ID: 1170924036

View in Genome Browser
Species Human (GRCh38)
Location 20:20706410-20706432
Sequence CTCTTCAGGCAGTCTTAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170924036_1170924041 27 Left 1170924036 20:20706410-20706432 CCATACTAAGACTGCCTGAAGAG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1170924041 20:20706460-20706482 CTAGTTGTAGAATGTCCACGTGG 0: 1
1: 0
2: 0
3: 547
4: 2817

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170924036 Original CRISPR CTCTTCAGGCAGTCTTAGTA TGG (reversed) Intronic
906002407 1:42438241-42438263 ATCTTCAGGCAATCTTATTGAGG - Intronic
906756393 1:48320287-48320309 GTCTTGAGGTAGTCTTAGTTGGG - Intronic
909023087 1:70453352-70453374 CTCTGCAGACAGTCTTAAGATGG + Intergenic
909023171 1:70454460-70454482 CTCTGCAGACAGTCTTAAGATGG + Intergenic
909856302 1:80536803-80536825 CTCTTTAGGCAGTCTGACTGGGG - Intergenic
910479916 1:87647228-87647250 CACTTCAGGAAGTCTCAGGAAGG - Intergenic
913116200 1:115699630-115699652 CTCTTCATGGAGTCCTAGTTTGG - Intergenic
914332906 1:146689132-146689154 TTCTCCATGCAGCCTTAGTAGGG + Intergenic
915723689 1:158002611-158002633 TTCTTGAGGCACTCTCAGTATGG + Intronic
920689550 1:208135408-208135430 CTCTCCAGGCAGTCTTCCTGTGG - Intronic
1064464424 10:15565149-15565171 ATCTTCAGGCACTCTTAAAAAGG + Intronic
1069507088 10:69009494-69009516 CTCTTCAGGCATTTTTCGTCTGG + Intronic
1071430568 10:85603291-85603313 CTCTTCAGGCAGCCCAAGGAGGG + Intronic
1074866654 10:117547834-117547856 CTCTTCAGGAAGCCTCAGAAGGG + Intronic
1074963608 10:118469719-118469741 CTCTCCTGGCAGTCTTGGAAAGG - Intergenic
1076376827 10:129994080-129994102 GTCTTCAGGTAGTCTTATTTGGG - Intergenic
1076400568 10:130181928-130181950 CCCTCCAGGCAGGCTTTGTATGG + Exonic
1079192859 11:18295998-18296020 CTCTTCAGGCTGTCAAAGAAAGG - Exonic
1085674345 11:78501529-78501551 CTCTTCAGAAAGTCTAAGAAGGG + Intronic
1088182016 11:107123070-107123092 GTCTTCAGGTAGTCTTATTTGGG - Intergenic
1090132742 11:124161762-124161784 CTCCTCAGCCATTCTTAATACGG - Intergenic
1090638265 11:128707264-128707286 CTCTACAGGCAGTGTTATCAGGG - Intronic
1091631982 12:2168926-2168948 CTCTCCAGGAAGCCTTAGAAAGG - Intronic
1092690688 12:11106856-11106878 CTCTTCAGGTAGTCTTTATGAGG + Intronic
1098754947 12:74350230-74350252 CTCTTCACGAAGTCTAATTATGG + Intergenic
1099144798 12:79027969-79027991 CTCTTTATGCAGTCATATTATGG + Intronic
1101322502 12:103685334-103685356 CTCTTTAGGAAGTCTGAGAATGG - Intronic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1103431923 12:120894988-120895010 CTCCTCAGGCATTTTTAGAAGGG + Intronic
1105373087 13:19818240-19818262 CTCTTCTGGAAGTCATAGTAAGG + Intergenic
1107902566 13:45032187-45032209 CTGGTAAGGCAGTCTTAGTAGGG - Intronic
1111876229 13:93899697-93899719 CTCTTCAGGCCTTTTTATTATGG - Intronic
