ID: 1170916265

View in Genome Browser
Species Human (GRCh38)
Location 20:20628958-20628980
Sequence CACGGAGCTCTCTGAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 245}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170916265_1170916271 -2 Left 1170916265 20:20628958-20628980 CCAGCTCCTCAGAGAGCTCCGTG 0: 1
1: 0
2: 2
3: 16
4: 245
Right 1170916271 20:20628979-20629001 TGAGGCTCTGGGAAGAAGACTGG 0: 1
1: 0
2: 4
3: 43
4: 445
1170916265_1170916273 30 Left 1170916265 20:20628958-20628980 CCAGCTCCTCAGAGAGCTCCGTG 0: 1
1: 0
2: 2
3: 16
4: 245
Right 1170916273 20:20629011-20629033 TGCTATGTTCATTTGTTGCTGGG 0: 1
1: 0
2: 2
3: 25
4: 324
1170916265_1170916272 29 Left 1170916265 20:20628958-20628980 CCAGCTCCTCAGAGAGCTCCGTG 0: 1
1: 0
2: 2
3: 16
4: 245
Right 1170916272 20:20629010-20629032 TTGCTATGTTCATTTGTTGCTGG 0: 1
1: 0
2: 1
3: 41
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170916265 Original CRISPR CACGGAGCTCTCTGAGGAGC TGG (reversed) Intronic
900353823 1:2250264-2250286 CACGGGACTCTCTGTTGAGCAGG - Intronic
900628977 1:3623941-3623963 CATGGGGATCTCTGAGCAGCTGG - Intergenic
902173985 1:14635663-14635685 CACGCAGCTCTCTTAAGTGCAGG - Intronic
902271720 1:15309806-15309828 CAGGGATATCTCTGAGGAGGTGG + Intronic
902889364 1:19430731-19430753 CAGCAAGCTCTCTGAGGTGCGGG - Intronic
905883137 1:41477341-41477363 CACAAAGCTCTGTGAGCAGCAGG - Intergenic
908320273 1:62971993-62972015 CACTGAGCTCACTGAGGCTCAGG - Intergenic
915034455 1:152910523-152910545 GCTGGAGCTCTCTGAGCAGCAGG + Exonic
915034460 1:152910553-152910575 GCTGGAGCTCTCTGAGCAGCAGG + Exonic
915231619 1:154449815-154449837 CAGGGAGGGCTCTGAGGAGGAGG + Intronic
915269851 1:154746299-154746321 CACGGCTATCTCAGAGGAGCAGG + Intronic
915826765 1:159086406-159086428 CCCAGAGCGCTCTGATGAGCTGG - Intronic
916745037 1:167678637-167678659 CAAGGAGCTGTCTGTGGAGGAGG - Intronic
917477551 1:175381843-175381865 CATGGAGATATCTGAGAAGCAGG - Intronic
917533603 1:175858062-175858084 CCCAGAGCCCTCTGAGAAGCTGG + Intergenic
919091257 1:192980865-192980887 CACACAGCTCTGTGAGGAGATGG + Intergenic
923960055 1:239070479-239070501 GTCGGAGCTCTCGGAGGAGTTGG + Intergenic
1063035600 10:2284069-2284091 GAGGGAGCTCTCAGAGGAGGAGG - Intergenic
1064454546 10:15474364-15474386 CACGGAGCATTCTCAGTAGCAGG + Intergenic
1065821036 10:29525883-29525905 CACGGAGGACTCTGAGGCTCAGG - Intronic
1065963829 10:30754850-30754872 CACGCAGCTCTCTGAAGAAGGGG + Intergenic
1066005274 10:31141095-31141117 CAGGGAGTTCTGTGAGGTGCAGG + Intergenic
1067509575 10:46883985-46884007 GACTGACCTCTCTGAGGAGGAGG - Intergenic
1067652679 10:48167874-48167896 GACTGACCTCTCTGAGGAGGAGG + Intronic
1068529673 10:58171380-58171402 CACCAAGCTTTCTGAGGATCCGG + Intergenic
