ID: 1170919848

View in Genome Browser
Species Human (GRCh38)
Location 20:20667714-20667736
Sequence AAACAGTTTCAGTGCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170919848_1170919855 23 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919855 20:20667760-20667782 ATGGAGAAAGGTTGAAGGTGTGG 0: 1
1: 0
2: 2
3: 38
4: 397
1170919848_1170919851 -6 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919851 20:20667731-20667753 CTGTTTTCTTTATCTTGAAGGGG 0: 1
1: 0
2: 6
3: 62
4: 558
1170919848_1170919852 4 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919852 20:20667741-20667763 TATCTTGAAGGGGAAACAGATGG 0: 1
1: 0
2: 0
3: 23
4: 326
1170919848_1170919853 11 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG No data
1170919848_1170919854 18 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919854 20:20667755-20667777 AACAGATGGAGAAAGGTTGAAGG 0: 1
1: 0
2: 1
3: 34
4: 419
1170919848_1170919849 -8 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919849 20:20667729-20667751 AACTGTTTTCTTTATCTTGAAGG 0: 1
1: 0
2: 2
3: 51
4: 496
1170919848_1170919850 -7 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919850 20:20667730-20667752 ACTGTTTTCTTTATCTTGAAGGG 0: 1
1: 0
2: 3
3: 55
4: 506
1170919848_1170919858 28 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919858 20:20667765-20667787 GAAAGGTTGAAGGTGTGGTGGGG 0: 1
1: 0
2: 4
3: 22
4: 338
1170919848_1170919856 26 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919856 20:20667763-20667785 GAGAAAGGTTGAAGGTGTGGTGG 0: 1
1: 0
2: 3
3: 51
4: 420
1170919848_1170919857 27 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919857 20:20667764-20667786 AGAAAGGTTGAAGGTGTGGTGGG 0: 1
1: 0
2: 1
3: 27
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170919848 Original CRISPR AAACAGTTTCAGTGCACTCC AGG (reversed) Intronic
900006582 1:59135-59157 AAAAAGTTTCCCTGCACTCATGG + Intergenic
901959163 1:12810767-12810789 AAACAGACTCACTGCATTCCAGG + Intergenic
901974421 1:12932895-12932917 AAACAGACTCACTGCATTCCAGG + Intronic
902010751 1:13268872-13268894 AAACAGACTCACTGCATTCCAGG - Intergenic
905311807 1:37054250-37054272 AAAAAGCTTCCGGGCACTCCTGG - Intergenic
909057717 1:70842577-70842599 AAACAGGTCCAGTGCTTTCCTGG + Intergenic
910320379 1:85936976-85936998 AACCAGTTCCAGTGCATTCTGGG + Intronic
912173126 1:107124771-107124793 CACTAGTTTCACTGCACTCCCGG + Intergenic
913999208 1:143678585-143678607 AAACAGTTTCATTTCATTCTAGG - Intergenic
914691322 1:150030731-150030753 GAACAGTTTCAGTGAACTGGTGG - Intergenic
915769432 1:158404330-158404352 AAACAGTTTCACTGGGTTCCAGG - Intergenic
917524749 1:175778059-175778081 AAACAACTTCAGTGAACTCTTGG + Intergenic
923414648 1:233744316-233744338 AAACCATATCAGTGCACTTCTGG - Intergenic
924235687 1:241998068-241998090 AGACTGTTCCACTGCACTCCTGG - Intronic
1064586917 10:16848621-16848643 AAACTGTTTGAGAGCTCTCCTGG - Intronic
1066218970 10:33316834-33316856 AAACATTTTCAGTCCACTGGAGG + Intronic
