ID: 1170918458

View in Genome Browser
Species Human (GRCh38)
Location 20:20652294-20652316
Sequence AAAGATGAACAGGTGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170918458 Original CRISPR AAAGATGAACAGGTGCAGTT TGG (reversed) Intronic
901252756 1:7793665-7793687 GATGATGAACATGGGCAGTTTGG + Intronic
901760439 1:11467732-11467754 AAAGGTGAACAGATGCAGGAAGG + Intergenic
902320891 1:15664964-15664986 AAAGATAACCAGTTGCAGCTAGG + Exonic
902405960 1:16183757-16183779 AAATGTGGACAGGTGCAGTCGGG - Intergenic
903917177 1:26773111-26773133 AAGGATGAAGAGGGGTAGTTAGG - Intronic
904174049 1:28613246-28613268 AAAGATGTCCAGCTGCATTTAGG - Exonic
905657498 1:39694243-39694265 TATGATGAACAGGTGAAGCTGGG - Intronic
906110488 1:43318972-43318994 AAAGAGGAGAAGGTGCAGTATGG + Intronic
906220625 1:44076094-44076116 ACAGGTGACCAGGTGCAGTTTGG - Intergenic
906451911 1:45957492-45957514 AAAGAAGAACACGTACAGTTGGG - Intronic
908028437 1:59974857-59974879 AGGGGTGAACTGGTGCAGTTTGG - Intergenic
908077096 1:60532129-60532151 AAAAATGAGATGGTGCAGTTGGG - Intergenic
909597382 1:77421856-77421878 ACAGGAGAACATGTGCAGTTAGG - Intronic
911363032 1:96902689-96902711 CAAGATGAAAAGGTGCTGTTAGG + Intergenic
912838684 1:113019777-113019799 ACAGATGCAGAGGTGGAGTTTGG - Intergenic
913670830 1:121096096-121096118 AAAGAAGAACAGCTGCAGGAAGG + Exonic
914022593 1:143883519-143883541 AAAGAAGAACAGCTGCAGGAAGG + Intergenic
914196422 1:145450353-145450375 AATGATGAACAGGTGGAGGGAGG + Intergenic
914391455 1:147226703-147226725 CAAGATTAGCAGGTGCAGATTGG - Intronic
914661079 1:149791461-149791483 AAAGAAGAACAGCTGCAGGAAGG + Exonic
914975788 1:152360083-152360105 AAATATGTAGAGGTGGAGTTAGG - Intergenic
915835839 1:159173730-159173752 ATTGCTGAACAGTTGCAGTTTGG - Intronic
916422740 1:164651634-164651656 AAAGAAGAACAGTTGAAGGTGGG + Intronic
917941917 1:179930963-179930985 TAAGTTGAACAGGAGAAGTTTGG + Intergenic
920636174 1:207706120-207706142 AAAGATGAAAAGGAGAAGATAGG + Intronic
920766722 1:208840620-208840642 AAAGAAGGGCAGGTGCAGTGAGG - Intergenic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
923691780 1:236201248-236201270 AAAGATGATCAGGCACAGTCAGG - Intronic
924422003 1:243918297-243918319 GAAGATAAACAGGTTTAGTTGGG - Intergenic
924546552 1:245033170-245033192 AAAGGTCACCAGGTCCAGTTGGG - Intronic
924855715 1:247873282-247873304 GAAGATGGACATGCGCAGTTTGG + Intronic
1064296037 10:14079982-14080004 TAACATGAGCAGCTGCAGTTAGG + Intronic
1064613594 10:17129373-17129395 GCAGATGAGCAGGGGCAGTTGGG - Intronic
1066454711 10:35563137-35563159 AAAGATGTGCTGCTGCAGTTTGG + Intronic
1066670619 10:37834387-37834409 ATAGCTGATCAGGTGCAGGTTGG - Intronic
1067980768 10:51082048-51082070 AAAGATGATCAGGTGGGGTGCGG - Intronic
1069814140 10:71182870-71182892 ACAGATGAACAGGGGAAGTAGGG + Intergenic
1070393426 10:75990736-75990758 AAAGAGGAAATGGTCCAGTTTGG + Intronic