1069681691 10:70290141-70290163 CAAGGTGCTCAGTGAGGAGCGGG - Intergenic
1070801475 10:79246792-79246814 CAGGGAGCTCCCTGGGAAGCTGG - Intronic
1072355753 10:94608730-94608752 CACTGAGCCTTCTGAGCAGCTGG + Intronic
1073073597 10:100809767-100809789 CACTGACCTCTCTGGGAAGCAGG - Intronic
1074341778 10:112638179-112638201 CAAGAAGCTCTCTGAACAGCTGG + Intronic
1074628307 10:115219279-115219301 CACACAGCTCTGTGAGGAGATGG - Intronic
1074969090 10:118521038-118521060 GACGGAGCTCGCTGAGGGACAGG + Intergenic
1075297289 10:121289060-121289082 CAGGGAGCTCTCTGAGGTCAAGG + Intergenic
1075562324 10:123477221-123477243 CAAGCAGCTCTCAGAGAAGCTGG + Intergenic
1075642048 10:124071926-124071948 CAGGAAGCTCTCTGAGGAGCTGG - Intronic
1075926176 10:126253638-126253660 CCAGGAGCTGTCAGAGGAGCAGG - Intronic
1077488576 11:2850208-2850230 CACGGAGCTCCCTGTGGGCCAGG - Intergenic
1077499969 11:2904894-2904916 CCCGGAGTTCTTTGAGCAGCAGG - Intronic
1077819192 11:5719438-5719460 CAGGGAGCGCTCTGTGGAGATGG - Intronic
1078826169 11:14932411-14932433 CATGCAGCTCTGTGAGGAGATGG - Intronic
1079452596 11:20610215-20610237 CGCAGAGCTCTCTGATGAGATGG + Intronic
1080159745 11:29159662-29159684 CAGGGACTTCTCAGAGGAGCTGG + Intergenic
1080827457 11:35860210-35860232 CAGGGTACTCTCTGGGGAGCAGG - Intergenic
1082682250 11:56189215-56189237 CACGGACATCTCTGAGCTGCAGG - Intergenic
1082912596 11:58393684-58393706 CATGGAGCTCTCTGGGGAATAGG + Intergenic
1083459694 11:62802813-62802835 CCTGGAGTTCTCTGAGGGGCAGG - Intronic
1083921910 11:65785993-65786015 CATGGAGGCCTCTGAGGAGCGGG + Intergenic
1084546551 11:69817829-69817851 CGCCGAGCCCTTTGAGGAGCAGG - Intronic
1085323912 11:75592294-75592316 CAGGGAGCTCTCTGTCTAGCAGG - Intronic
1085469014 11:76744894-76744916 CATGGGCCTCTCAGAGGAGCCGG - Intergenic
1087838956 11:102903117-102903139 CACTTAGCTTTCTGAGTAGCTGG - Intergenic
1088398076 11:109390789-109390811 CTAGGAGCTCTCAGAGAAGCAGG - Intergenic
1089601017 11:119615185-119615207 CAAGGAGCTCTTTGAGGACAAGG - Intergenic
1089775364 11:120831943-120831965 CCCGGATCTCCTTGAGGAGCGGG - Exonic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1091486685 12:896147-896169 CACTGAGGACTCTGAGGTGCTGG - Exonic
1091757021 12:3060350-3060372 CCGGAAGCTCTCTGAAGAGCAGG - Intergenic
1096718690 12:53505801-53505823 CAGTGAGCTCTCTGAGGAGCAGG + Exonic
1097950127 12:65418688-65418710 CAGGGTACTCTCTGGGGAGCTGG - Intronic
1102029927 12:109734408-109734430 CAGTGAGCTTTCTGCGGAGCCGG - Intronic
1103851689 12:123937499-123937521 CACGGGGCTCCCTGACGGGCTGG + Exonic
1103954884 12:124570414-124570436 CAAGGGACTCTCTAAGGAGCTGG - Intergenic
1104670223 12:130675309-130675331 CACGGGGCGCTGTGTGGAGCAGG - Intronic
1106329370 13:28725280-28725302 GACGGAGCTCTCAGGGTAGCAGG - Intergenic
1106603732 13:31208932-31208954 CAGGGACCCCTCTGAGGAGGGGG - Intronic