1067165416 10:43863178-43863200 AAAAAGTTTCCCTGCCCTCCTGG + Intergenic
1067420080 10:46137594-46137616 AAATTGTGTCACTGCACTCCAGG + Intergenic
1069959986 10:72073879-72073901 TAACAGTCCCAGGGCACTCCTGG + Intronic
1073604768 10:104883113-104883135 AAACAGCTTCAGTGAAGTTCAGG - Intronic
1074212805 10:111353147-111353169 AAAAAGTTTCTGAGCACTGCAGG + Intergenic
1078104417 11:8349766-8349788 AGACAGTTTCAGTCCCCTCGAGG - Intergenic
1079865501 11:25728984-25729006 AAAGTGTTTTAGTGCACTGCTGG + Intergenic
1079898174 11:26148743-26148765 AAACAGCTTAAGTGCAATGCAGG + Intergenic
1082170443 11:48997734-48997756 GAACAGTTTCAGTATGCTCCTGG - Intergenic
1083493118 11:63027680-63027702 AAACCGTATCATTCCACTCCTGG + Intergenic
1086695373 11:89838622-89838644 GAACAGTTTCAGTATGCTCCTGG + Intergenic
1086710780 11:90005863-90005885 GAACAGTTTCAGTATGCTCCTGG - Intergenic
1091997397 12:5004541-5004563 AAATAGGTTCAGAGAACTCCAGG + Intergenic
1094649956 12:32366119-32366141 AAACAGTTTTAGTGTATTTCTGG + Intronic
1095683158 12:45002256-45002278 AAACAGTTTCAGTGGAATAATGG - Intergenic
1097631516 12:62069490-62069512 ATACAGTTTGACTGTACTCCTGG - Intronic
1100862115 12:98817336-98817358 AAACAAATTCAGTGCAGTCAAGG + Intronic
1101108689 12:101464383-101464405 AAATTGTGTCACTGCACTCCAGG + Intergenic
1103264703 12:119618923-119618945 AAACCATATCATTGCACTCCTGG - Intronic
1105484037 13:20809007-20809029 AAACACTTTAAGTGCTCTCCAGG + Intronic
1105635175 13:22209461-22209483 AAACAGTGTGAAAGCACTCCCGG + Intergenic
1106895695 13:34299728-34299750 AAACCTTTTCAGTGCATGCCTGG - Intergenic
1108300922 13:49075343-49075365 GGACAGTTTCAGTGCATTACAGG + Exonic
1108458280 13:50638900-50638922 AAACAGTTTGAGGGCAATCAGGG - Intronic
1110618129 13:77564316-77564338 CAATAGTTTCAATCCACTCCAGG + Intronic
1112121118 13:96412330-96412352 AGACAGTTTCAGTCCTCTGCTGG - Intronic
1113077937 13:106486873-106486895 AAACATTTTCAGGCCACTGCAGG - Intergenic
1113308974 13:109111211-109111233 AAACAGTTTCTGTGCCTACCAGG - Intronic
1113948611 13:114058797-114058819 TATAAGTTTCAGAGCACTCCTGG - Intronic
1113984503 13:114303106-114303128 AAAAAGTTTCAGTGAAGTCAAGG + Intronic
1115492505 14:33971753-33971775 AAACTCATTCAGAGCACTCCGGG + Intronic
1119319836 14:73723849-73723871 AAACAATTTCATTTCTCTCCAGG + Intronic
1120826965 14:88965009-88965031 AGACAGCATCACTGCACTCCAGG - Intergenic
1121318679 14:92977783-92977805 AAAGAGTTTTAGTTGACTCCCGG - Intronic
1122504707 14:102224998-102225020 AAACAGCTACAGTGAACTGCGGG + Intronic
1125555134 15:40578551-40578573 ACACAGTGCCACTGCACTCCAGG - Intergenic
1128630191 15:69257384-69257406 TGACAGTATCACTGCACTCCAGG - Intronic
1130439858 15:83942741-83942763 AATCAGTTTGACTGCCCTCCTGG + Exonic
1130849252 15:87777811-87777833 AAACAGTTTTAGTGCGCCTCGGG + Intergenic
1131814409 15:96207400-96207422 AAATAGTTTCCCTGCCCTCCAGG + Intergenic
1132438876 15:101839115-101839137 CTACAGATTCAGTGCAATCCAGG - Intergenic
