ID: 1170936119

View in Genome Browser
Species Human (GRCh38)
Location 20:20811235-20811257
Sequence TTCTCCATCCTCAGGGTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170936119_1170936125 11 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936125 20:20811269-20811291 CTGGGTCCCTAAAGCACTGGAGG No data
1170936119_1170936122 -8 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG No data
1170936119_1170936126 12 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936126 20:20811270-20811292 TGGGTCCCTAAAGCACTGGAGGG No data
1170936119_1170936129 24 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936129 20:20811282-20811304 GCACTGGAGGGCTGACTTCCTGG No data
1170936119_1170936123 -7 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936123 20:20811251-20811273 TGGAGAAGCAGCAAGAGTCTGGG No data
1170936119_1170936124 8 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936124 20:20811266-20811288 AGTCTGGGTCCCTAAAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170936119 Original CRISPR TTCTCCATCCTCAGGGTCAC AGG (reversed) Intergenic
No off target data available for this crispr