1106754770 13:32811541-32811563 CAGGGAGCTCACAGAGGAGCAGG - Intergenic
1106900160 13:34347374-34347396 ACATGAGCTCTCTGAGGAGCAGG + Intergenic
1107827377 13:44340610-44340632 CACTGAGCTCCCTGGGGAGTGGG + Intergenic
1108580266 13:51822284-51822306 CACTGAGCTTCCTGAGGATCAGG - Intergenic
1113487596 13:110665689-110665711 CCCTGAACTGTCTGAGGAGCTGG - Intronic
1113696740 13:112351955-112351977 CACTGAGCACTCCGGGGAGCAGG + Intergenic
1114471815 14:22968335-22968357 CTTGGAGCTCTCTCAGGACCAGG - Intronic
1115536262 14:34376202-34376224 CACAGATCTCTTTGAGAAGCAGG + Intronic
1121009931 14:90513828-90513850 CTGGGAGCTCTCTGAGAGGCAGG + Intergenic
1121729076 14:96173857-96173879 CACCCAGCTCTGTGAGGAGAGGG + Intergenic
1122078841 14:99253235-99253257 GGCGGTGCACTCTGAGGAGCCGG - Intronic
1122498642 14:102178428-102178450 CAAGGAACTCACTGAGGATCTGG - Intronic
1122719416 14:103713968-103713990 GCGGGAGCTCTCTGAGAAGCTGG - Intronic
1122770927 14:104097354-104097376 AACGGGGCACTCAGAGGAGCTGG - Intronic
1122874865 14:104659379-104659401 CACGGATCTCACTGTGGAGGGGG - Intergenic
1123138917 14:106056134-106056156 CCCAGAGCTCTCTGTGTAGCAGG - Intergenic
1123756725 15:23402724-23402746 AAGGGAGCTCTCTGATCAGCTGG - Intergenic
1123995302 15:25713962-25713984 CTCGGAGCTTGCTCAGGAGCAGG - Exonic
1127103259 15:55588290-55588312 CACAGCGCCCTCTGAGGAGGAGG + Intronic
1127103509 15:55589646-55589668 CAGGAAGCACTCTGAGGAGAAGG + Intergenic
1129333942 15:74841499-74841521 CAGGGCGCTAGCTGAGGAGCAGG + Exonic
1129684638 15:77678008-77678030 CACAGAGCTTTCTGAGGAGGTGG - Intronic
1130995370 15:88900527-88900549 CATGGAGCACACTGCGGAGCTGG - Intronic
1132525488 16:412098-412120 CACGCAGGTGTCTGAGGACCAGG + Exonic
1132532844 16:462055-462077 GTCGGAGCTCACAGAGGAGCAGG - Intronic
1132746083 16:1436878-1436900 CACGGGGAGCTCTGGGGAGCAGG + Intronic
1135231790 16:20715487-20715509 CACTCAGCTGTCTGAGTAGCTGG - Intronic
1135733974 16:24916197-24916219 CACGGAGCTCCCAGAGAACCAGG + Intergenic
1136995812 16:35187525-35187547 CAGGGAGGTCTCTGTGGAGAAGG + Intergenic
1138554516 16:57763837-57763859 CACCGACCTCTCTCAGGACCAGG - Intronic
1141162451 16:81638446-81638468 CACGGGACTCTCTGAGGGGATGG + Intronic
1141509227 16:84501820-84501842 CACGGGGCTCTCAAAGGAGACGG - Intronic
1141609856 16:85175217-85175239 CATGGTGCTCTCTGGGGACCCGG - Intronic
1142368799 16:89666240-89666262 CTCGGACCTCACTGAGTAGCTGG - Intronic
1146162723 17:30568697-30568719 CACGCAGCTTGCTGAGGAGTGGG + Intergenic
1148440227 17:47708415-47708437 CACCGAGCTGACGGAGGAGCTGG + Exonic
1148708614 17:49659375-49659397 TACGAAGCTGTCGGAGGAGCTGG - Intronic
1149003869 17:51784182-51784204 CTGGGAGTTCTCAGAGGAGCTGG + Intronic
1149139985 17:53420628-53420650 CATGCAGCTCTGTGAGGAGATGG + Intergenic
