ID: 1170934517

View in Genome Browser
Species Human (GRCh38)
Location 20:20797859-20797881
Sequence CTACGAATGCGGGTGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170934505_1170934517 24 Left 1170934505 20:20797812-20797834 CCATTTTGCCTATGAAAGAAAAT No data
Right 1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG No data
1170934504_1170934517 29 Left 1170934504 20:20797807-20797829 CCATTCCATTTTGCCTATGAAAG No data
Right 1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG No data
1170934508_1170934517 16 Left 1170934508 20:20797820-20797842 CCTATGAAAGAAAATTTGGAGGC No data
Right 1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG No data
1170934510_1170934517 -6 Left 1170934510 20:20797842-20797864 CCTGGCAGAAAACCTCTCTACGA No data
Right 1170934517 20:20797859-20797881 CTACGAATGCGGGTGGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170934517 Original CRISPR CTACGAATGCGGGTGGGGAC TGG Intergenic
No off target data available for this crispr