ID: 1170919685

View in Genome Browser
Species Human (GRCh38)
Location 20:20665902-20665924
Sequence ACCAGTGAAAAAGGGTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170919681_1170919685 -2 Left 1170919681 20:20665881-20665903 CCACCACAGGCAACATATGAGAC 0: 1
1: 0
2: 1
3: 13
4: 173
Right 1170919685 20:20665902-20665924 ACCAGTGAAAAAGGGTACCTTGG 0: 1
1: 0
2: 1
3: 14
4: 126
1170919682_1170919685 -5 Left 1170919682 20:20665884-20665906 CCACAGGCAACATATGAGACCAG 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1170919685 20:20665902-20665924 ACCAGTGAAAAAGGGTACCTTGG 0: 1
1: 0
2: 1
3: 14
4: 126
1170919679_1170919685 25 Left 1170919679 20:20665854-20665876 CCGAGGAGCAACTACAGAGCTAA 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1170919685 20:20665902-20665924 ACCAGTGAAAAAGGGTACCTTGG 0: 1
1: 0
2: 1
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170919685 Original CRISPR ACCAGTGAAAAAGGGTACCT TGG Intronic
901662411 1:10806813-10806835 GCCAGTGGAAAAGGGCACCCTGG - Intergenic
902886314 1:19407431-19407453 AGCTGGGGAAAAGGGTACCTGGG + Intronic
906664621 1:47611328-47611350 ACAGGTGAAAAATGGTATCTTGG - Intergenic
907595187 1:55713151-55713173 ACCACTCAAAAAGGGAACATGGG - Intergenic
910517045 1:88073619-88073641 ACAAGTGAAAAAGGGAACTGAGG - Intergenic
911087818 1:93993797-93993819 TCCAGTTAAAAAGGTCACCTTGG - Intronic
919814335 1:201428229-201428251 AGCACAGAAAAAGGGAACCTGGG - Intronic
922897697 1:229113271-229113293 AGCAGTGAAAGAGATTACCTGGG - Intergenic
1063803548 10:9610870-9610892 ACAATTGAAAATGGGTACGTGGG + Intergenic
1064174461 10:13062291-13062313 ACCATTGCAAAAGGGAAACTCGG - Intronic
1071894184 10:90047020-90047042 ATCAGTGAAAAGAGGTAGCTTGG + Intergenic
1072494710 10:95945470-95945492 AGCAGGCAAATAGGGTACCTGGG - Intergenic
1074614330 10:115051447-115051469 AACAGTCAGAAAGGGTACCCTGG - Intergenic
1074710251 10:116171368-116171390 ACCAAAGAAAAAGAGTAGCTTGG + Intronic
1075774072 10:124968195-124968217 ACCATTAAAAAATGTTACCTTGG - Intronic
1075945977 10:126433368-126433390 ACCAGGGAAGAAGGGCATCTGGG + Intronic
1078862585 11:15264079-15264101 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1078862623 11:15264403-15264425 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1078862660 11:15264729-15264751 ACCTTTGAAAAAGAGTACCTTGG - Intergenic
1080034730 11:27699943-27699965 ACCAGGGAAAAAGGGACCCGGGG - Intronic
1087837939 11:102893479-102893501 ACCATTTAAAAATGGAACCTGGG - Intergenic
1089494607 11:118901904-118901926 ACCAGATACAACGGGTACCTGGG - Exonic
1090750409 11:129741943-129741965 ACAGGTGAAAAATGGTATCTTGG + Intergenic
1094314167 12:29119559-29119581 ACAAGTCCAAAGGGGTACCTGGG - Intergenic
1097909933 12:64958792-64958814 CACAGTCAAAAAGGGTACCCAGG - Intergenic