1132446939 15:101931822-101931844 AAAAAGTTTCCCTGCACTCATGG - Intergenic
1132950153 16:2557249-2557271 AAACATTTCCACTGCAATCCCGG + Intronic
1132964193 16:2642921-2642943 AAACATTTCCACTGCAATCCCGG - Intergenic
1133559633 16:6938974-6938996 GAACAGTTACAGTGCATTCCTGG - Intronic
1139834395 16:69826522-69826544 AAATAGTGCCATTGCACTCCAGG + Intronic
1140907832 16:79424679-79424701 CAACAGTCTCACAGCACTCCTGG - Intergenic
1143322925 17:6079703-6079725 TCACAGTTCCAGTGCACCCCTGG + Intronic
1144080951 17:11763339-11763361 ACTCAGTTTCAGTGGACTCATGG - Intronic
1144488435 17:15686832-15686854 AAACCCTTTCAGGCCACTCCTGG - Intergenic
1146503155 17:33381570-33381592 AGAGAGTTTCAGTGCCCCCCCGG - Intronic
1149692957 17:58593600-58593622 GAACAATTTCAGTGCACTCAAGG - Exonic
1153502569 18:5763877-5763899 AAATTGTTTCTGTGCACTCAAGG - Intergenic
1153692184 18:7605016-7605038 AAAAAGTTTCAGTGCAACACAGG + Intronic
1153844224 18:9033906-9033928 AAACAGTAGCAGTCCACCCCGGG - Intergenic
1154300057 18:13184779-13184801 AAAGATGTTCAGTGCACACCAGG - Intergenic
1154989060 18:21582893-21582915 AAACAGTTTAATTTCACGCCTGG + Intronic
1155528255 18:26739785-26739807 AAACAGGTTCCCTGCCCTCCTGG + Intergenic
1157024554 18:43827511-43827533 CAACAGTTTTAGTGCACCCCAGG + Intergenic
1158534392 18:58294479-58294501 CAACAGTTTCTGTTCATTCCAGG - Intronic
1160638337 19:100711-100733 AAAAAGTTTCCCTGCACTCATGG + Intergenic
1160671737 19:368205-368227 ACACACTTTCAGTGCACTATGGG - Intronic
1161405203 19:4087716-4087738 AGACTGTGTCAGTGCACTCCAGG - Intergenic
1164800382 19:31071217-31071239 AAACAGTTTTAGTGACCCCCTGG - Intergenic
1167757806 19:51423573-51423595 AGACAGCACCAGTGCACTCCAGG + Intergenic
925545926 2:5016263-5016285 AAACAGCTTCAGTGGCCTCAGGG - Intergenic
929000019 2:37338324-37338346 AAGAAATTTCAGTGCACTCAAGG - Intergenic
929047959 2:37808797-37808819 AAGCAGATTCACTTCACTCCTGG - Intergenic
929336581 2:40754973-40754995 ACCCAGTTTCACTGCATTCCAGG + Intergenic
930103574 2:47621230-47621252 ACAGAGTTTCAGGCCACTCCTGG - Intergenic
930133797 2:47880254-47880276 AAACACTCTCAGGGCACTCTGGG - Intronic
933006851 2:77005484-77005506 AAACCGTATCATTGCACCCCTGG - Intronic
938401212 2:130992696-130992718 ACACAGTATCAGTGCAAGCCAGG + Intronic
943454449 2:188086074-188086096 AAACATTTACAGTGCTCTTCTGG - Intergenic
946947935 2:224841767-224841789 AAGCAGTTTCAGTGATCTCCAGG - Intronic
948165957 2:235862853-235862875 AAACAGTCTCAATGCACGCACGG - Intronic
1169199845 20:3703589-3703611 AAAGAGATGCAGAGCACTCCAGG - Intronic
1170919848 20:20667714-20667736 AAACAGTTTCAGTGCACTCCAGG - Intronic
1170982609 20:21228716-21228738 AAACAGTTTCACTTCCCTCGGGG - Intronic
1172382000 20:34502319-34502341 AAGCAGTTATAGTGCACTACAGG - Intronic
1183186838 22:36296680-36296702 AAACAGTTCTTGTGCACTCAGGG - Intronic
1183783460 22:40014980-40015002 AAATACTTTCAGTGCACTCTAGG - Intronic
1183915189 22:41112235-41112257 AGACAGTGCCACTGCACTCCAGG - Intronic
1184965570 22:47969649-47969671 AGACAGTGCCATTGCACTCCAGG - Intergenic