1073963703 10:108963718-108963740 AAAGCAGACCAGGTGCAGTGTGG - Intergenic
1074252799 10:111769509-111769531 TAAGATGAAGAGTTGAAGTTGGG + Intergenic
1075738162 10:124676840-124676862 AAAGCTGGCCAGGGGCAGTTTGG - Intronic
1076550417 10:131274353-131274375 AAAACTGAACAAGTGCAGCTGGG - Intronic
1078076779 11:8169230-8169252 AAAGATGAACATGGGGAGTGAGG - Intergenic
1079728275 11:23905285-23905307 AAGGATGAAAAGGGTCAGTTAGG + Intergenic
1079780436 11:24595532-24595554 AAAAATTGACAGGTGCACTTTGG - Intronic
1079897676 11:26142482-26142504 AAAGATGAACAGATGGAATGAGG + Intergenic
1080192767 11:29571183-29571205 AAAGGGGCCCAGGTGCAGTTTGG - Intergenic
1080210244 11:29777705-29777727 AAAGATTAAAAGGGGCAGATGGG + Intergenic
1082269890 11:50158917-50158939 AAAGATGAAAAGGAGCAAGTCGG + Intergenic
1084795755 11:71503292-71503314 AAAGATGATCAGGTGAGGCTGGG + Intronic
1086596756 11:88581508-88581530 AAAGATGAATTGTTGCAGATTGG + Intronic
1087946231 11:104163910-104163932 AAAGATGAGCCGGTGCATTTGGG + Exonic
1088620142 11:111673472-111673494 AAAGGTAAACAGCTCCAGTTTGG - Intronic
1091451265 12:573408-573430 AAAGATAAACACGTGCAGTCTGG + Intronic
1091757234 12:3061998-3062020 GATGGTGAACAGGTGCAGTGGGG - Intergenic
1093308158 12:17544562-17544584 AAATGCGAACAGGTGCTGTTAGG + Intergenic
1094325587 12:29234580-29234602 AAAGTTGACCAGTTGCAGTGTGG - Intronic
1095310632 12:40693000-40693022 AAAGATGAGCAGGTGCGGGCCGG - Intronic
1102482659 12:113234365-113234387 AAGGATGAAGAGGAGCAGTTTGG + Intronic
1102512984 12:113428252-113428274 AAACATGAACTCGTGCAGATGGG + Intronic
1103355378 12:120316013-120316035 AAAGACAAACAGGTACACTTTGG - Intergenic
1105257200 13:18751650-18751672 AAAGATGCGCAGGTACAGCTTGG - Intergenic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1106575669 13:30972203-30972225 AAAGATGAATCTGTGCAGTAAGG + Intronic
1107820584 13:44282184-44282206 GAAGATGAAAATGGGCAGTTTGG - Intergenic
1108105787 13:47007387-47007409 AAAGATGGGCAGGTGCAGGTAGG + Intergenic
1108320071 13:49281188-49281210 TTAGCTGAACAGTTGCAGTTAGG - Intronic
1108368954 13:49747853-49747875 AAAGATGACTGGGTACAGTTAGG - Intronic
1108554703 13:51581724-51581746 AAGGGTGAGCAGGTGCAGTCTGG - Intergenic
1109288236 13:60437559-60437581 AAAGTTGAAGAGGTGAATTTTGG + Intronic
1110274036 13:73622568-73622590 AAAGATAAACATAAGCAGTTTGG - Intergenic
1110670007 13:78166817-78166839 AAAGATGCAAAGTTTCAGTTAGG - Intergenic
1115473991 14:33796942-33796964 ACAGATGCACAGGTGCACCTTGG - Intronic
1118231561 14:63955798-63955820 AAAAATGAACAGAAGCATTTTGG - Intronic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1120625856 14:86825632-86825654 AAAGTGTAACAAGTGCAGTTTGG + Intergenic
1122625081 14:103080926-103080948 AATGATGAACAGGTGCTGAGCGG + Intergenic
1123097449 14:105773233-105773255 ACAGGTGAACAGGGGCAGGTGGG - Intergenic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1124517138 15:30376282-30376304 AAAGTTAAACAGCTGCAGTGTGG + Intronic