1098701629 12:73635874-73635896 ACCAAGTAACAAGGGTACCTTGG - Intergenic
1102109584 12:110354829-110354851 TCCAGTAAAAAAGGGCTCCTTGG + Intergenic
1102490611 12:113287777-113287799 ACCAGTGAAGAAGGGTGGCAGGG - Intronic
1102724191 12:115044272-115044294 ACCACTAAGAAAGGGTAGCTGGG + Intergenic
1102794413 12:115676042-115676064 ACCAAGGAGAAATGGTACCTGGG - Intergenic
1105666368 13:22561667-22561689 GACAGTGAAAAACTGTACCTTGG - Intergenic
1113674348 13:112197105-112197127 ACCAGGGAAACAGGGAACCAGGG - Intergenic
1113674377 13:112197194-112197216 ACCAGAGAACAAGGGCACCAGGG - Intergenic
1116484230 14:45427651-45427673 ACCAGGGAAAAGAGGGACCTGGG + Intergenic
1120870226 14:89330076-89330098 ACCAGTGAAAATAGTTAACTGGG - Intronic
1124031252 15:26014142-26014164 TCCAGTGAAAATTGGAACCTAGG - Intergenic
1126664444 15:51063606-51063628 ACAAGGGACAAAGGGGACCTTGG - Intronic
1128628181 15:69233683-69233705 AACAGTCTAATAGGGTACCTGGG - Intronic
1129287494 15:74537831-74537853 ACCAGATAAAAAAGGTAGCTGGG - Intergenic
1129804546 15:78444448-78444470 ACCTGAGATAAAGGGTGCCTGGG - Intronic
1133635030 16:7657113-7657135 ACCAGTCAAAAAGGTGTCCTAGG + Intronic
1134047562 16:11112297-11112319 ACCTGTTAAAATGGGAACCTAGG + Intronic
1137836554 16:51597807-51597829 ACCAGGGAAAGAGGGACCCTAGG - Intergenic
1143616014 17:8049665-8049687 AACACTGAAAAAGGGTCACTGGG + Intergenic
1147870079 17:43581054-43581076 ACCAGTGAACCAGGGGACCCCGG - Intergenic
1149615789 17:57997061-57997083 ATGACTGAAAAAGGATACCTAGG + Intronic
1153024778 18:662239-662261 ACCAGAGAAGAAGGGGACTTGGG + Exonic
1153772007 18:8423920-8423942 CCCAGTGAAAATGGGTTTCTAGG - Intergenic
1157799605 18:50608823-50608845 ACAAGTGAACAAGGGTATCTGGG + Intronic
1158601029 18:58855674-58855696 ACCATTGAAAAAGAGTTCCTGGG - Intergenic
1158943423 18:62427263-62427285 AACAGTGGAAAAGGGAACATGGG + Intergenic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1163192496 19:15687675-15687697 CCCAGTGAAGATGTGTACCTAGG - Intronic
1164587260 19:29483835-29483857 AGCAGTGACAAAGGTGACCTAGG + Intergenic
1164636133 19:29792708-29792730 ACCAGTGACAAGGGGCACCCTGG - Intergenic
1164704397 19:30309457-30309479 ACCAGTGAAAAAGTGTGCTGAGG - Intronic
1168375985 19:55879617-55879639 GCCAGTGAAAAGAGCTACCTGGG - Intronic
930829204 2:55725300-55725322 ACCAGTGCAAGAGGGTCTCTAGG - Intergenic
932101601 2:68906048-68906070 ACCATTGAATCAGGGTAACTGGG - Intergenic
937681825 2:124652406-124652428 CCCACTGAAAAAGGCTACCTTGG + Intronic
941377627 2:164751148-164751170 ACCACTCAAAAAAGGTACCAAGG + Intronic
944248696 2:197559411-197559433 AACAGTGAAAAAGGTAACCTAGG - Intergenic
944448449 2:199816319-199816341 ACCAGTGAAAAAAGGCATATAGG + Intronic
948591121 2:239050889-239050911 ACCAGGCAACAAGGGTCCCTGGG + Exonic