1112866042 13:103899440-103899462 GTCTTCGGGCAGTCTTATTTGGG - Intergenic
1114190673 14:20437513-20437535 CTCCACAGGCAGACTTAATAAGG + Intergenic
1116629771 14:47315357-47315379 TGCTTCAGGCAGACTTGGTAGGG - Intronic
1117842838 14:59879161-59879183 GTCTTGAGGCAGTCTTATTTGGG + Intergenic
1121026497 14:90620311-90620333 CCATTTAGGCAGTCTTGGTAAGG - Intronic
1123798197 15:23794780-23794802 CTCTTCACTCAGTCTTATGAGGG - Intergenic
1124957681 15:34370389-34370411 TTCTGCAGGCAGTCTGAGAAGGG + Intergenic
1125470074 15:39993808-39993830 CTCTGCAGGAAGTCCTGGTAAGG + Intronic
1131348502 15:91674192-91674214 CTCTTCTCAAAGTCTTAGTATGG - Intergenic
1131649017 15:94378661-94378683 CTGTTCTTGCAGTCCTAGTATGG + Intronic
1132606209 16:794780-794802 TTCCTCAGGCAGTCTAAGGAGGG + Intronic
1134406838 16:13968228-13968250 GTCTTGAGGTAGTCTTATTAGGG + Intergenic
1134537361 16:15036816-15036838 CTCTTCGTGGAGACTTAGTAAGG + Exonic
1140000711 16:71022112-71022134 TTCTCCATGCAGCCTTAGTAGGG - Intronic
1142325198 16:89410458-89410480 CTCTGCAGGGTGTCTTAGTCTGG - Intronic
1149528330 17:57375650-57375672 GACTTCAGGCAGTGTTATTAAGG + Intronic
1154317215 18:13314026-13314048 CTCTTCACGCAGTATCAGTAAGG - Intronic
1156909498 18:42394057-42394079 CTCTTCAGGCTGGCATAGGAAGG + Intergenic
1157447430 18:47755890-47755912 CTCTGCAGGCTGTCCTAGTCAGG - Intergenic
1159091847 18:63858954-63858976 ATCTTGAGGCAGTCTTATTTGGG + Intergenic
1162817719 19:13206701-13206723 TTCTGCAGGCAGTAATAGTAGGG + Exonic
926815000 2:16791529-16791551 TTCTTCAGGAAGACTGAGTAAGG - Intergenic
928107445 2:28480062-28480084 CTAGCCAGGCAGTCTGAGTATGG + Intronic
938813696 2:134877984-134878006 CTTTTGGGGCAGTCTTGGTAGGG - Intronic
942210398 2:173663989-173664011 TTCATCAGGCAGACATAGTAAGG - Intergenic
943192812 2:184702377-184702399 CTCTTCAGGCAGTCATCCTTTGG + Intronic
943356828 2:186866922-186866944 CTCTTGAGGCTCTTTTAGTAGGG - Intergenic
944193764 2:197030485-197030507 CTCTTGAGGCAATATTAGTGGGG + Intronic
1169825011 20:9758170-9758192 CTCTTGAGGCAGCCTTAGCAGGG + Intronic
1169877307 20:10312128-10312150 CTCTTCAGAGAGTCCTACTAAGG + Intergenic
1170190159 20:13637897-13637919 CTCTTGAGAAAGTCTTATTAAGG - Intronic
1170924036 20:20706410-20706432 CTCTTCAGGCAGTCTTAGTATGG - Intronic
1173337607 20:42125468-42125490 CTGTTCATGCTGTCTTATTATGG - Intronic
1173817405 20:45998571-45998593 CTCTCCAGTCAGTCTTCTTACGG - Intergenic
1173973419 20:47169827-47169849 CTCCTCCAGCAGTCTTCGTAAGG + Intronic
1175159719 20:56999185-56999207 CTCTCCATGCAGTCTCAGCAGGG - Intergenic
1176457972 21:6929339-6929361 CTCTCCAGGCAGCCTTGGCAGGG - Intergenic
1176836144 21:13794423-13794445 CTCTCCAGGCAGCCTTGGCAGGG - Intergenic
1176968186 21:15235541-15235563 CACTGCAGGCAGTGTTAGAAAGG + Intergenic