1124725806 15:32154712-32154734 AAAGTTAAACAGCTGCAGTGTGG - Intronic
1125838496 15:42775331-42775353 CAAGATGAAAAGCTCCAGTTAGG - Exonic
1126358257 15:47818774-47818796 ACAGATCAACAGCTGGAGTTAGG + Intergenic
1126471126 15:49011961-49011983 AAACATGAACATGAGAAGTTTGG + Intronic
1127981840 15:64041186-64041208 AAAGATGGACAGGAGGAGTGAGG + Intronic
1128614776 15:69100614-69100636 AGAGATGACCAGCTGCAGCTTGG + Intergenic
1129955186 15:79629971-79629993 AAAGATGAAGAGGTCAAGTCTGG - Intergenic
1131779521 15:95841553-95841575 AAAAATGAATAGTTGCAATTTGG - Intergenic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133356865 16:5143164-5143186 AACCATGCACAGGTCCAGTTAGG - Intergenic
1134776807 16:16860258-16860280 AAAGCTGGAAAGGTGAAGTTTGG - Intergenic
1135845926 16:25918568-25918590 AAGGATGAGCAGGTGTGGTTTGG + Intronic
1139898086 16:70304336-70304358 AAAGATGAACAGATGAACCTCGG - Intronic
1144245316 17:13356992-13357014 AGGGATGAATAGGTGCAGTACGG - Intergenic
1144251165 17:13418125-13418147 AAAGATACACACGTGCACTTTGG + Intergenic
1145891914 17:28423045-28423067 AAAGATGAAGATGTGCAGGTGGG - Intergenic
1146086122 17:29831556-29831578 AAAGATAAACAGTTGCATTCTGG - Intronic
1146175216 17:30661797-30661819 ATAGATGAACTGATGTAGTTTGG - Intergenic
1146348668 17:32077831-32077853 ATAGATGAACTGATGTAGTTTGG - Intergenic
1147746951 17:42700629-42700651 AAAGATGAAGAGGAGGAGTTAGG - Exonic
1150195452 17:63293624-63293646 AAATATAAACAGCTGCAGCTAGG - Intronic
1151141482 17:71996701-71996723 AAAGATGAAGACGTGCAATGGGG + Intergenic
1153162035 18:2217195-2217217 AAAGATTAACAAGTGCACATGGG + Intergenic
1153622345 18:6990752-6990774 AAAGATGGGCAGGTGGAATTTGG - Intronic
1154113873 18:11593925-11593947 AAGTATGACCAGGGGCAGTTAGG - Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154426158 18:14273789-14273811 AAAGATGCACAGGTACAACTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154430705 18:14306321-14306343 AAAGATGGACAGGTACAGCTTGG + Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154481843 18:14836540-14836562 AAAGATGAACATGGGGAGATGGG - Intronic
1156317765 18:35986730-35986752 AAAGAGAAACAAATGCAGTTTGG - Intronic
1156584477 18:38416436-38416458 GTAGATGAGCAGGTGCAGTTTGG - Intergenic
1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG + Intronic
1159454023 18:68638515-68638537 AAAGACCATCAGGTGCAGTCAGG + Intergenic
1162406158 19:10475151-10475173 AAAGGTGAACAAGGGCAGTGGGG + Intergenic
1162923552 19:13918461-13918483 TTAGAAGAAGAGGTGCAGTTGGG - Intronic
1165202488 19:34156537-34156559 AGAAATGAACAGGTACAGGTTGG + Intergenic
1165323278 19:35099400-35099422 AAAAAAGAACAGTGGCAGTTTGG + Intergenic
1166197241 19:41215263-41215285 AAAGATGGACAGGTGGTGCTGGG - Intergenic
1166220385 19:41360470-41360492 ACAGATAAACGAGTGCAGTTGGG - Intronic
1166898174 19:46036940-46036962 CAGGATGAACAGCTGCAGATAGG + Intergenic
1167403888 19:49291244-49291266 ACAGATGAATAGGTGGAGATAGG - Intronic