949114772 3:307536-307558 ACACAATTTCATTGCACTCCAGG - Intronic
956337420 3:68179629-68179651 AAACATTTTCAGTGTTCTCCAGG - Intronic
961130318 3:124460168-124460190 AAACAGTATCACTGCAGTACTGG - Intronic
961187146 3:124925659-124925681 AGATTGTGTCAGTGCACTCCAGG - Intronic
962570062 3:136703962-136703984 AGACTGTGTCACTGCACTCCAGG + Intronic
965735719 3:171818294-171818316 AAACTGTCTCAGTGCACTGATGG - Intergenic
966324132 3:178735308-178735330 AAACAGTATGACTTCACTCCAGG + Intronic
966973124 3:185063376-185063398 AAAAAGTTTCAGTGCAGTAAAGG + Intergenic
967467531 3:189824556-189824578 AAACAGTTTCACAGCAGCCCCGG - Intronic
967519750 3:190415995-190416017 AAACCATATCATTGCACTCCTGG + Intergenic
968152094 3:196345000-196345022 GAACAGTTTCAGTGCAATGTTGG - Intergenic
969451020 4:7273450-7273472 AGACAGTCTCAGCCCACTCCTGG - Intronic
971793549 4:31198956-31198978 AAACCGTATCATTCCACTCCTGG + Intergenic
971907565 4:32746905-32746927 AAATAGTGTCAGTGTACTCCAGG + Intergenic
975061238 4:70003519-70003541 AAACAATTCCAGTGAACTTCTGG + Intergenic
977592895 4:98846353-98846375 AAAAACTTTCAGGGCTCTCCTGG - Intergenic
978600796 4:110425384-110425406 AGACAGTGCCACTGCACTCCAGG + Intronic
979137615 4:117128749-117128771 AAACAATATCATTCCACTCCTGG - Intergenic
981341262 4:143624257-143624279 AAACAGATCCAGTTCAATCCTGG - Exonic
981583580 4:146274911-146274933 AACCAGTTTCAGTCAACTCTGGG - Intronic
983144327 4:164194330-164194352 AAACAGATTAAGGGCACTGCAGG + Intronic
983631476 4:169853611-169853633 AAACAGTTTTAATTCACTCATGG - Intergenic
983714451 4:170761216-170761238 AAATAGTGCCACTGCACTCCAGG + Intergenic
986748235 5:10762017-10762039 AAACATTTGCAGTGTATTCCCGG + Intergenic
988668781 5:33359288-33359310 AAACAGTATCATTCCACCCCTGG + Intergenic
989373616 5:40735871-40735893 AAGCAGTTTCAGTGGATTCATGG + Intronic
991563867 5:67984446-67984468 AATCAGTTTAAGAGGACTCCTGG + Intergenic
993559082 5:89381169-89381191 AAACAGTTTCAGAGAACTCTTGG - Intergenic
996126868 5:119735892-119735914 AAATAGTTGTAGTGCTCTCCAGG - Intergenic
998189784 5:140013703-140013725 GAACAGTTTCAGTGCAGTAGTGG - Intronic
999105923 5:149071164-149071186 GAACAGTTTCAGAGAGCTCCAGG - Intergenic
1000043211 5:157500631-157500653 AAACAGTTTATGTCAACTCCTGG + Intronic
1000976549 5:167770985-167771007 AAAATGTTTCAATGCACTCAAGG + Intronic
1001194554 5:169660140-169660162 ACACAGTATGAGTGCATTCCAGG - Intronic
1002632093 5:180589064-180589086 AGATCGTGTCAGTGCACTCCAGG - Intergenic
1002632213 5:180589870-180589892 AAACAGTTACAGAGCACAACAGG + Intergenic
1004232650 6:13847025-13847047 GAACAATTTCAGTGGACTCTGGG + Intergenic
1004288793 6:14347871-14347893 ACACAGTATCAGTGCACCCCAGG + Intergenic
1004447614 6:15714844-15714866 AAAGTGTTTCAGTGACCTCCAGG + Intergenic
1007932330 6:45703107-45703129 TTACTGGTTCAGTGCACTCCAGG - Intergenic
1009029876 6:58044020-58044042 AAACAGTTTCAGTGTTTTCTTGG - Intergenic
1010395926 6:75391922-75391944 AAAGAGTTTCAGTGGAGTACTGG - Intronic