1150867425 17:68868156-68868178 CCTGGAGCTCTCCAAGGAGCAGG - Exonic
1150876433 17:68975986-68976008 CCTGGAGCTCTCCAAGGAGCAGG - Exonic
1151188916 17:72383340-72383362 CACACAGCTCTCTGTGGAGTGGG - Intergenic
1152231271 17:79115258-79115280 CAAGGAGCTTTGTGATGAGCAGG - Intronic
1152715713 17:81899608-81899630 CAGGGGCCTCTCTGAGGAGGTGG - Intronic
1154030232 18:10746966-10746988 CACAGAGCTCACAGAGTAGCAGG - Intronic
1155112186 18:22726808-22726830 CACTCAGCTCTGTGAGGAGATGG + Intergenic
1156496531 18:37529451-37529473 GAGGGAGCTCACGGAGGAGCAGG + Intronic
1156625584 18:38903673-38903695 CACTGAACTAGCTGAGGAGCAGG - Intergenic
1160003556 18:75051057-75051079 CAAGGAGCTCTCGGTGTAGCAGG + Intronic
1160020105 18:75173719-75173741 CTCCGAGCTCTTTGAGGGGCTGG + Intergenic
1160455881 18:78999613-78999635 CTGGGACCTCTCTGAGCAGCTGG + Exonic
1160907200 19:1456932-1456954 CACGCAGCTCTCGGGCGAGCTGG - Exonic
1160909130 19:1466735-1466757 CACGTAGTTCTCCGACGAGCTGG - Exonic
1161008413 19:1948009-1948031 CACGAAGCTTTCAGAGGAACCGG - Intronic
1162018619 19:7858587-7858609 CACGGAGGCCTCTGAAGACCGGG + Intronic
1163508404 19:17721282-17721304 CAGGGAGATCTCTGAGGAGGGGG + Intronic
1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG + Exonic
1164676471 19:30104829-30104851 CACAGAGCTCTGTGGGGACCAGG - Intergenic
1167708377 19:51095256-51095278 CATGGGGGTCTCTGAAGAGCTGG - Intergenic
1168124379 19:54275599-54275621 CAGGGAGCTCACTGTGGATCAGG - Intronic
925029208 2:636499-636521 CACCGGCCCCTCTGAGGAGCAGG + Intergenic
925935528 2:8755252-8755274 CAGGATGCTCTCTGAGGAGGGGG - Intronic
926005845 2:9373075-9373097 CACTGAGCTCACTGCGGTGCTGG - Intronic
926302216 2:11612631-11612653 CCTGGGGGTCTCTGAGGAGCTGG + Intronic
926717534 2:15936935-15936957 CAAGGAGCTCACTGTGGACCAGG - Intergenic
928925870 2:36578782-36578804 TAAGGAGTACTCTGAGGAGCTGG - Exonic
929567989 2:43001701-43001723 CTGGGAGCTCTCTGAGGGGCAGG - Intergenic
930320954 2:49854147-49854169 CACTTAGCTTCCTGAGGAGCTGG - Intergenic
930793097 2:55355724-55355746 CATAGAACTCTCTGAAGAGCGGG - Exonic
933940291 2:87239557-87239579 CACGGAGGGCTCTGTGGACCAGG + Intergenic
934708525 2:96500973-96500995 CTGGGGGCTCTCTGGGGAGCTGG - Intronic
936352847 2:111726219-111726241 CACGGAGGGCTCTGTGGACCAGG - Intergenic
936689868 2:114873767-114873789 CATGCAGCTCTGTGAGGAGATGG + Intronic
943781211 2:191825903-191825925 CAGGGTGCTCCCTGAGGTGCAGG + Intergenic
945244079 2:207702292-207702314 CACTGAGAACTCTGAGGGGCAGG + Intergenic
946174561 2:217914423-217914445 CAGGCAGCTCCCTGTGGAGCTGG + Intronic
948569067 2:238906088-238906110 CCTGGAGGTCTCTGAGGACCTGG + Intronic
949035410 2:241813824-241813846 CACGGGGCTCTCTGGGGACAGGG - Intronic
949035427 2:241813883-241813905 CACGGGGCTCTCTGGGGACAGGG - Intronic