1167403954 19:49291792-49291814 ACAGATGAATAGGTGGAGATAGG - Intronic
1168368556 19:55811461-55811483 AATGATGAACAGCTGCAGCAGGG + Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925490022 2:4381078-4381100 AATGCTGAACAGGTGCAACTGGG + Intergenic
927317081 2:21696217-21696239 GATGAAGAACAGGTGCAGTGTGG - Intergenic
929121849 2:38490010-38490032 AAAGAATGACAGGTGCAGTGGGG - Intergenic
931643324 2:64400243-64400265 AGAGAGGAAGAGGTGAAGTTAGG + Intergenic
933210328 2:79559644-79559666 AAAGATGATCAAATGCACTTTGG + Intronic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934493683 2:94779740-94779762 AAAGATGTACAGGTACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
937159764 2:119749049-119749071 AGGGATGAACAGGTGCAGCACGG - Intergenic
937788051 2:125925429-125925451 AAAGATGAACAGATGAATTCCGG + Intergenic
938280120 2:130057854-130057876 AATGATGCACAGGTACAGCTTGG - Intergenic
938331077 2:130448569-130448591 AATGATGCACAGGTACAGCTTGG - Intergenic
938358871 2:130672934-130672956 AATGATGCACAGGTACAGCTTGG + Intergenic
938435264 2:131279587-131279609 AATGATGCACAGGTACAGCTTGG + Intronic
938629100 2:133146027-133146049 AAATATGAACATGAGCAGTATGG - Intronic
939400741 2:141690528-141690550 GAAGATGATCAGTTACAGTTGGG + Intronic
940553407 2:155191021-155191043 ATAAATGAATAGGTGCAGTGGGG - Intergenic
941278136 2:163516780-163516802 AAATATGAAGAGGTGCATTTTGG + Intergenic
941924891 2:170884819-170884841 AAAGATGAGAAAGTGCTGTTTGG - Intergenic
942480931 2:176387409-176387431 AGAGATGAAGAGATGCAGTCTGG - Intergenic
942735446 2:179106050-179106072 AAAAATGAAAAGCTTCAGTTGGG - Exonic
943584149 2:189718155-189718177 AATGATGAAAATGTTCAGTTGGG + Intronic
945328335 2:208509817-208509839 GAAGCAGCACAGGTGCAGTTTGG - Intronic
945517450 2:210779965-210779987 AAAGTTGAAGAGGTTCATTTTGG + Intergenic
946829251 2:223711320-223711342 TAAGGGGTACAGGTGCAGTTTGG + Intergenic
947152683 2:227131042-227131064 TAAGATGATCTGGTGCTGTTTGG - Intronic
948047900 2:234957779-234957801 AAAGCTGAGGGGGTGCAGTTTGG + Intronic
948292426 2:236835698-236835720 AAAGAGGACAAGGTGCAGCTTGG - Intergenic
1168925136 20:1573076-1573098 AAAGATAAAGAGGTGCAATTTGG - Intronic
1168929013 20:1606104-1606126 AAAGATAAAGAGGTGCAATTTGG - Intronic
1170075030 20:12410089-12410111 AAAGATAAAGAGGCTCAGTTGGG + Intergenic
1170918458 20:20652294-20652316 AAAGATGAACAGGTGCAGTTTGG - Intronic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1171885292 20:30647535-30647557 AAAGATGTACAGGTACAGCTTGG - Intergenic
1172860692 20:38048535-38048557 AAATATGAAAAGCTGCAGTGGGG + Intronic
1176798759 21:13400076-13400098 AAAGATGAACATGGGGAGATGGG + Intergenic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176844097 21:13863294-13863316 AAAGATGCACAGGTACAGCCTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176846775 21:13882617-13882639 AAAGATGCACATGTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1177969101 21:27766217-27766239 AAAGATGGACAGGACAAGTTAGG + Intergenic
