ID: 1170919853

View in Genome Browser
Species Human (GRCh38)
Location 20:20667748-20667770
Sequence AAGGGGAAACAGATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170919848_1170919853 11 Left 1170919848 20:20667714-20667736 CCTGGAGTGCACTGAAACTGTTT 0: 1
1: 0
2: 0
3: 15
4: 168
Right 1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170919853 Original CRISPR AAGGGGAAACAGATGGAGAA AGG Intronic
No off target data available for this crispr