ID: 1170936122

View in Genome Browser
Species Human (GRCh38)
Location 20:20811250-20811272
Sequence ATGGAGAAGCAGCAAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1170936117_1170936122 -4 Left 1170936117 20:20811231-20811253 CCAACCTGTGACCCTGAGGATGG No data
Right 1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG No data
1170936115_1170936122 2 Left 1170936115 20:20811225-20811247 CCTGTGCCAACCTGTGACCCTGA No data
Right 1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG No data
1170936119_1170936122 -8 Left 1170936119 20:20811235-20811257 CCTGTGACCCTGAGGATGGAGAA No data
Right 1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1170936122 Original CRISPR ATGGAGAAGCAGCAAGAGTC TGG Intergenic
No off target data available for this crispr