1177969505 21:27771171-27771193 AAAGATGAAAAGGTAAAATTGGG - Intergenic
1178420876 21:32442372-32442394 CAAGATCAAAAGGTGAAGTTAGG - Intronic
1179014624 21:37585225-37585247 AAAGTTGAACAGAAGCAGTCAGG + Intergenic
1179282339 21:39944707-39944729 GAAGTTGAACAGGTGGAGATAGG + Intergenic
1179900480 21:44390879-44390901 GCAGATGAACAGGTGCATATTGG - Intronic
1180363268 22:11918474-11918496 AAAGATGCACAGGTAAACTTGGG + Intergenic
1180711899 22:17844918-17844940 AATGATGAGCTAGTGCAGTTAGG - Intronic
1183101736 22:35588429-35588451 AAAAATGAACAGGAGCAGGGTGG - Intergenic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
950748750 3:15111972-15111994 CAAGATGAACAGGTTTATTTGGG + Intergenic
951090977 3:18573638-18573660 GCAGAAGAACAGATGCAGTTGGG - Intergenic
954287493 3:49629417-49629439 GAAGATGAGAAGATGCAGTTGGG + Intronic
954870060 3:53761075-53761097 GAAGTTGAACAGATGGAGTTGGG + Intronic
957780879 3:84816109-84816131 AAAGATGAAGGTGTGTAGTTTGG - Intergenic
960135182 3:114097429-114097451 AAGAATGAACAGGGGCAGCTTGG + Intergenic
960292676 3:115905465-115905487 AAAACTGAACAGGTACATTTTGG - Intronic
964092573 3:152893848-152893870 ACATATGAAAAGGTGCATTTTGG + Intergenic
965069492 3:163900251-163900273 AAAGATTGTCAGGTGCAGTAAGG - Intergenic
966959166 3:184916209-184916231 AGAGATGAACATGTACAATTTGG + Intronic
970763122 4:19515786-19515808 AAAGTAAAACAGATGCAGTTTGG - Intergenic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
971705249 4:30033386-30033408 AAAGAAGAAAAGGTGGAGATGGG + Intergenic
971935700 4:33144206-33144228 AAAGATAAAGAGGTGAGGTTTGG - Intergenic
972246898 4:37254736-37254758 AAAGATGAAAAACTGCAGCTTGG + Intronic
973260351 4:48157507-48157529 AAAGAAGAAGCGGTGCAGATTGG - Intronic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
973998526 4:56485306-56485328 AAAGTTGGACAGGTACAATTAGG + Intronic
974368856 4:60987926-60987948 AAAGAGGAAGAGGAGCTGTTTGG - Intergenic
974766631 4:66355467-66355489 AAAGATGAACAAGAGCAGTTTGG + Intergenic
974857422 4:67477055-67477077 AAAGACCATCAGGTGCAGGTAGG - Intronic
975687877 4:76935749-76935771 AAAGGTGATCAGATCCAGTTTGG + Intergenic
977070591 4:92380480-92380502 AAATATGTAGAGGTGGAGTTGGG - Intronic
979176723 4:117674218-117674240 TAACATGAAAAGGTGCAGTTTGG + Intergenic
982714530 4:158792919-158792941 AAAGATAAAGAGGTGAAGTCAGG + Intronic
985384409 4:189430536-189430558 AGAAATGAACAAGGGCAGTTTGG - Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
986008677 5:3691399-3691421 AAGGATGAACAGATACAATTAGG + Intergenic
986428257 5:7655841-7655863 AAAGGTGATCAGATGCAGATGGG - Intronic
987995590 5:25273633-25273655 AAAGAGGAACAGATGCTGTGTGG + Intergenic
988818160 5:34854635-34854657 AAACATGAATGGGTGCAGTGAGG - Intronic
989465180 5:41746761-41746783 AGACATGAATAGGTTCAGTTTGG - Intronic
