ID: 1170917240

View in Genome Browser
Species Human (GRCh38)
Location 20:20639059-20639081
Sequence CCTAGAACCCTTGTGGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 150}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170917229_1170917240 6 Left 1170917229 20:20639030-20639052 CCTGAAGTGTGCCCTCCTTCTGG 0: 1
1: 0
2: 1
3: 22
4: 163
Right 1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1170917232_1170917240 -5 Left 1170917232 20:20639041-20639063 CCCTCCTTCTGGGCTGACCCTAG 0: 1
1: 0
2: 3
3: 13
4: 161
Right 1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1170917228_1170917240 30 Left 1170917228 20:20639006-20639028 CCTCGAAGAATGAGGAGAGCAAA 0: 1
1: 0
2: 2
3: 15
4: 227
Right 1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1170917234_1170917240 -9 Left 1170917234 20:20639045-20639067 CCTTCTGGGCTGACCCTAGAACC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 150
1170917233_1170917240 -6 Left 1170917233 20:20639042-20639064 CCTCCTTCTGGGCTGACCCTAGA 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170917240 Original CRISPR CCTAGAACCCTTGTGGTTTG GGG Intronic
900912183 1:5606307-5606329 CCTCAAACCCATGTTGTTTGAGG + Intergenic
902378468 1:16041535-16041557 CCTAGAACCTTTGGGGTTTCTGG + Intergenic
902385118 1:16071992-16072014 CCTAGAACCTTTGGGGTTTCTGG + Intronic
904043258 1:27596145-27596167 GCTAGAACCCCTATGGTATGGGG + Intronic
906237836 1:44222515-44222537 CCTAGAACCCTGGAGGCTGGAGG + Intronic
909804735 1:79859629-79859651 CCTAGATCCATTGTTTTTTGGGG - Intergenic
911075753 1:93873330-93873352 CCTATAATCCTAGTGCTTTGAGG + Intronic
912508998 1:110175677-110175699 ACTAGAACCCTGGCTGTTTGAGG + Intronic
916526563 1:165615855-165615877 CCTAGAATCTTTATGGTTTCAGG + Intergenic
917559383 1:176130984-176131006 CCTAGGACCCTATAGGTTTGGGG + Intronic
919296439 1:195707564-195707586 TCTAGAATTCTTGTAGTTTGAGG - Intergenic
921903667 1:220474900-220474922 CCGAGAACCCTCGTGGTGAGTGG + Intergenic
924250337 1:242126689-242126711 TCTAGAATCTTTGTGGTTTCAGG - Intronic
1065252704 10:23832642-23832664 CCTAAAACCCTTGTAATCTGTGG - Intronic
1068984492 10:63094599-63094621 CCTAGAACCCTCCAGGCTTGAGG - Intergenic
1068993253 10:63173298-63173320 TCTAGAACCATTATAGTTTGAGG - Intronic
1069054313 10:63829052-63829074 CCTAGCTCCCTGGTGGTTAGTGG - Intergenic
1069139991 10:64810696-64810718 CCTTGACCCCTTGTGCTTTCTGG + Intergenic
1069949868 10:72011372-72011394 CTGGGAACCCTTGGGGTTTGGGG + Exonic
1071360233 10:84839115-84839137 ACCAGAACCACTGTGGTTTGGGG + Intergenic
1071501102 10:86204878-86204900 CCGAGAACCCTTGGGGCTGGTGG - Intronic
1073758606 10:106607281-106607303 CCTGGAACCCCTGTGGCCTGAGG + Exonic
1074672220 10:115804674-115804696 CCTTGAGCCTTTGTTGTTTGTGG - Intronic
1074828392 10:117231162-117231184 TCTTGGACCTTTGTGGTTTGAGG - Intergenic
1075073421 10:119334180-119334202 CCTGGAACCCCAGTGCTTTGAGG + Intronic
1076699299 10:132262318-132262340 CCTAGAACTTTTATAGTTTGAGG - Intronic
1077829751 11:5853775-5853797 TCTAGAACTTTTATGGTTTGAGG - Intronic
1080397327 11:31902187-31902209 ACAAGAACTCTTGCGGTTTGGGG - Intronic