950304785 3:11909555-11909577 CTCATCAGGCAGTGTGAGTGTGG - Intergenic
951013005 3:17702252-17702274 TTCTTCTGGAAGTCTTAGCAGGG - Intronic
951450976 3:22837714-22837736 CTCTACAGCCATTCTAAGTATGG + Intergenic
952995186 3:38873230-38873252 ATCTTCAGCCATTCTTATTATGG + Intronic
953912796 3:46901351-46901373 CTCTGTGGGCAGTCTTAGGATGG + Intronic
957491894 3:80938149-80938171 CTCTTCAGGGACTCTTATTTAGG + Intergenic
959410793 3:106018475-106018497 CTCTTCAGGAAGTCTAGGAAAGG + Intergenic
960678581 3:120222893-120222915 CTCTTTAAGCAGTCTCTGTAAGG + Intronic
968347942 3:198026921-198026943 CTCATCAGGCCCTCTTAGTAAGG + Intronic
972667332 4:41179696-41179718 ATCTTCAGGGAGTATTAATACGG - Intronic
976727771 4:88231411-88231433 CTCTTCTGGCATTCCTAGCAAGG + Intergenic
977256191 4:94742706-94742728 CTTTTCAGGCACAGTTAGTAAGG + Intergenic
977855976 4:101893635-101893657 CTCTTCAGGAAGCCTTTGAAAGG - Intronic
979809187 4:125014119-125014141 CTCCTCAGGCAGTCCCATTATGG + Intergenic
980976828 4:139619178-139619200 TTCTTCTGGCAGTATTAGTTAGG - Intergenic
990922336 5:60981110-60981132 GTCTTCAGGTAGTCTTATTTGGG - Intronic
997696692 5:135866604-135866626 CTCTTCAGGGAGTTTTATTTTGG - Intronic
1007346461 6:41233426-41233448 CTCTTCTGGCACTCTTAATATGG + Intronic
1008882024 6:56389610-56389632 GCCTTCAGGCAGTCTTATTTGGG - Intronic
1017086572 6:150718129-150718151 CTTTTCACCCAGTGTTAGTATGG + Intronic
1023200293 7:37689605-37689627 TTCTTGAGTCAGTCTTGGTAGGG + Intronic
1028633962 7:92966532-92966554 CAATTCAGTCAGTCTTTGTAAGG + Intergenic
1030109696 7:106016451-106016473 GCCTTCAGGGAATCTTAGTAGGG - Intronic
1033724397 7:144098169-144098191 CTCTTCAGTCTGTCTTTTTATGG + Intergenic
1033796480 7:144851284-144851306 GTCTTCAGGCTTTGTTAGTATGG + Intergenic
1036193864 8:6697234-6697256 TTCTTGATGCAGTCATAGTAAGG + Intergenic
1039762412 8:40591621-40591643 CTGGTGAGGCAGTCTTTGTAAGG - Intronic
1042820229 8:72922594-72922616 CTCTTCAGCCTGTCTTATGAGGG + Intronic
1042836605 8:73084689-73084711 CTCTTCAGGGAGTCTTTTTCTGG + Intronic
1045536642 8:103035442-103035464 CTCTTCAGGATTTCTCAGTAAGG + Intronic
1047624085 8:126637655-126637677 TTCTTCAGGTAGTCTTGGAATGG + Intergenic
1047756085 8:127919510-127919532 CTCTTCATCCAGTCTGAGTGGGG + Intergenic
1052820919 9:33137465-33137487 CTCAGCAGGCAGTCTTATAAGGG - Intronic
1054928533 9:70612650-70612672 CACTTCAATAAGTCTTAGTATGG - Intronic
1185814260 X:3139749-3139771 CTTTTCAGGCAGGCTCTGTAGGG + Intergenic
1188231362 X:27668330-27668352 CTTATCAGGCAGTCTTTGTAAGG + Intronic
1190429853 X:50368595-50368617 CTCTTCAGGGAGTTTTGGAATGG - Exonic
1192240263 X:69322888-69322910 CTCTTCAGGCAGTCAGAGACAGG - Intergenic
1199145431 X:144360549-144360571 CCCTTCAGGAAGTCTTTTTAGGG - Intergenic
1201267450 Y:12221763-12221785 CTTTTCAGGCAGGCTCTGTAGGG - Intergenic