948765291 2:240216289-240216311 ACCCAAGAAAAAGGGTACATAGG + Intergenic
1168776291 20:450466-450488 ACCAGTGTCAAAGGGTACTTGGG + Intronic
1170919685 20:20665902-20665924 ACCAGTGAAAAAGGGTACCTTGG + Intronic
1172561243 20:35890464-35890486 ACCAGTGACACATGGTCCCTTGG + Intronic
1173149070 20:40550438-40550460 AGCAGTGAATAAAGGTACCAGGG - Intergenic
1173697941 20:45037361-45037383 TCCAGCAAAAAAGGGTACATTGG - Intronic
1179937543 21:44614775-44614797 ACCAGTGAAAAAGGAAGCCACGG + Intronic
949700134 3:6746966-6746988 ACCAATGAAAAAGGCTACAGAGG - Intergenic
950014309 3:9745042-9745064 ACCAGTGAAGAAGAGTTTCTTGG + Exonic
950445497 3:13035133-13035155 AGCTGTGAAAAAGGCTCCCTGGG - Intronic
952326409 3:32324352-32324374 CCCAGAGAAAAAGGGTTCCCTGG + Intronic
954734106 3:52690700-52690722 ACCACTAATAAAGGATACCTTGG - Exonic
954809788 3:53240861-53240883 CCCAGTGCAGAAGGGTAGCTTGG + Intronic
956135782 3:66097183-66097205 TACAGTGAAAAAGGGCATCTTGG - Intergenic
956628273 3:71288686-71288708 AGCAGTGAAAAAGGAATCCTGGG - Intronic
962877438 3:139546432-139546454 GCAAGTGAAAAAGGGTATCTTGG + Intergenic
963626656 3:147681792-147681814 AGCAGTGGAAAAGGGCAACTTGG + Intergenic
964605087 3:158552439-158552461 ACCAGGGAAAAAAGTTAACTGGG - Intergenic
970853465 4:20629350-20629372 ACTAGAGAAAAAGGGAACTTAGG + Intergenic
972707762 4:41562083-41562105 ACACCTGAAAAAGGGTACCTTGG - Intronic
974403237 4:61431130-61431152 ACCAAAGAAAAAAGGTAGCTTGG + Intronic
974679904 4:65147142-65147164 AGGAGTGAAAAATGGTACCATGG - Intergenic
975292254 4:72690479-72690501 AGCAGTGACAAAGGGTAGCACGG + Intergenic
982048793 4:151477780-151477802 AACAGTGATAAATGGTACCTCGG - Intronic
983353967 4:166631576-166631598 ATCAGTGAAAAAGAGTAAGTAGG + Intergenic
990771847 5:59255790-59255812 ACTAGTGAAAATGGATACATGGG + Intronic
993057386 5:82997763-82997785 AACAATGAAAAGGGGTACCCTGG - Intergenic
993702835 5:91138495-91138517 ATCAGTGAAACAAGGGACCTAGG - Intronic
993843527 5:92910530-92910552 ACCAGTGAAACAGGGTACCCAGG - Intergenic
993996223 5:94726750-94726772 ACTAGTTAAAAAGAGTTCCTGGG + Intronic
994185478 5:96810337-96810359 AACAGAGAGAAAGGGTACCTAGG + Intergenic
995412659 5:111876145-111876167 GCCAGTAAAAAGGGCTACCTGGG - Intronic
996404520 5:123092553-123092575 ACCAGAGAAAAAAGTTACCCAGG - Intronic
999693421 5:154168122-154168144 CCCGGGGAAACAGGGTACCTGGG + Intronic
1001990382 5:176111591-176111613 ACCAGTGAGACAGGGTTCTTGGG + Intronic
1002130724 5:177079933-177079955 ACCAGTGAATAAGGGGACGGGGG + Intronic
1002226489 5:177726549-177726571 ACCAGTGAGACAGGGTTCTTGGG - Intronic
1002267358 5:178044664-178044686 ACCAGTGAGACAGGGTTCTTGGG + Intronic
1003530480 6:6933373-6933395 ACCAGTAACAAAGGCTACGTAGG + Intergenic