949035444 2:241813942-241813964 CACGGGGCTCTCTGGGGACAGGG - Intronic
1169845429 20:9986439-9986461 CAAGGAGCTCTCTGAGGTGGAGG + Intronic
1170744147 20:19083662-19083684 CACACAGCTCTGTGAGGAGATGG + Intergenic
1170916265 20:20628958-20628980 CACGGAGCTCTCTGAGGAGCTGG - Intronic
1171164942 20:22961379-22961401 CACAGAGCTCTGTGAAGACCTGG - Intergenic
1171967354 20:31540462-31540484 CACTGGGCTCTCTGAGGTGGAGG - Intronic
1172129791 20:32648001-32648023 CTCTGTGCCCTCTGAGGAGCAGG + Intergenic
1173480926 20:43398774-43398796 CATGGATCACTCTGAGGCGCAGG - Intergenic
1174096925 20:48097070-48097092 CACTCAGCGCTCTGAGGATCTGG - Intergenic
1174810216 20:53639018-53639040 CAGGGAGCTGACAGAGGAGCTGG + Intergenic
1175170510 20:57077036-57077058 CATGGAGCTCTCACTGGAGCTGG + Intergenic
1175398970 20:58689044-58689066 CAAGGACCTCCCTGAGCAGCTGG - Intronic
1176839527 21:13827538-13827560 CACGGGGCTCCCTCAGGTGCAGG + Intergenic
1178564788 21:33673395-33673417 CACGTAGCTATGTGAGGAGATGG + Intronic
1179726396 21:43343751-43343773 CACGGGGCGCTCTGGGAAGCAGG - Intergenic
1179966477 21:44809687-44809709 CCAGGAGGTCTCTGAGGAGCAGG + Intronic
1180133555 21:45844558-45844580 CACAGTGCTCACAGAGGAGCGGG - Intronic
1180183702 21:46129305-46129327 CACGGAGCTCACGCAGGACCCGG + Intronic
1181940212 22:26470070-26470092 CCCGGAGCTTCCTGAGGAGCAGG - Intronic
1182361353 22:29748262-29748284 CACTGGGCCCTCAGAGGAGCAGG - Intronic
1182497822 22:30722896-30722918 CACCTAGCTCTCCGAAGAGCTGG + Intronic
1183541147 22:38430099-38430121 CAGGGAGCTCTTTGAGAACCAGG - Intronic
1183560742 22:38570480-38570502 GAAGGAGCGCGCTGAGGAGCGGG + Intergenic
1183744644 22:39685636-39685658 CAAGGAGCTCCCTTCGGAGCAGG - Intronic
1184596059 22:45514932-45514954 CACTGAGCCCTGTGAGGAGCTGG + Intronic
1184727818 22:46356712-46356734 CACTGAGCTCCCAGGGGAGCAGG - Intronic
949970174 3:9397427-9397449 GCCGAGGCTCTCTGAGGAGCCGG + Intergenic
950005055 3:9686205-9686227 CACGGAGGCCTCTGAGGAGTAGG - Intronic
950041186 3:9920477-9920499 CACAGAGCCCTGTGAGGAGAGGG - Exonic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950758491 3:15198681-15198703 CACGCAGCTCTGTGAGAAGATGG - Intergenic
953514016 3:43572300-43572322 CTGGGATCTCTCTGTGGAGCAGG - Intronic
953741333 3:45541714-45541736 CTTGGAGCTGTGTGAGGAGCCGG - Intronic
961301322 3:125923975-125923997 CTCGGAGCTGTTTGAGGACCCGG - Intergenic
963604894 3:147405608-147405630 CAACTAGCTCTCTGGGGAGCAGG - Intronic
965480311 3:169210728-169210750 GAAGGAGCTCTCTGGGGAGGTGG - Intronic
966743711 3:183255493-183255515 GACTGAGCACTCTGAGGAGGAGG + Intronic
967309945 3:188096262-188096284 CAGGCAGTTCTCTCAGGAGCTGG + Intergenic
967859833 3:194142058-194142080 CACCGAGCTCCCTGTGTAGCCGG + Intergenic
967952691 3:194853161-194853183 CTCGGAGCTCACTGAGAAGTGGG - Intergenic