1016055358 6:139572833-139572855 ATAAGGTTTCACTGCACTCCAGG + Intergenic
1016452898 6:144201718-144201740 AAATACTTTCAGTGCACTTTTGG - Intergenic
1016468232 6:144347889-144347911 AGACTGTGTCACTGCACTCCAGG - Intronic
1019052494 6:169193781-169193803 AAACAGATTCTGTGCTCTCCAGG + Intergenic
1021878942 7:25075447-25075469 AAAGAGGTTCAGTGGACTCACGG + Intergenic
1023339261 7:39202054-39202076 AACCACGTTCAGTGCAGTCCAGG - Intronic
1026006741 7:66606027-66606049 AGATAGTGCCAGTGCACTCCCGG - Intergenic
1026456924 7:70580842-70580864 ATACATTTTCAGCGGACTCCTGG - Intronic
1030054118 7:105567021-105567043 AAACAGCTTCTCTGCACTGCTGG - Intronic
1030514467 7:110522972-110522994 AAACAGTGACATTGCCCTCCAGG + Intergenic
1032576160 7:133057264-133057286 AAAAAGTTTCAGTTCAGGCCAGG + Intronic
1034327823 7:150253362-150253384 AAACAGCTTCAGTGGACATCAGG - Intronic
1034765385 7:153716071-153716093 AAACAGCTTCAGTGGACATCAGG + Intergenic
1037205301 8:16310620-16310642 AAAATGTTTCAGTGAACTCTTGG - Intronic
1039309961 8:36306782-36306804 GAACAATTTCAGTGCACTAGTGG + Intergenic
1039661978 8:39477679-39477701 AAACAGGTACAGTGGGCTCCAGG - Intergenic
1041053977 8:53963723-53963745 CAACAGTTTCAGTGTACTCTTGG - Intergenic
1043080714 8:75761435-75761457 AAACTGTATCATTGCACCCCTGG - Intergenic
1043190148 8:77210450-77210472 AAACAGTTTCAGTGTATTAATGG + Intergenic
1044417613 8:91953944-91953966 TAAGAGTGTCACTGCACTCCAGG + Intergenic
1044427078 8:92064123-92064145 AAACAGGTTGTGTGCACTCTTGG - Intronic
1044848381 8:96404316-96404338 TAACAGTGCCACTGCACTCCAGG + Intergenic
1045018248 8:98018233-98018255 AAACACTTTCAGAGCACCCAAGG - Intronic
1047119453 8:121884540-121884562 AAACAGATTGACTCCACTCCTGG + Intergenic
1048156198 8:131955834-131955856 AAACTGTTTCAGAGAACTGCTGG + Exonic
1049917543 9:333117-333139 AAACAGTGCCAGAGCTCTCCTGG + Intronic
1050561984 9:6843503-6843525 AAACAGTTTCAGTGAAAGACTGG + Intronic
1050880462 9:10693299-10693321 AACTAGTTTCAGAGCACTCATGG - Intergenic
1052877703 9:33579758-33579780 TCACAGTTTCAGAGCTCTCCAGG - Intergenic
1054804209 9:69382289-69382311 AAACAGTTTCAGTGGAATGGGGG + Intronic
1054936765 9:70696408-70696430 AAACAGGCTCAGTGCTGTCCTGG + Intronic
1055047732 9:71947689-71947711 AAATTGCATCAGTGCACTCCAGG - Intronic
1057457818 9:95230271-95230293 GAACAGTTAGATTGCACTCCAGG - Intronic
1058940623 9:109809695-109809717 AAACCATATCAGTCCACTCCTGG - Intronic
1059006284 9:110406667-110406689 ATACAGTATCAGTGCTTTCCTGG - Exonic
1060980655 9:127789716-127789738 AGACAGCTCCAGTGCCCTCCTGG - Exonic
1187609048 X:20920495-20920517 AAGCAGTGTCAATGCACACCTGG + Intergenic
1192425538 X:71072472-71072494 GAACAGTTTCAGTAGAGTCCTGG + Intronic
1195671408 X:107473301-107473323 AAAAAGTTACAGTGGATTCCAGG + Intergenic
1196030712 X:111093005-111093027 AAACTGTTTCAGTCAAATCCTGG - Intronic
1196226167 X:113169676-113169698 CAACAATTTCAGTGTACTCCAGG + Intergenic
1198150074 X:133899676-133899698 AAACAGTTTAACTGAATTCCAGG + Intronic