1081691152 11:45079611-45079633 ATTAGAAACCTTGTGCTTTGGGG - Intergenic
1085242281 11:75067802-75067824 CCTGGAATCCTAGTGCTTTGGGG + Intergenic
1086080532 11:82899307-82899329 CCTTGATCTCTTGGGGTTTGTGG - Intronic
1086756026 11:90563126-90563148 TCTAGAATTCTTGTGGCTTGAGG - Intergenic
1091510596 12:1120249-1120271 CCTATAATTCTTGTGCTTTGGGG - Intronic
1092456020 12:8643496-8643518 CCTAGAACCATGTTGATTTGGGG + Intronic
1092710027 12:11326242-11326264 CCTTGAACCCCTGTGGTCAGGGG + Intergenic
1092743602 12:11653059-11653081 CCTACAACCCTTGAAGGTTGTGG + Intronic
1092771679 12:11902787-11902809 CCTAGAAGTCTTGCCGTTTGAGG + Intergenic
1094608905 12:31974293-31974315 CCTAAAACTCTTGTAGATTGGGG - Intronic
1096389328 12:51217280-51217302 CCTGGAGCCCTTGTGGGGTGCGG - Intronic
1100174546 12:92014417-92014439 CCTAGAATTCTTATAGTTTGAGG + Intronic
1105069713 12:133227157-133227179 GCTAGAAGTCTTGTTGTTTGGGG - Intronic
1105235824 13:18552633-18552655 CCTAGGATTCTTGTAGTTTGAGG + Intergenic
1109339265 13:61034171-61034193 TCTAGAACCCATGTGGGATGTGG + Intergenic
1111375170 13:87368662-87368684 CCTGGATCCCTTGTGCTTTCTGG + Intergenic
1118110348 14:62711531-62711553 CATAGCTCCCTTGAGGTTTGAGG + Intronic
1121096499 14:91221185-91221207 CATAGCAGCCATGTGGTTTGGGG + Intronic
1122489016 14:102100960-102100982 ACTAGAAGCTTTGTGATTTGTGG - Intronic
1127266694 15:57367896-57367918 CTTAGATGCCTTCTGGTTTGAGG + Intergenic
1130212580 15:81938666-81938688 CACAGAGCCCTTGTGCTTTGAGG + Intergenic
1132091787 15:98953288-98953310 CCTCGACACCTTGTGGCTTGGGG - Intronic
1132096413 15:98988279-98988301 CCTAGGACCCTTGAGCTTGGTGG + Intronic
1137704096 16:50521936-50521958 GCAGGAACCCTTGTGGATTGAGG + Intergenic
1137753727 16:50885476-50885498 GCTAGAACCTTTGTGATGTGTGG - Intergenic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1151079259 17:71309771-71309793 TCTAGAATCTTTGTGGTTTCAGG - Intergenic
1151548542 17:74808041-74808063 GCTGCAACCCTTGTGGTTTAGGG - Intronic
1154513718 18:15137365-15137387 CCTAGGATTCTTGTAGTTTGAGG - Intergenic
1157815692 18:50728201-50728223 CCTAGAACCCTGGGGTTGTGGGG - Intronic
1162428807 19:10614342-10614364 CCTCACACCCATGTGGTTTGAGG - Intronic
1167443312 19:49522688-49522710 CCTAGAATCCTGGCGCTTTGGGG - Intronic
926009023 2:9393878-9393900 CCCAGAAGCCTTGTGTGTTGAGG - Intronic
926670241 2:15570313-15570335 GCTAGCACTCTTGTTGTTTGTGG + Intergenic
927036318 2:19180614-19180636 TCTAGAATCCTTATGGTTTCAGG + Intergenic
928436694 2:31259110-31259132 CTTGGAACCCTTGTGCTATGGGG + Intronic
929310905 2:40423041-40423063 TGTAGAACCCTTTTTGTTTGTGG - Intronic
931585757 2:63825473-63825495 CCTAGAACTCTTTTGGCTCGAGG - Intronic
932463470 2:71898145-71898167 CCTAGAGCCTTTGTGCTTGGAGG + Intergenic
933643414 2:84788303-84788325 CCTAGAATCCTTGATGTTTCAGG + Intronic
934614529 2:95763003-95763025 CCATGAACCTTTGGGGTTTGTGG - Intergenic
935234328 2:101125588-101125610 TCTTGAATGCTTGTGGTTTGTGG - Intronic
936819726 2:116505334-116505356 TCTAGAATTCTTATGGTTTGAGG + Intergenic
938513957 2:131981976-131981998 CCTAGGATTCTTGTAGTTTGAGG - Intergenic
940307738 2:152244624-152244646 CCTAGAACTCTTCTGGATAGAGG - Intergenic