990861559 5:60333274-60333296 AAAGATGAATAAGTGCACCTGGG + Intronic
992936805 5:81715767-81715789 ATAGATGGCCAGGTGCAGTGTGG + Intronic
993641045 5:90406350-90406372 ATAGATGAAGAGGAGCAGTAGGG + Intronic
993998669 5:94752353-94752375 CAAGCTGATCAGCTGCAGTTTGG - Intronic
997192377 5:131949098-131949120 AAAGATGAATGGTTGGAGTTAGG + Intronic
999221453 5:149982153-149982175 AGAGATGAAGCGGTGAAGTTGGG + Exonic
999479921 5:151938597-151938619 AAAGATGAAGAGATGCAGAGGGG + Intergenic
1000447224 5:161337073-161337095 AAATAGGAATAGGTGTAGTTGGG + Intronic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1000945056 5:167412215-167412237 AAAGAGGAACAGGAGCAGCTAGG + Intronic
1001778930 5:174350919-174350941 AAAGCTGAGGTGGTGCAGTTAGG - Intergenic
1003111903 6:3258235-3258257 AAATAAGAACAGGTGCCTTTCGG - Intronic
1010016754 6:71113507-71113529 AAACATGAACAGATGATGTTTGG - Intergenic
1010085175 6:71908756-71908778 CAAGATGAAAAGGTTCATTTAGG - Intronic
1010633176 6:78225071-78225093 TAAGAAGCACATGTGCAGTTTGG + Intergenic
1012939180 6:105399625-105399647 AAAGATGAAAAGCTGTTGTTCGG - Intronic
1013279632 6:108623362-108623384 AAAGATTTACATGTGCAGGTGGG - Intronic
1014515007 6:122367293-122367315 AAAAATGAACAGGTTCAGGGTGG + Intergenic
1015939347 6:138432583-138432605 TAACATGAGCAGCTGCAGTTTGG - Exonic
1016238242 6:141893954-141893976 AAAGATGAGCAGGTGGAGGCCGG + Intergenic
1017331508 6:153204145-153204167 AAAAATGAACATGTGTAGTTAGG - Intergenic
1017576549 6:155811290-155811312 AAAAAGGAACAGGTGTAATTCGG + Intergenic
1019110746 6:169710817-169710839 AAAAATGAAGCGCTGCAGTTAGG + Intronic
1019970235 7:4534855-4534877 AAAAATGAACATGTGCAAATGGG - Intergenic
1021055996 7:16046938-16046960 AAAGATGAACAGGTGGAGTAGGG + Intergenic
1022082399 7:27035607-27035629 AAATAAGACCAGGTGCAGTGTGG - Intergenic
1022383029 7:29878442-29878464 ATAGATGAAAAGGTGCAGGGAGG + Intronic
1023273575 7:38493789-38493811 TGAGATGAACGGGTGAAGTTGGG + Intronic
1024789033 7:52941284-52941306 AAAGATGAATAACTGCAGTGTGG - Intergenic
1027675427 7:81151912-81151934 AAAGCTGAACAAATGCATTTAGG - Intergenic
1028295630 7:89127049-89127071 AGAAATGATCAGGTACAGTTGGG - Intronic
1028770319 7:94612776-94612798 AAGGAGGAACAGGTGGAGGTGGG - Intronic
1028909813 7:96195379-96195401 AAAAAGGAAAAGGTGCATTTGGG - Intronic
1029426232 7:100495729-100495751 AAAAAAGGACAGGTGAAGTTTGG + Intergenic
1031502075 7:122531266-122531288 AAAGAAGAAGAGGTGAAGTTAGG + Intronic
1031618260 7:123905798-123905820 AAAGAGGTTCAGGTACAGTTGGG - Intergenic
1032557486 7:132852350-132852372 AGAGATAACCAGGTTCAGTTTGG + Intronic
1035517688 8:250351-250373 ATAGATGACCAGATACAGTTGGG + Intergenic
1035778337 8:2207772-2207794 GAAGTTGAACAGGAGCAGATGGG + Intergenic
1036255950 8:7206673-7206695 ACAGATGAACAGATGGACTTGGG + Intergenic
1036361538 8:8080826-8080848 ACAGATGAACAGATGGACTTGGG - Intergenic
1039909814 8:41817369-41817391 TGAGATGAACAGGTGAGGTTTGG + Intronic
