ID: 1170930318

View in Genome Browser
Species Human (GRCh38)
Location 20:20763861-20763883
Sequence CTGGGCTCCTTGGGAGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170930310_1170930318 27 Left 1170930310 20:20763811-20763833 CCGGGCTGGAATGCAGTGGTGCA 0: 1391
1: 27820
2: 83849
3: 169223
4: 205179
Right 1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG No data
1170930309_1170930318 28 Left 1170930309 20:20763810-20763832 CCCGGGCTGGAATGCAGTGGTGC 0: 51
1: 3565
2: 55733
3: 144012
4: 209496
Right 1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170930318 Original CRISPR CTGGGCTCCTTGGGAGAACT GGG Intergenic
No off target data available for this crispr