942041913 2:172075214-172075236 CCAAGCACACTTGTGATTTGAGG - Intronic
942681872 2:178485247-178485269 GCTAGAACCCTTGTCTTCTGTGG + Intronic
947064358 2:226204824-226204846 CCTACAATCCTTGGGATTTGGGG + Intergenic
947584542 2:231345625-231345647 CCTAGACCCCTTGTGGGCTAAGG + Intronic
948325301 2:237114409-237114431 CCTAGAACCTCTGTTATTTGGGG + Intergenic
1169977972 20:11352278-11352300 CCTAGAATCCTTGAGGTTTGGGG - Intergenic
1170166273 20:13362968-13362990 CCTAATACCCTTGTAGATTGGGG + Intergenic
1170917240 20:20639059-20639081 CCTAGAACCCTTGTGGTTTGGGG + Intronic
1176779825 21:13180919-13180941 CCTAGGATTCTTGTAGTTTGAGG + Intergenic
1177125399 21:17187195-17187217 TCTAGAATCTTTATGGTTTGAGG - Intergenic
1177977473 21:27869945-27869967 CCTAGGATTCTTGTAGTTTGAGG + Intergenic
1178608779 21:34061969-34061991 CCAAGCAGCCTTGTGATTTGAGG + Intergenic
1182365428 22:29775735-29775757 CCTGGAACCCCTCTGCTTTGTGG + Intergenic
949120999 3:383830-383852 GCTTGAACCCTTATGTTTTGTGG - Exonic
950840333 3:15962504-15962526 TCTAGAATCTTTGTGGTTTCAGG + Intergenic
950842849 3:15984231-15984253 CCTAGAATTTTTGTAGTTTGAGG + Intergenic
951021712 3:17788299-17788321 TCTAGAACTCTTATAGTTTGAGG + Intronic
951915538 3:27797285-27797307 CCTAGAACCCTCATGGTAAGTGG + Intergenic
951950031 3:28189915-28189937 CCTAAACCCCTTGTTGTTTGAGG + Intergenic
952011912 3:28909306-28909328 CCTACAACCCCTGTGGTTGGAGG + Intergenic
952134718 3:30404388-30404410 CCTAGAACTCCTGTTGTATGAGG + Intergenic
957463858 3:80559683-80559705 TCTAGAACTTTTGTGGTTTCAGG + Intergenic
959693299 3:109222596-109222618 TCTAGAACTTTTGTAGTTTGAGG - Intergenic
961070370 3:123918741-123918763 GCTAGAACACTTGGGGTTAGCGG + Intronic
963791383 3:149586517-149586539 CCTATAACCCTTGTAGATAGGGG + Intronic
973571005 4:52239627-52239649 CCTGGATCCATTGTGGCTTGTGG + Intergenic
973733453 4:53845969-53845991 CATAGCATCCCTGTGGTTTGGGG - Intronic
977907248 4:102491783-102491805 TCTAGAACTTTTGTAGTTTGAGG - Intergenic
979553972 4:122023728-122023750 CCTAGAATCTTTATGGTTTCAGG - Intergenic
981131509 4:141162686-141162708 CCTTGACCCCTTGTGGTTCTGGG - Intronic
984781740 4:183532754-183532776 CCTGGAAACCTCTTGGTTTGTGG + Intergenic
986355260 5:6917861-6917883 CCTAGAATCTTTATGGTTTCAGG - Intergenic
992037383 5:72793685-72793707 CCTAGATCCCTCATGGTTTTGGG - Intergenic
993536440 5:89092404-89092426 CTTAGAGCCCCTGTGCTTTGGGG - Intergenic
996578037 5:124998341-124998363 GCTAGATTCCTTTTGGTTTGGGG + Intergenic
996921418 5:128771967-128771989 CTTAGTACCTGTGTGGTTTGGGG - Intronic
996961965 5:129262035-129262057 CCTAGAATCTTTATGGTTTCAGG + Intergenic
999591497 5:153152827-153152849 TCTAGAATTCTTATGGTTTGAGG - Intergenic
1000128300 5:158269122-158269144 CTTAGAAGCCTTGTGATTTTTGG + Intergenic
1001715601 5:173812963-173812985 CCTAGGATTCTTGTAGTTTGAGG - Intergenic
1003658003 6:8031998-8032020 TCTAGAACTCTTATGGTTTTAGG - Intronic
1004451757 6:15754183-15754205 CCTAGAACCCGTGGGGTTCTAGG - Intergenic
1004801915 6:19157828-19157850 CCTAAAACCCTTGTGTATAGGGG - Intergenic
1005626888 6:27670746-27670768 CCTTGAATCAGTGTGGTTTGGGG - Intergenic
