ID: 1170934046

View in Genome Browser
Species Human (GRCh38)
Location 20:20794596-20794618
Sequence ATTCTAGTGATTCGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170934042_1170934046 2 Left 1170934042 20:20794571-20794593 CCAGATGTGGTGGCTCATATTTA No data
Right 1170934046 20:20794596-20794618 ATTCTAGTGATTCGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170934046 Original CRISPR ATTCTAGTGATTCGGGAGGC AGG Intergenic