968009058 3:195261026-195261048 TACGGAGCTCCCAGAGCAGCAGG - Intronic
968137356 3:196228726-196228748 CCAGGAGCCCTGTGAGGAGCCGG + Intronic
968647670 4:1748551-1748573 TAGGGAGCTCTGTGAGGGGCAGG + Intergenic
968705389 4:2075211-2075233 CCTGGCGCTCTCTGAGGGGCTGG + Intronic
968756681 4:2419665-2419687 CACGGACCTTTCTGAGCACCTGG - Intronic
968761043 4:2442909-2442931 CAGGGAGCTCACTGGGGTGCTGG + Intronic
968761072 4:2442975-2442997 CAGGGAGCTCACTGGGGTGCTGG + Intronic
969904076 4:10376903-10376925 CACGGAGCTCCCTGGCCAGCCGG + Intergenic
970065346 4:12087560-12087582 CACCGAGCTCTCTGGGGAAATGG + Intergenic
970263357 4:14253372-14253394 CAAGGACTTCTCTGAGGAGGTGG - Intergenic
970434927 4:16023945-16023967 CACCGGTTTCTCTGAGGAGCTGG + Intronic
971193316 4:24448035-24448057 CACGGTTCTTTGTGAGGAGCTGG - Intergenic
973230492 4:47835404-47835426 ATAAGAGCTCTCTGAGGAGCAGG - Intronic
975789353 4:77931912-77931934 CACGCAGCGCTGTGAGGAGATGG + Intronic
976617624 4:87094376-87094398 CAGTGAGCTCTCTGAGGACAGGG + Intronic
977932288 4:102761627-102761649 CACGGAGGTTTCTGAGGTTCTGG + Intergenic
978222404 4:106292612-106292634 CATGCAGCTCTGTGAGGAGATGG + Intronic
978340851 4:107720183-107720205 CGCGGAGCGCGCTGAGCAGCCGG + Exonic
979623314 4:122819768-122819790 CACACAGCTCTGTGAGGAGATGG - Intergenic
982380016 4:154740316-154740338 CAAAGACTTCTCTGAGGAGCAGG + Intronic
984352069 4:178608248-178608270 CTCTGAGCTCTCTGAGAAACAGG - Intergenic
985547407 5:516683-516705 CACAGAGCTCTCTCAGGAGTGGG - Intronic
985605110 5:854102-854124 CACGGAGGACAGTGAGGAGCGGG + Intronic
985605275 5:854779-854801 CACGGAGGACAGTGAGGAGCGGG + Intronic
985753490 5:1698082-1698104 CACGCAGCTCTGTGAGGAGACGG - Intergenic
987417634 5:17680701-17680723 CACTAAGCTCTGTGAGGAGATGG + Intergenic
988090216 5:26529693-26529715 TACGCAGCTTTCTGAGCAGCTGG + Intergenic
997282615 5:132658315-132658337 CAGGGAGCTCATTGAGGAGCTGG + Exonic
999377477 5:151096763-151096785 CACTTAGCTCTCTGTGTAGCAGG + Intergenic
999896273 5:156037261-156037283 CAAGGAGCCATCTGAGCAGCAGG + Intronic
1006393316 6:33771606-33771628 CAGGGAGCAGGCTGAGGAGCTGG + Exonic
1007585136 6:42984747-42984769 CGCGGAGCTCTGGGAGGGGCCGG + Intronic
1007697705 6:43744255-43744277 CTAGGAGCTCTCTGAGGATAGGG + Intergenic
1007757371 6:44108613-44108635 CAGGGAGCTCAGTGGGGAGCAGG + Intergenic
1009523649 6:64716035-64716057 CATGCAGCTCTGTGAGGAGATGG - Intronic
1009674210 6:66795937-66795959 CATGTAGCTCTGTGAGGAGATGG - Intergenic
1010928450 6:81771447-81771469 CATTGACCTCTCTCAGGAGCTGG - Intergenic
1013466995 6:110426556-110426578 GAGGGAGATCTCTGAGGAGGAGG - Intronic
1013649087 6:112175409-112175431 CAAGGAAATCTCTGAGAAGCTGG - Exonic
1016041394 6:139435139-139435161 TACAGAGTTCTCTGAGAAGCTGG - Intergenic