1008873360 6:56299242-56299264 CATAGAACCTTTCTGCTTTGGGG + Intronic
1010637351 6:78277335-78277357 TCTAGAATCTTTGTGGTTTCAGG + Intergenic
1012717172 6:102690088-102690110 TCTAGAATCTTTGTGGTTTCAGG + Intergenic
1013116905 6:107110393-107110415 CCCAGAGCTCTTGTGGTTTCTGG - Intronic
1014208790 6:118686668-118686690 CCAAGAACACTTGTGTGTTGAGG + Intronic
1014542460 6:122693185-122693207 CCTTGAAGCCTTGTGTTCTGGGG - Intronic
1015773033 6:136788307-136788329 TCTAGGACTCTTATGGTTTGAGG - Intronic
1021229225 7:18065122-18065144 CCTAGAAATCTTGTAGTTTGAGG - Intergenic
1022625454 7:32031786-32031808 CCTAGAACCCTTGTGGTAGAGGG - Intronic
1023985073 7:45089288-45089310 CCTAGAACCCTGGTTGTGGGAGG + Intergenic
1024205433 7:47155551-47155573 GCTAGAGCCCTTCTGGTGTGGGG - Intergenic
1026328916 7:69335302-69335324 CCTATAATCCTTGTGCTTTGGGG - Intergenic
1027631476 7:80611139-80611161 CCTATAATCCCAGTGGTTTGTGG - Intronic
1032998925 7:137481270-137481292 CTTAGTACCTTTGTGATTTGGGG + Intronic
1035356960 7:158281718-158281740 CCTGGACTCCTTGGGGTTTGGGG - Intronic
1036436647 8:8740770-8740792 CCTAGGACCTTTATAGTTTGAGG - Intergenic
1036837082 8:12081293-12081315 CCTAGAATCTTTATGGTTTTGGG - Intergenic
1036858876 8:12327538-12327560 CCTAGAATCTTTATGGTTTTGGG - Intergenic
1038820505 8:30947840-30947862 CCTAAAACCCTTGTAGATAGGGG + Intergenic
1039885689 8:41652933-41652955 CCAAGAACCCTGGTGGGTTGTGG + Intergenic
1041363939 8:57082005-57082027 CCTAGAATTTTTATGGTTTGGGG - Intergenic
1043957829 8:86382704-86382726 ACTAGAACCCTGGTTTTTTGCGG - Intronic
1044054333 8:87549634-87549656 CCTAGAATTCTTATGGTTTAAGG + Intronic
1044704196 8:94992881-94992903 CTTAAACTCCTTGTGGTTTGGGG - Intronic
1045103155 8:98865606-98865628 CCTATAATCCTAGTGCTTTGGGG - Intronic
1047382914 8:124380753-124380775 CCTTGAACCCTTGAAGTTAGAGG + Intergenic
1049367537 8:142247861-142247883 CCCAGCACCCTTGTGGTGTCTGG + Intronic
1050449240 9:5762456-5762478 CCTATAAACCTTATGGATTGGGG + Intronic
1050816588 9:9820595-9820617 TCTAGGATTCTTGTGGTTTGAGG + Intronic
1051707573 9:19896629-19896651 TGTAGTACCTTTGTGGTTTGGGG - Intergenic
1052146946 9:25061444-25061466 CCTAGGGCCCTTGTGGTGTAGGG + Intergenic
1054940925 9:70740843-70740865 CCTAGAACTGTTGTGGTTTCAGG - Intronic
1056433703 9:86554459-86554481 CCTATAATCCTAGTGCTTTGAGG - Intergenic
1056594579 9:87996293-87996315 ACTAGAAACCTAGTGGTTTCAGG - Intergenic
1056861836 9:90192388-90192410 CCTTGACCCCTTGTGCTTTCCGG - Intergenic
1057339032 9:94182804-94182826 CCTAGAAGCTTTGTGGTCTCAGG - Intergenic
1061593834 9:131615850-131615872 CATAGAAACCTTGTGGGTGGCGG - Intronic
1187589252 X:20698174-20698196 TCTAGAATCCTTATGGTTTCAGG - Intergenic
1189653868 X:43220557-43220579 CCTATAACCCCAGTGCTTTGGGG - Intergenic
1191908351 X:66120517-66120539 TCTAGAATCCTTATGGTTTTAGG + Intergenic
1193736752 X:85166156-85166178 TCTAGAATTTTTGTGGTTTGGGG - Intergenic
1196128242 X:112123426-112123448 TCTAGAGCTTTTGTGGTTTGGGG + Intergenic
1196927421 X:120647287-120647309 TATAGAACCCTTGTTTTTTGAGG + Intergenic
1198515179 X:137400057-137400079 CCTAGAGCCCTTGAGCTTTAAGG - Intergenic