1040102464 8:43517926-43517948 AAAGATGCACATGTACAGCTTGG + Intergenic
1040103821 8:43527926-43527948 AAAGATGTACAGGTACAGCTTGG + Intergenic
1041255153 8:55973633-55973655 AAAAATTTACAGTTGCAGTTTGG + Intronic
1041464109 8:58142031-58142053 TCAGGTGAACAGGTGCAGTCAGG - Intronic
1041631180 8:60089118-60089140 AAATATGAAGAGATGAAGTTTGG + Intergenic
1044619047 8:94171384-94171406 GAAGATGAACAGGGGCAATAGGG + Intronic
1044895704 8:96889388-96889410 AAAGAGGTAGAAGTGCAGTTTGG + Intronic
1046164766 8:110417961-110417983 AAAGATAAACAGGTGCATTTTGG + Intergenic
1046876663 8:119262234-119262256 ATAGTTGAGCAGGTGCAATTTGG - Intergenic
1047948993 8:129912554-129912576 AAAGATGCACAGATGCACTCTGG + Intronic
1048455753 8:134576884-134576906 TAAAATGTACAGGGGCAGTTTGG + Intronic
1050372842 9:4939510-4939532 AAAGATGGTCAGGAGGAGTTTGG - Intergenic
1050780695 9:9331061-9331083 AAACATGAAGACCTGCAGTTGGG + Intronic
1051074486 9:13214863-13214885 AGAGGTGAACAGGTGTAGGTAGG + Intronic
1051318684 9:15874596-15874618 AAAGGTCTCCAGGTGCAGTTTGG - Exonic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878205 9:33583327-33583349 AAAGACGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497779 9:38560880-38560902 AAAGACGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053663403 9:40300292-40300314 AAAGATGTACAGGTACAGCTTGG + Intronic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054375526 9:64446526-64446548 AAAGATGTACAGGTACAGCTTGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054521211 9:66075993-66076015 AAAGATGTACAGGTACAGCTTGG - Intergenic
1055939627 9:81637069-81637091 AAAGATGAACTGGGGAAGGTGGG + Intronic
1056693445 9:88827215-88827237 GAAGATGGACAGGTGAATTTAGG + Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1059517538 9:114909701-114909723 AAAGATAGACAGGTGCAGCTGGG - Intronic
1061023220 9:128030384-128030406 AAAAAAAAAAAGGTGCAGTTTGG + Intergenic
1061118728 9:128630178-128630200 AAAGATGGCCAGTTGCAGTTAGG + Intronic
1062698310 9:137886482-137886504 AATGATGAACAGGTGGAGGGAGG - Intronic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185503143 X:614078-614100 GATGATGAAGAGGTGCCGTTTGG - Intergenic
1187049757 X:15684164-15684186 AAAGATGAAAATGTCCAGTATGG - Intergenic
1187787806 X:22912770-22912792 AAAGTAGAACAGCTGCAGATGGG - Intergenic
1192321700 X:70095209-70095231 AAAGATGAAAAAGAGAAGTTGGG + Intergenic
1192323868 X:70115587-70115609 TGAGATGAATAGGTGAAGTTTGG + Intergenic
1194561346 X:95425477-95425499 ACAGATTAACAATTGCAGTTGGG + Intergenic
1194863958 X:99042294-99042316 ATTGGTGAACAGGGGCAGTTTGG + Intergenic
1196856868 X:119992382-119992404 AAAAATGTGCAGGAGCAGTTGGG + Intergenic
1197181292 X:123539523-123539545 AAAGATGCACTGGTGAAGGTAGG - Intergenic
1197983266 X:132241006-132241028 AAAAATTTACAGGTGCAGTGGGG + Intergenic
1199137102 X:144266268-144266290 ACACATGAACAGTTGCAGGTGGG + Intergenic