1019125692 6:169838908-169838930 CACAGAGCTCTGGGCGGAGCAGG + Intergenic
1019494084 7:1329542-1329564 CAGGGAGCCCTCTGGGGGGCAGG - Intergenic
1019888981 7:3930180-3930202 CACAGACCTCTCCTAGGAGCTGG - Intronic
1023542124 7:41276759-41276781 CAGGTAGCTCTCTGTGTAGCTGG - Intergenic
1029811267 7:103051488-103051510 CACTGATCTCTCAGAGCAGCTGG - Intronic
1031478611 7:122251897-122251919 CACGGAGCTCTCCCTGGAGTTGG + Intergenic
1033611220 7:142964580-142964602 CTGGGAGCTGTCTCAGGAGCAGG + Intergenic
1034541114 7:151758890-151758912 GAAGGAGGTCTCTGAGGAGGCGG + Intronic
1035603420 8:912784-912806 CACGTTCCTCTCTGTGGAGCCGG + Intergenic
1036229008 8:6983741-6983763 CGCGATGCACTCTGAGGAGCTGG - Intergenic
1036231461 8:7002846-7002868 CGCGATGCACTCTGAGGAGCTGG - Intronic
1036236496 8:7043538-7043560 GGTGGTGCTCTCTGAGGAGCTGG - Intergenic
1036397853 8:8384112-8384134 CACTGGGCTATCTGAGGAGGTGG + Intronic
1036410154 8:8492442-8492464 CACGAAGCCCTCTGAGGCCCAGG + Intergenic
1037752466 8:21691827-21691849 GATGGAGCTCTCTTAGGAGCTGG - Exonic
1038147828 8:24914348-24914370 CAAGGAGCGCTTTGAGGAGGAGG + Exonic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041502438 8:58553442-58553464 CGCGGAGCCCCCTGAGGAGAGGG - Intronic
1043881089 8:85543798-85543820 CATGGAGCTCTCTGAGAAAAAGG + Intergenic
1045596305 8:103660104-103660126 CAGTGAGCTCTCTGAAGAGCAGG + Intronic
1047647215 8:126881653-126881675 TACCCAGCTCTCTGAGGAGAAGG - Intergenic
1049468545 8:142764763-142764785 CATGGAGCTCCCTGAGGCTCTGG + Intronic
1049575516 8:143388072-143388094 CCCGGTGCTCCCTGAGGACCAGG + Intergenic
1050092726 9:2031732-2031754 CAGGGAACTATCTGAGGGGCTGG - Intronic
1050305214 9:4299530-4299552 CGCGGAGCGCTCTGAAGGGCTGG - Exonic
1050428745 9:5539668-5539690 CAGGGGTCTCTCAGAGGAGCTGG + Intronic
1058229224 9:102405599-102405621 CATGCAGCTCTGTGAGGAGATGG + Intergenic
1060099751 9:120829118-120829140 CAGTCAGCTCTCTCAGGAGCTGG + Exonic
1060493806 9:124103324-124103346 CAGGAAGCTTTCTGAGTAGCTGG - Intergenic
1060765986 9:126295349-126295371 CACGAGGCTCTGTGAGGATCAGG - Intergenic
1061433712 9:130547366-130547388 CAAGGAGGTCCATGAGGAGCAGG - Intergenic
1061780656 9:132994329-132994351 CAGGGAGCTTGCTGAGGAGACGG - Intergenic
1062354537 9:136155533-136155555 AACGGAGCAGTTTGAGGAGCAGG - Intergenic
1203776231 EBV:74704-74726 CAGCCAGCTCCCTGAGGAGCCGG + Intergenic
1203791716 EBV:155175-155197 CGCTGAGGTCTCTGATGAGCTGG + Intergenic
1185614566 X:1413015-1413037 AACAGAGCTCCATGAGGAGCTGG + Intronic
1187711728 X:22061171-22061193 CACGCATCTCTCTAAGGCGCAGG - Intronic
1194672227 X:96748313-96748335 CACTGAGCTCTCTGAGGGTAAGG - Intronic
1196698151 X:118635917-118635939 CACAGAGCCCTCTGAGTAGCAGG + Intronic
1197150675 X:123217135-123217157 CAGGGAGGTCTCTGATGAGGGGG - Intronic