ID: 1170930868

View in Genome Browser
Species Human (GRCh38)
Location 20:20768534-20768556
Sequence GCCGGTCGGCGCCACCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170930865_1170930868 -8 Left 1170930865 20:20768519-20768541 CCGGCACTCGGAGCAGCCGGTCG No data
Right 1170930868 20:20768534-20768556 GCCGGTCGGCGCCACCGGCCAGG No data
1170930859_1170930868 23 Left 1170930859 20:20768488-20768510 CCCAAGTTCTGGGTGGGCATGGG No data
Right 1170930868 20:20768534-20768556 GCCGGTCGGCGCCACCGGCCAGG No data
1170930861_1170930868 22 Left 1170930861 20:20768489-20768511 CCAAGTTCTGGGTGGGCATGGGC No data
Right 1170930868 20:20768534-20768556 GCCGGTCGGCGCCACCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170930868 Original CRISPR GCCGGTCGGCGCCACCGGCC AGG Intergenic
No off target data available for this crispr