un_KI270755v1:11073-11095 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185782134 X:2857871-2857893 ATGAGAAAATGGCAGCAAAAAGG - Intronic
1186172412 X:6891445-6891467 CTTTGAGAATGGAAAGAAAGGGG - Intergenic
1186564490 X:10647570-10647592 TTTTGAAAATGGAAGAATAAAGG + Intronic
1186684111 X:11906446-11906468 CTTTGAAAATGGAGGGAAATTGG - Intergenic
1186950619 X:14620626-14620648 TTGTGATAAAGGATGGAAAATGG - Intronic
1187062259 X:15798261-15798283 CAGTGAAAGTGGAAGAGAAATGG - Intronic
1187216193 X:17279248-17279270 CTGTGAAAAGGGAAAGAACCAGG - Intergenic
1187260975 X:17684970-17684992 TTGTTAAAAAGGGAGGAAAAGGG + Intronic
1187281850 X:17863357-17863379 CTAAGAAAATGGAGGGAAGAAGG + Intergenic
1187508944 X:19900326-19900348 CTCAGAAAATAGAAGGAAAACGG - Intergenic
1187872143 X:23773308-23773330 CTCTGAAAATGAAACCAAAATGG + Intergenic
1188976912 X:36686817-36686839 GTGGGAAAATGGAATGGAAAGGG - Intergenic
1189199387 X:39178730-39178752 CTTTTAAAATTGAAGAAAAATGG - Intergenic
1190366884 X:49703426-49703448 CTGTGAAACTGGGAGCAAAGTGG + Intergenic
1190529344 X:51359768-51359790 GTGTGAAGATGGAAGCTAAATGG + Intergenic
1190783129 X:53618175-53618197 CAGTGAAAACGAAAGCAAAAAGG + Intronic
1192119474 X:68441474-68441496 GTGTGAAAATGTGATGAAAATGG - Intergenic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1193039142 X:76986546-76986568 GAGGGAAAATGGAAGAAAAATGG - Intergenic
1193172981 X:78358130-78358152 CTTTGGAAATGGGAGGAAAGAGG - Intergenic
1193754138 X:85385709-85385731 TTGTGAAAAGGGAAGACAAACGG + Intergenic
1195059407 X:101179168-101179190 CTGGGAAAAGGGAAGGAATGAGG - Intergenic
1195266143 X:103182015-103182037 CTGTAAAATTAGAATGAAAAAGG - Intergenic
1195468074 X:105203025-105203047 CTGTGAAACTGGAAGCAAGGGGG - Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1195992898 X:110700521-110700543 TTGAGAAAAGGGAAGAAAAATGG + Intronic
1196030107 X:111087682-111087704 CTGTGGACGTGGAAGAAAAAGGG + Intronic
1196415645 X:115468154-115468176 ATGTGACACAGGAAGGAAAAAGG + Intergenic
1196709225 X:118745137-118745159 TTGTGAAAATGGAATGGTAATGG + Intronic
1196866351 X:120074537-120074559 CTGAGAAAATGGAGGGCAACAGG + Intronic
1196876747 X:120161744-120161766 CTGAGAAAATGGAGGGCAACAGG - Intronic
1196974823 X:121147838-121147860 AAGGGAAAAAGGAAGGAAAAAGG + Intergenic
1197055915 X:122118480-122118502 CTATGAAAATGGTATAAAAATGG - Intergenic
1197262036 X:124330361-124330383 TAGTGAAAAAGGAAAGAAAAAGG - Intronic
1198122111 X:133604326-133604348 CTGAGAAAATGGAATTGAAATGG - Intronic
1199431887 X:147771120-147771142 ATCTGAAAATGAAAGCAAAAGGG - Intergenic
1201904048 Y:19071767-19071789 CTGTGTAAGTGGAAAAAAAAGGG + Intergenic