1007390018 6:41545705-41545727 ACCAGTGAAGAAGGGGCCCAAGG - Intergenic
1008475597 6:51932511-51932533 ACCAGTAAAAAAGTGCATCTGGG - Intronic
1010577217 6:77547010-77547032 ATAAGAGAGAAAGGGTACCTGGG - Intergenic
1011292106 6:85787873-85787895 AACAGTGAACAAGGGTCCGTGGG + Intergenic
1011927177 6:92660868-92660890 ACCAGTGATAATGAGTAACTAGG - Intergenic
1012842959 6:104353336-104353358 AACAGTGAAAAACGCTACCTGGG - Intergenic
1013017830 6:106177277-106177299 AGCAGAGAAAAAGTGGACCTTGG + Intergenic
1014034102 6:116745188-116745210 ACCGGTAGAAAGGGGTACCTGGG - Intergenic
1017050363 6:150386991-150387013 ACTAGAGAAAAAGTTTACCTCGG - Intronic
1017824635 6:158072241-158072263 CCCAGTCAAAAAGGGTCCATTGG - Intronic
1019922435 7:4171632-4171654 ACCAGTGGATGAGGGGACCTTGG - Intronic
1023113965 7:36842158-36842180 ACCAGCAAAAAATGGTACCAGGG - Intergenic
1023569142 7:41554381-41554403 ACCAGGGAAAAAGGAAAGCTGGG - Intergenic
1028914488 7:96243496-96243518 ACCAATGAAATAGAGTATCTGGG - Intronic
1029838006 7:103333638-103333660 CCCAGTGGAAAAGGGTACAAGGG - Intronic
1030782765 7:113622703-113622725 AATAGAGAAAAAGGGGACCTAGG + Intergenic
1033667948 7:143461191-143461213 CCCAGAGAAAAGGGCTACCTGGG - Intergenic
1034114541 7:148572106-148572128 GCCAATGGAAAAGGCTACCTGGG + Intergenic
1038779871 8:30561024-30561046 ACCATTTAAAAAGGATACTTAGG - Intronic
1039857483 8:41428628-41428650 AAAAGAGAAAAAGAGTACCTGGG - Intergenic
1040431741 8:47349736-47349758 ACCAGTGAGCAAGGGTCCGTGGG + Intronic
1040551275 8:48439296-48439318 AACAGTGAGAAAGGTGACCTGGG - Intergenic
1043211060 8:77518543-77518565 GCCAGTGAAAATGGAAACCTGGG + Intergenic
1044644953 8:94430450-94430472 ACCAGTGAAACAGAGTATTTTGG - Intronic
1046011859 8:108558249-108558271 ACCAGTATAAAAGGTTTCCTTGG + Intergenic
1046620907 8:116528618-116528640 GCCAGAGAAGAAGGGTACATGGG + Intergenic
1050539647 9:6659236-6659258 ACCTGTGTAAAAGGATGCCTAGG - Intergenic
1050881261 9:10702934-10702956 ACAAGAGAAAAAGGCTACTTTGG + Intergenic
1053505738 9:38641809-38641831 ACCATGGAAACAGGGTACATGGG + Intergenic
1055162092 9:73142555-73142577 GCCTGTGAAAAAGGGGGCCTTGG - Intergenic
1055312439 9:74997035-74997057 ACCAGGGAAAAAGGGGAGCCAGG + Intronic
1056534798 9:87517961-87517983 ACCAGTGATCATGGGTGCCTGGG + Intronic
1057117143 9:92536145-92536167 ACCAGGGAAAATGGTTACCAAGG + Intronic
1057262355 9:93592160-93592182 CCCAGTGAAAAAGGGCTCCTGGG - Intronic
1059592083 9:115672722-115672744 ACCAGGGAGTAAGGTTACCTGGG - Intergenic
1060617431 9:125031044-125031066 CCCACTGAAAAAAGGTACTTGGG - Intronic
1061742294 9:132716172-132716194 AGCATTTAAAAAGGGTCCCTTGG - Intergenic
1061888079 9:133603033-133603055 CCCAGGGAGAAAGGGCACCTGGG + Intergenic
1189060337 X:37746714-37746736 CCCAGTGGCAAAGGGTAGCTGGG + Intronic